CN102675424A

CN102675424A - Polypeptide drug for resisting Hepatitis B virus X protein

Info

Publication number: CN102675424A
Application number: CN2011100618693A
Authority: CN
Inventors: 张晓东; 叶丽虹
Original assignee: Bio Tech Ltd Tianjin Top Tyke
Current assignee: TIANJIN TOPPHARM BIO-SCIENCE & TECHNOLOGY CO., LTD.
Priority date: 2011-03-15
Filing date: 2011-03-15
Publication date: 2012-09-19
Anticipated expiration: 2031-03-15
Also published as: WO2012122943A1; CN102675424B

Abstract

The invention relates to the field of polypeptide drugs, in particular to a polypeptide for resisting hepatitis B virus X protein and polynucleotide coding the polypeptide, and application of the polypeptide and the polynucleotide. Specifically, the invention relates to a polypeptide with functional activity of inhibiting hepatitis B virus X protein (HBX), and the polypeptide has activity of inhibiting HBX on a molecular level, a cell level and an animal level so as to inhibit hepatitis caused by infection of hepatitis B viruses, liver cirrhosis caused by repeated attacks of hepatitis, and liver cancer caused on the basis of liver cirrhosis. The polypeptide and a peptide stimulant of the polypeptide comprise functional fragments and functional variants of the polypeptide and the peptide stimulant, and genes for coding the polypeptide, the peptide stimulant or the functional fragments and the functional variants, and are widely used for preventing and treating liver diseases that attack after infection of Hepatitis B virus, including hepatitis, liver cirrhosis and liver cancer.

Description

Anti-hepatitis B virus X protein polypeptide drugs

Technical field

The present invention relates to the polypeptide drugs field, be specifically related to the polypeptide of anti-hepatitis B virus X protein and the polynucleotide of this polypeptide of coding, and their application.

Background technology

Liver cancer is one of malignant tumour that causes patient death, and its grade malignancy is high, and the PLC mortality rate is only second to cancer of the stomach in China, occupies second of China's mortality of malignant tumors.According to statistics, annual newly-increased liver cancer number 300,000 people of China, and annual PLC mortality number reaches 110,000.(hepatitis B virus HBV) infects the generation can cause hepatitis, liver cirrhosis and primary hepatocarcinoma to hepatitis B virus, is hepatitis B infected liver cancer afterwards at the liver cancer patient of China 80% or more, can be referred to as liver cancer after the hepatitis B.

HBV is the dna virus that is about 3.2Kb; Its ORFs is expressed hepatitis B virus surface antigen (HBsAg), rHBcAg (HBcAg), hepatitis-B virus polymerase and hepatitis B virus X antigen (HBxAg) and (or is referred to as hepatitis B virus X albumen; Be HBx), wherein HBx is the necessary factor of HBV dna replication dna.Because HBx is the necessary factor of HBV dna replication dna, therefore suppress the function of HBx, mean the infection that can suppress HBV, and hepatitis that causes thus and liver cirrhosis.

In addition, HBx promotes the growth and the propagation of liver cancer as trans-acting factor, is referred to as cancer protein.Research in molecular level, cell levels and animal level finds that also HBx has the very strong short hepatoma cell proliferation and the effect of migration.The transgenic mouse experiment proves that also HBx has the effect that significant promotion liver cancer takes place.The experimental results shows that the lasting existence that HBV infects can cause chronic hepatopathy, comprises the liver cirrhosis that chronic hepatitis, chronic hepatitis are shown effect repeatedly and taken place after the fibrillar connective tissue hyperplasia in the hepatic tissue that causes, and most of liver cancer that on the liver cirrhosis basis, takes place.In the chronic hepatopathy incidence and development process of (comprising hepatitis, liver cirrhosis and liver cancer), HBx has brought into play important effect.Therefore, HBx is the important target spot of prevention and treatment hepatopathy.

At present, the treatment of liver cancer is main with operation, be aided with interventional therapy, and chemotherapy effect is undesirable.The expression positive rate of HBsAg and HBxAg is up to more than 80% even 90% in the liver cancer tissue of clinical operation.Therefore, HBx is as the important virulence factor of liver cancer genesis and development, and finds its specific inhibitor, then has important significance for theories and practical clinical and is worth.Yet, because the three-dimensional conformation of HBx is resolved as yet completion at present, so be difficult to through its chemical inhibitor of HBx stereoscopic three-dimensional conformation design.

Polypeptide fragment can be used as medicine, and it is widely used clinically.For example, Zadaxin (thymopeptide) is the thymopeptide-5 that from calf thymus, extracts, and has the lymphocyte transformation of promotion, strengthens the active effect of macrophage phagocytic, can be used for treating panimmunity defective disease.The characteristics of polypeptide drugs are that pharmacological action is clear and definite, and are safe, and are easy to produce.But the discovery difficulty of polypeptide drugs is big, and its reason is that the most polypeptide fragment transformation period in vivo is short, directly influences pharmacodynamic action.

Summary of the invention

The present invention relates to a kind of hepatitis B virus X of inhibition albumen (hepatitis B virus X protein that has; HBx) polypeptide of functionally active; It has the activity that suppresses HBx on molecular level, cell levels and animal level; Thereby can suppress the hepatitis b virus infected hepatitis that causes, the liver cirrhosis of showing effect repeatedly and causing by hepatitis, and the liver cancer that on the liver cirrhosis basis, takes place.This polypeptide and its peptide mimics; The function fragment and the functional variant that comprise them; And the gene of these polypeptide of encoding, peptide mimics or their function fragment, functional variant, can be widely used in the hepatopathy behind the control hepatitis B infection, comprise hepatitis, liver cirrhosis and liver cancer.

On the one hand; The invention provides isolated polypeptide or peptide mimics; It comprises aminoacid sequence or its function fragment or functional variant shown in SEQ ID NO:1; Said polypeptide or peptide mimics have and suppress the proteic function of hepatitis B virus X, and can suppress the generation and the development of the chronic hepatopathy after hepatitis b virus infected.Chronic hepatopathy behind the said hepatitis B virus infection can comprise hepatitis, the liver cirrhosis of being shown effect repeatedly and being caused by hepatitis, and the liver cancer that on the liver cirrhosis basis, takes place.

In specific embodiments more of the present invention; Aforementioned polypeptides or peptide mimics, its aminoacid sequence that comprises, its function fragment or functional variant can have and the aminoacid sequence 70% shown in the SEQ ID NO:1 at least, and perhaps 80%; Perhaps 90%, and even higher homogeny.Preferably, these polypeptide or peptide mimics comprise any aminoacid sequence shown in SEQ ID NOs:1-6.

On the other hand, the present invention provides isolating polynucleotide, and said polynucleotide comprise the polynucleotide of aminoacid sequence, its function fragment or the functional variant of coding shown in SEQ ID NO:1; Or the polynucleotide of or strict hybridization complementary with the polynucleotide that comprise aminoacid sequence, its function fragment or the functional variant of coding shown in SEQ ID NO:1.Preferably, these polynucleotide are the polynucleotide of the aminoacid sequence shown in the coding SEQ ID NOs:1-6, perhaps are the polynucleotide of or strict hybridization complementary with the polynucleotide of the aminoacid sequence shown in the coding SEQ ID NOs:1-6.

On the other hand, the present invention also provides the recombinant expression vector that contains exogenous polynucleotide, and it comprises the polynucleotide of aminoacid sequence, its function fragment or the functional variant of coding shown in SEQ ID NO:1; Or the polynucleotide of or strict hybridization complementary with the polynucleotide that comprise aminoacid sequence, its function fragment or the functional variant of coding shown in SEQ ID NO:1.Preferably, these recombinant expression vector rights comprise the polynucleotide of the aminoacid sequence shown in the coding SEQ ID NOs:1-6, perhaps comprise the polynucleotide of or strict hybridization complementary with the polynucleotide of the aminoacid sequence shown in the coding SEQ ID NOs:1-6.The bright host cell that comprises above-mentioned recombinant expression vector that also provides of we.

In addition, the present invention also provides and comprises aforementioned polypeptides or the application in the medicine of making the metainfective chronic hepatopathy of hepatitis B virus resisting of peptide mimics, Nucleotide and recombinant expression vector.In a specific embodiment, said medicine can be the therapeutic vaccine of hepatitis B.Said medicine can comprise pharmaceutical composition, and it can comprise optional pharmaceutical carrier.

Among the present invention; Described polypeptide (comprising its function fragment or variant) and peptide mimics thereof; Effective supressor as HBx; Have the bioactive ability that suppresses HBx, can suppress the hepatitis b virus infected hepatitis that causes, liver cirrhosis that causes thus and the liver cancer that on the liver cirrhosis basis, takes place.What be worth to stress is that aforementioned polypeptides provided by the invention has tangible pharmacodynamic action, therefore can become treatment because the active drug of the hepatopathy that hepatitis B virus infection caused.

Description of drawings

Fig. 1: applying high voltage liquid chromatography (HPLC) is to the analytical results of synthetic polypeptide A nti-HBxP3# behind the purifying.

Fig. 2. application report gene test polypeptide gene plasmid of the present invention is to expressing the influence of the proteic liver cancer cell of HBx.The result shows that p-Anti-HBxP3# is active inhibited to NF-B promotor in HepG2-X cell, L-O2-X cell and the HepG2.2.15 cell, is dose-dependently, and the HepG2 liver cancer cell of no HBx and the L-O2 liver cell of no HBx are not had influence.Similarly, 5 of p-Anti-HBxP3# kinds of functional variant genes (0.15 μ g/well) have certain restraining effect to the activity of NF-B promotor in HepG2-X cell and the L-O2-X cell. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Fig. 3. detect polypeptide of the present invention activates the NF-B promotor to the HBx albumen of expressing at cell levels active influence.The result shows; The polypeptide A nti-HBxP3# of synthetic is active inhibited to the NF-B promotor in the proteic HepG2-X cell of expression HBx, L-O2-X cell and the HepG2.2.15 cell; And this restraining effect is dose-dependently, but HepG2 liver cancer cell and L-O2 liver cell that no HBx is expressed then do not have this influence. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Fig. 4. use MTT and detect transfection polypeptide gene plasmid of the present invention expressing the influence of the proteic liver cancer cell of HBx.The result shows, p-Anti-HBxP3# is to HepG2-X cell, L-O2-X cell and the growth of HepG2.2.15 cell and breed inhibitedly, and its effect is dose-dependently, but the HepG2 liver cancer cell and the L-O2 liver cell of no HBx expression then do not had influence.5 kinds of functional variant genes of p-Anti-HBxP3# (0.15 μ g/well) are also inhibited to the growth and the propagation of HepG2-X cell and L-O2-X cell.Behind the p-Anti-HBxP3# ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Fig. 5. use MTT and detect the influence of polypeptide of the present invention the growth of liver cancer cell.The result shows, using artificial synthetic polypeptide A nti-HBxP3# is to HepG2-X cell, L-O2-X cell and the growth of HepG2.2.15 cell and breed inhibitedly, and its effect is dose-dependently.And HepG2 liver cancer cell and L-O2 liver cell that no HBx is expressed do not have influence. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Fig. 6: the polypeptide A nti-HBxP3# of synthetic is to the effect of HepG2-X cell.The nude inoculation experimental result shows that using artificial synthetic polypeptide A nti-HBxP3# has the obvious suppression effect to growth of HepG2-X cell and propagation. ^*P＜0.01, Student ' s t test statistical analysis

Fig. 7. the polypeptide A nti-HBxP3# of synthetic is to the effect of HepG2.2.15 cell.The nude inoculation experimental result shows that using artificial synthetic polypeptide A nti-HBxP3# has the obvious suppression effect to growth of HepG2.2.15 cell and propagation.* P＜0.01, Student ' s t test statistical analysis

Fig. 8. make up the connection synoptic diagram of polypeptide carrier for expression of eukaryon.

Embodiment

Among the present invention, comprise specification sheets and claims, the following term of use has following implication unless stated otherwise:

" isolating " speech is meant to be separated material from its primary environment (for example, if spontaneous its natural surroundings that just refers to).Such as it is exactly not to be separated that spontaneous polynucleotide or polypeptide are present in the Live Animals, and same polynucleotide or polypeptide with some or all in natural system with it the material of coexistence separately be exactly isolating.Such polynucleotide or polypeptide can be the parts of a certain carrier, also can be the parts of a certain compsn.Since carrier and compsn are not the compositions of its natural surroundings, they remain isolating.

" purifying " speech means and on purity, has improved." purity " is relative terms at this, and unnecessarily is interpreted as absolute purity.For example, purity can be at least about 50%, maybe can be greater than 60%, 70%, 80%, 90%, maybe can be 100%.

As used among the present invention, isolating material is from its primal environment, to separate.Polynucleotide under the native state in the active somatic cell and polypeptide be do not have isolating, but same polynucleotide and polypeptide as from native state with in other materials that exist separately, then be isolating, be improved on the while purity, also so be purifying.

" nucleic acid ", " nucleotide sequence " or " base sequence " are meant Nucleotide, oligonucleotide or polynucleotide and fragment thereof or part.Nucleic acid of the present invention can (for example, mRNA) the form (for example, cDNA or genomic dna) of form or DNA exists with RNA.DNA can be double-stranded, also can be strand.Single stranded DNA or RNA can be in coding strand (sense strand) or the noncoding strand (antisense strand) any.In addition, polynucleotide of the present invention also can be at the polynucleotide of its 5 ' end or 3 ' end fusion code tag mark (sequence label or affinity tag sequence).They can be synthetic or from natural origin obtain (for example; Separate and/or purifying); It can comprise the Nucleotide of natural, non-natural or modified; And it can comprise the key between natural, non-natural or the Nucleotide that changes, such as phosphoramidic acid ester bond or phosphorothioate bond, is used for replacing the phosphodiester bond that in the oligonucleotide of unmodified, exists between the Nucleotide.

So-called " aminoacid sequence " or " polypeptide " is meant peptide, oligopeptides, polypeptide or protein and part fragment thereof, the amino acid that is connected with peptide bond therebetween.When " aminoacid sequence " among the present invention related to a kind of aminoacid sequence of naturally occurring protein molecule, this " polypeptide " or " protein " did not also mean that aminoacid sequence are restricted to the complete natural acid sequence relevant with said protein molecule.Aminoacid sequence of the present invention can contain additional peptide.As additional peptide, be example like the peptide of polyhistidine label (His-tag) or epi-position marks such as Myc, FLAG.

" disappearance " is meant the disappearance of in aminoacid sequence or nucleotide sequence one or more amino acid or Nucleotide.

" insertion " or " interpolation " is meant that the change in aminoacid sequence or nucleotide sequence causes with natural existence or the molecule before changing is compared the increase of one or more amino acid or Nucleotide.

" displacement " is meant by different amino acid or Nucleotide and replaces one or more amino acid or Nucleotide.

" lack, replace or add one or more amino acid or Nucleotide " then be meant, utilizes manufacture method disappearance, the displacement of known mutant nucleic acid such as kunkel method Kunkel or polypeptide or add the amino acid or the Nucleotide of the number of the degree that can lack, replace or add.Said mutation is not limited to utilize known fixed-point mutation method and the sudden change of artificial inductive, also can carry out separation and purification and obtains naturally occurring nucleic acid or proteinic sudden change.Can include one or more amino-acid residues to amino acid whose sudden change is that conformation is the amino acid of D-type, rare amino acid that nature exists or manually modified amino acid, and these amino acid can be also can not encoded by genetic codon.Similar therewith, induce nucleic acid to undergo mutation, can comprise the naturally occurring Nucleotide of nature, also can comprise Nucleotide with modification.

" function fragment " of polypeptide is meant any part of polypeptide of the present invention, and said part keeps similar or the identical basically BA and the function of its polypeptide as a part (i.e. " parent " polypeptide).

" functional variant " of polypeptide is meant and keeps basically like said polypeptide or same or analogous biological function of aminoacid sequence or active aminoacid sequence; They can comprise; For example, 1) one or more amino-acid residues have disappearance and/or one or more amino-acid residue to be added in the original acid sequence; Perhaps 2) one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues in the original acid sequence; Perhaps 3) certain group on one or more amino-acid residues is replaced by other group in the original acid sequence; Perhaps 4) original acid sequence and other molecule or the fusion of compound (such as sugar, lipid, polyoxyethylene glycol etc.); Perhaps 5) aminoacid sequence of original aminoacid sequence and the interpolation peptide sequence that merges and then form (like leader sequence or secretion sequence or be used for the sequence etc. of this polypeptide of purifying); Perhaps 6) the converse analogue of original acid sequence; Perhaps 7) mixing of various situation more than.Among the present invention; The functional variant of aminoacid sequence; Can include one or more amino-acid residues is that conformation is the amino acid of D-type, rare amino acid that nature exists or manually modified amino acid, and these amino acid can be also can not encoded by genetic codon.

" the converse analogue " of polypeptide is meant the polypeptide of the parent's polypeptid acid sequence that comprises counter-rotating, thus the aminoacid sequence of said converse analogue (when from the N end when the C end reads) with hold the parent's amino acid sequence of polypeptide when reading identical when holding from C to N; In addition, each amino acid is this amino acid whose D isomer in the converse analogue, and the D isomer is opposite with the L isomer.For example, the converse analogue of tripeptides Val-Ala-Gly has aminoacid sequence Gly-Ala-Val, and wherein each amino acid is the D isomer.

Among the present invention, " peptide mimics " is meant to have with the essentially identical universal architecture of corresponding polypeptide and have, and for example, can increase the compound of the modification of its stability or biological function.Peptide mimics comprises, for example, comprises those compounds with the same acid sequence of corresponding polypeptide, but therein between two or more amino acid, peptide mimics has the main chain of change.Said peptide mimics can comprise that the amino acid that synthetic or non-natural exist replaces naturally occurring amino acid.

Among the present invention, " the degeneracy varient " of nucleotide sequence is such polynucleotide sequence, and itself and parent nucleotide sequence are had any different, but coded protein or the polypeptide of encoded protein matter and polypeptide and parent nucleotide sequence is the same.

" nucleic acid hybridization " be well known in the art (referring to, for example, Sambrook etc., Molecular Cloning:A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory, 2001).Usually, temperature is high more, and salt concn is low more, and then preciseness becomes high more (being difficult to hybridization), thereby can obtain more identical polynucleotide.The hybridization temperature that is fit to is according to the length of base sequence or its base sequence and different.In addition, the invention still further relates in " stringent condition " hybridization down.Among the present invention; " stringent condition " is meant; Than hybridization under LIS and the comparatively high temps and wash-out; For example, incubated overnight under 42 ℃ the condition, in (denatured sheared salmon sperm dnas of sodium phosphate (pH7.6), 5 * Denhardt solution, 10% T 500 and the 20 μ g/ml of 50% methane amide, 5 * SSC (150mM NaCl, 15mM trisodium citrate), 50mM), then under 65 ℃ of conditions with 0.1 * SSC wash-out.

" homology " is meant the complementary degree, can be portion homologous, also can be complete homology." portion homologous " is meant a kind of part complementary sequence, and it can partly suppress the hybridization of complete complementary sequence and target nucleic acid.This inhibition can detect through hybridizing (Southern trace or Northern trace etc.) under the condition that reduces in the severity degree.Complete complementary sequence and target sequence combining under the condition that the severity degree reduces can competed and suppress to basic homologous sequence or hybridization probe.Certainly, the condition that severity reduces not is to allow nonspecific combination, and two sequences mutually combines, and still needs specificity or optionally interaction.

" homogeny " of aminoacid sequence or nucleotide sequence or " identity " percentage be meant two or more amino acid or nucleotide sequence relatively in, the same or analogous percentage of sequence.Have a lot of methods well known to those skilled in the art to measure the homogeny percentage, as through the MEGALIGN program (Lasergene software package, DNASTA, Inc., Madison, WI).The MEGALIGN program can compare two or more sequences (referring to Higgins & Sharp according to diverse ways such as Cluster method; Gene 73:237-244; (1988)); The Gluster method through the distance between all pairings of inspection with each group series arrangement cluster, then will be bunch with in pairs or become set of dispense.Homogeny percentage between two aminoacid sequences such as sequence A and the sequence B can pass through computes:

[(the residue number of mating between sequence A and the sequence B)/(the residue number of sequence A-sequence A interval residue number-sequence B interval residue number)] X 100%

In like manner, also can or use methods known in the art,, measure the homogeny percentage of nucleotide sequence like the method (referring to Hein J., Methods in Emzumology 183:625-645,1990) of Jotun Hein through the Cluster method.

" recombinant expression vector " is meant the oligonucleotide or the polynucleotide recombinant chou of genetic modification; This recombinant cloning has the nucleotide sequence of coding mRNA, albumen, polypeptide or peptide, after this expression vector gets into host cell, can express corresponding mRNA, albumen, polypeptide or peptide.Among the present invention, recombinant expression vector can comprise the nucleotide sequence of any type, but to be not limited only to be DNA or RNA, can be strand or two strands, synthetic or from natural, also can be Nucleotide non-natural or that change.Key between the Nucleotide can be naturally occurring, also can right and wrong naturally occurring or modify.

Among the present invention; " chronic hepatopathy behind the hepatitis B virus infection " is meant the hepatopathy that causes after hepatitis b virus infected; Comprise the liver cirrhosis that chronic hepatitis, chronic hepatitis are shown effect repeatedly and taken place after the fibrillar connective tissue hyperplasia in the hepatic tissue that causes, and most of liver cancer that on the liver cirrhosis basis, takes place.Liver cancer be the result of hepatitis B virus persistent infection, this liver cancer can be referred to as liver cancer after the hepatitis B.

Among the present invention, " treatment " and " prevention " and the word that derives from by their, but do not mean be 100% or treatment completely or prevention, can regard as treatment or prevention degree that those skilled in the art admit." prevention " among the present invention can be regarded as the outbreak that postpones disease or its symptom or illness.

Polypeptide

The present invention provides the polypeptide of isolated or purified.The polypeptide that the present invention relates to can be comprise, basically by or the polypeptide formed by aminoacid sequence Met-Glu-Pro-Gly-Ala-Gly-His-Leu-Asp-Gly-His-Arg-Ala-Gly-Ser-Pro (SEQ ID NO:1).Research confirms that these polypeptide can obviously suppress the activity of HBx, has the generation of the chronic hepatopathy behind the obvious inhibition hepatitis B virus infection and the effect of development, the more important thing is that these polypeptide can suppress to infect the growth and the propagation of the liver cancer cell that hepatitis B virus is arranged.

Said molecular level, cell levels and the animal level of being suppressed at all has embodiment.As, said polypeptide can suppress the promoter activity by HBx activated nf B (NF-B) on molecular level, thereby embodies the effective inhibition of said polypeptide to HBx, and its inhibition effect is dose-effect relationship; Said polypeptide also embodies the growth of the liver cancer cell that contains the HBx gene and effective inhibition of propagation function at cell levels, and it suppresses effect and also is dose-effect relationship; Show that through the nude inoculation method said polypeptide can effectively suppress to express the one-tenth knurl ability of the liver cancer cell of HBx in the animal level.Yet said polypeptide does not have influence to there being the promoter activity of expressing NF-B in the HBx liver cancer cell, does not have influence to having growth and the propagation of expressing the HBx liver cancer cell yet.

The present invention also provides the various function fragments of said polypeptide of the present invention.Said function fragment can be any fragment of the continuous amino acid sequence of polypeptide of the present invention, and condition is that it is compared with parent's polypeptide, can keep the biological activity of parent's polypeptide with similarity degree, same degree or higher degree, for example, suppresses the activity of HBx.With reference to parent's polypeptide; Said function fragment can comprise; For example, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 105%, 110%, 120%, 150%, 200% of parent's polypeptide or higher activity.Said function fragment can also comprise extra amino acid at amino or carboxyl terminal or its amino and the carboxyl two ends of above-mentioned continuous amino acid sequence fragment, for example, and with different amino acid in parent's amino acid sequence of polypeptide.If it is ideal that said extra amino acid does not hinder the biological function of said function fragment, for example, suppress the activity of HBx, and anticancer effectively, liver cancer cell preferably, the growth and the propagation that especially infect the liver cancer cell that hepatitis B virus is arranged.Even more ideal is that when comparing with the BA of said parent's polypeptide, said extra amino acid can cause the enhanced BA.The function fragment of polypeptide of the present invention comprises that the aminoacid sequence that has at least 70% sequence identity with said parent's polypeptide is a preferred sequence.In a concrete embodiment, N end and/or C end that function fragment of the present invention is included in said parent's polypeptide add amino acid, for example one or two amino acid.

In addition, the functional variant of polypeptide of the present invention and function fragment thereof is also included within the scope of the invention.The functional variant of said polypeptide of the present invention and function fragment thereof keeps and said parent's polypeptide or the similar or identical basically biological activity of parent's function fragment; For example; The activity that suppresses HBx; And suppress liver cancer cell effectively, especially infect the growth and the propagation of the liver cancer cell that hepatitis B virus is arranged.With reference to said parent's polypeptide or parent's function fragment, said functional variant can with have an appointment at least 50%, 60%, 70%, 80%, 90%, 95% or 100% identity of the aminoacid sequence of said parent's polypeptide or parent's function fragment.Preferably, the functional variant of polypeptide of the present invention and function fragment thereof comprises, and has at least 70% sequence identity with said parent's polypeptide or parent's function fragment.Preferred, the functional variant of polypeptide of the present invention and function fragment thereof comprises with said parent's polypeptide or parent's function fragment and has only 1-3 amino acid whose difference.Most preferably, the functional variant of polypeptide of the present invention and function fragment thereof comprises with said parent's polypeptide or parent's function fragment and has only 1 amino acid whose difference.

The functional variant of said polypeptide of the present invention and function fragment thereof can comprise, for example, comprises parent's polypeptide or parent's function fragment aminoacid sequence with at least one conservative amino acid replacement.Specifically, the functional variant of said polypeptide of the present invention and function fragment thereof can comprise have 2,3,4,5 or the parent's polypeptide of more a plurality of conservative amino acid replacements or the aminoacid sequence of parent's function fragment.In addition, the functional variant of said polypeptide of the present invention and function fragment thereof also can comprise the parent's polypeptide with at least one non-conservative amino acid replacement or the aminoacid sequence of parent's function fragment.Specifically, can comprise have 2,3,4,5 or the parent's polypeptide of more a plurality of non-conservative amino acid replacements or the aminoacid sequence of parent's function fragment.In these situations,, preferably do not hinder or suppress the biological function or the activity of said functional variant for described amino-acid substitution.More preferably, said amino-acid substitution improves the biological function or the activity of the functional variant of polypeptide of the present invention and function fragment thereof, so that when comparing with said parent's polypeptide or parent's function fragment, the biological function of said functional variant or active the raising.

Preferably, the functional variant of polypeptide of the present invention and function fragment thereof comprises one or more conservative amino acid replacements.In this area, conservative amino acid replacement is known, and it refers to such amino-acid substitution, that is, one of them amino acid with certain physics and/or chemical property is changed to the amino acid that another has identical chemistry or physical property.Those skilled in the art understand, and the amino-acid substitution of conservative property can not cause the remarkable change of proteinic structure or function.Typical preservative replacement comprises that for example, with acidic amino acid displacement another acidic amino acid (for example, AsP or Glu), another has amino acid (for example, Ala, the Gly of non-polar sidechain with the amino-acid substitution with non-polar sidechain; Val, Ile, Leu, Met, Phe, Pro; Trp, Val, etc.), with another basic aminoacids of basic aminoacids displacement (Lys, Arg, etc.); Another has amino acid (Asn, Cys, Gln, Ser, Thr, the Tyr of polar side chain with the amino-acid substitution with polar side chain; Deng), with aromatic amino acid (Trp, Phe, Tyr, etc.) replace another aromatic amino acid, etc.

In addition, the functional variant of polypeptide of the present invention and function fragment thereof can also comprise the converse analogue of any polypeptide of the present invention or function fragment.Among the present invention; " converse analogue " is meant the polypeptide of the parent's polypeptid acid sequence that comprises counter-rotating, thus the aminoacid sequence of said converse analogue (when from the N end when the C end reads) with hold the parent's amino acid sequence of polypeptide when reading identical when holding from C to N.In addition, about converse analogue, each amino acid is this amino acid whose D isomer, and the D isomer is opposite with the L isomer.For example, the converse analogue of tripeptides Val-Ala-Gly has aminoacid sequence Gly-Ala-Val, and wherein each amino acid is the D isomer.Among the present invention, said functional variant preferably includes the converse analogue of SEQ ID NO:1.

Polypeptide of the present invention (comprising function fragment) and functional variant thereof can be random lengths,, can comprise the amino acid of arbitrary number that is; Condition is that said polypeptide (comprising function fragment) and functional variant thereof keep necessary BA; For example, suppress the activity of HBx, and anticancer effectively; Preferably liver cancer cell especially infects the liver cancer cell that hepatitis B virus is arranged.For instance, polypeptide of the present invention (comprising function fragment and functional variant) can be a 4-2000 amino acid long, is 5,6,7,8,9,10,11 like length; 12,13,14,15,16,18,20,25,30; 40,50,60,70,80,90,100,125,150; 175,200,300,400,500,700,800,1000 or more.Preferably, polypeptide length of the present invention is 6-20 amino acid, and satisfies as the pharmacodynamics of polypeptide drugs and the requirement of transformation period.

In one embodiment; The functional variant of polypeptide of the present invention and function fragment thereof and parent's polypeptide SEQ ID NO:1 have an amino acid whose difference, and it has similar BA and the function with parent's polypeptide SEQ ID NO:1, for example; The activity that suppresses HBx; And anticancer effectively, liver cancer cell is preferably especially expressed the liver cancer cell of HBx.More specifically, the functional variant of polypeptide of the present invention and function fragment thereof comprises SEQ ID NOs:2-6.

The present invention also provides the said polypeptide peptide mimics of (comprising function fragment and functional variant).In a preferred embodiment, said peptide mimics is to intend peptide.Intend peptide and be meant such peptide mimics, wherein each amino acid whose side chain sticks on the amino acid whose nitrogen-atoms rather than on the α carbon.For example, intend peptide and can be regarded as N-metathetical glycocoll, it has NRCH ₂The repeating unit of CO universal architecture, and it has identical with corresponding polypeptide or essentially identical aminoacid sequence.In another preferred embodiment, said peptide mimics comprises the main chain of change, and wherein the key between each amino acid is methylated.In this, said peptide mimics can comprise the peptide main chain that methylates of following structure:

In polypeptide of the present invention (comprising function fragment and functional variant) and the peptide mimics, can comprise with synthetic amino acid and replace naturally occurring amino acid.Said synthetic amino acid is known in this area; Comprise; For example; Aminocyclohexane carboxylic acid, nor-leucine, alpha-amino group n-capric acid, homoserine, S-acetylamino methyl-halfcystine, trans-3-Hydroxyproline, trans-4-Hydroxyproline, 4-amino-benzene L-Ala, 4-benzoyl phenylalanine(Phe), 4-oil of mirbane L-Ala, 4-chlorophenylalanine, 4-carboxyphenylalanine, beta-phenyl Serine, beta-hydroxyphenyl L-Ala, phenylglycocoll, Alpha-Naphthyl L-Ala, Cyclohexylalanine, Cyclohexylglycine, indoline-2-carboxylic acid, 1; 2; 3; The different beautiful jade of 4-tetrahydrochysene-3-carboxylic acid, amidomalonic acid, amidomalonic acid list phthalein amine, N '-benzyl-N '-methyl-Methionin, N '; N '-dibenzyl-Methionin, 6-oxylysine, ornithine, alpha-amino group Cyclopentane carboxylic acid, alpha-amino group hexahydrobenzoic acid, alpha-amino group Cycloheptanoic acid, α-(2-amino-2-norbornane)-carboxylic acid, alpha, gamma-DAB, α, β-diaminopropionic acid, hyperphenylalaninemia and α-tert-butylglycine.

Polypeptide of the present invention as herein described (comprising function fragment and functional variant) and peptide mimics can also comprise cell-penetrating peptide (CPP).Said CPP promotes polypeptide of the present invention to pass cytolemma and gets in the cell.CPPs is well known in the art.Referring to, for example, Deshayes etc., cellular elements life science (Cell.Mol.Life Sci.) 62:1839-1849 (2005); EI-Andaloussi etc., modern medicines design (Curr.Pharm.Design.) 11:3597-3611 (2005).Said CPP can be in those any known in the art.

Polypeptide of the present invention (comprising function fragment and functional variant) and peptide mimics are all right; For example; By fatization (for example; The fat acidifying), glycosylation, amidation, carboxylic acidization, phosphorylation, esterification, N-acidylate, through the disulfide linkage cyclisation, change into acid salt, Dimerized or polymerization, and/or puting together.

For instance, polypeptide according to the invention (comprising function fragment and functional variant) and peptide mimics can be the fat verivates.Contained lipid molecule can comprise any lipid known in the art, for example, and lipid acid, phosphatide group, glycophosphatidyl inositol; Phosphatidylserine, phosphatidylethanolamine, sphingophospholipid, phosphatidylcholine, Val; PI, phosphatidic acid, lysophosphoglyceride and SUV group.Preferably; Said fat verivate is a derivative of fatty acid; Said fatty acid molecule can be any C8-C20 lipid acid, for example, and LAURIC ACID 99 MIN, palmitinic acid, tetradecanoic acid, Triple Pressed Stearic Acid, oleic acid, linolic acid, linolenic acid, arachidonic acid, timnodonic acid, erucic acid or eicosanoic acid etc.Said lipid acid can also randomly comprise other functional groups on the carbon atom arbitrarily, for example, and one or more amino.Said fatty acid molecule can be attached to any suitable part of polypeptide of the present invention (comprising function fragment and functional variant) and peptide mimics.For example, comprise fatty acid molecule at polypeptide aminoterminal of the present invention, carboxyl terminal or amino and carboxyl two ends.Fatty acid molecule can directly or through linker be attached on polypeptide of the present invention (comprising function fragment and functional variant) and the peptide mimics.

Polypeptide of the present invention (comprising function fragment and functional variant) and peptide mimics comprise for example derivative of fatty acid of its verivate, can also be monomeric peptide, dimerization peptide or polymer peptide.

Polypeptide of the present invention (comprising function fragment and functional variant) and peptide mimics can be known by one of skill in the art method obtain (referring to, for example, Chan etc.; Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford; Britain, 2005; Reid, R., Peptide and Protein Drug Analysis, Marcel Dekker Company, 2000; And U.S. Patent number 5,449,752).In addition, also can obtain by nucleic acid recombination method production polypeptide (referring to, for example; Sambrook etc., molecular cloning: laboratory manual (Molecular Cloning:A Laboratory Manual), the 3rd edition; Cold spring port press (Cold Spring Harbor Press); The cold spring port, New York, 2001).In addition, polypeptide more of the present invention (comprising its function fragment and functional variant) can be from like plant, bacterium, insect, Mammals such as separation and/or purifying such as rat, people.The method of separation and purifying also is known in this area.Alternatively, polypeptide as herein described (comprising its function fragment and functional variant) can be bought from the synthetic back of commercial company and obtain.

Polynucleotide

The present invention also provides the isolating polynucleotide of any described polypeptide of the present invention (comprising function fragment and functional variant) of coding.Said polynucleotide comprise coding any polypeptide of the present invention (comprising function fragment and functional variant) encoding sequence, the nucleotide sequence SEQ ID NO:7 of the SEQ ID NO:1 that for example encodes, and any degeneracy varient of these encoding sequences; Alternatively, said polynucleotide can also comprise additional code sequence and/or non-coding sequence.On the other hand; The present invention also provides and comprises so isolating polynucleotide or its fragment, and the nucleotide sequence that it comprised and the nucleotide sequence of any nucleic acid of the present invention are complementary or under stringent condition and the nucleotide sequence hybridization of any polynucleotide of the present invention.

The present invention also provides the varient of above-mentioned polynucleotide, and its coding has the polypeptide of identical aminoacid sequence or functional fragment, the functional variant of polypeptide with polypeptide of the present invention (comprising function fragment and functional variant).The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it possibly be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

Polynucleotide of the present invention can be that natural existence obtains through purifying, also can produce through reorganization, perhaps can be based on chemosynthesis/or enzyme ligation, and use methods known in the art and make up.Polynucleotide of the present invention can contain naturally occurring Nucleotide, also can comprise the Nucleotide with modification.The physical stability of the duplex that said Nucleotide with modification forms when being designed to increase the biological stability of molecule or being increased in hybridization (for example; Thiophosphoric acid verivate and acridine metathetical Nucleotide); Comprise; For example; 5 FU 5 fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, xanthoglobulin, xanthine, 4-acetylcytosine, 5-(carboxyl hydroxymethyl) uridylic, 5-methoxyl group amino methyl-2-thiouracil, uridylic-5-oxyacetic acid, 5-methyl-2-thiouracil, 2-sulphur cytosine(Cyt), 2-thiouracil, 4-thiouracil, methyl uracil, uridylic-5-oxyacetic acid methyl ester, 3-(3-amino-3-N-2-carboxylic propyl group) uridylic and 2,6-diaminopurine etc.And the key that it can comprise between the Nucleotide natural or that change such as phosphoramidic acid ester bond or phosphorothioate bond, is used for replacing naturally occurring phosphodiester bond.Preferably, nucleic acid of the present invention is that reorganization produces.

Recombinant expression vector

The present invention also provides the recombinant expression vector that comprises any polynucleotide of the present invention.Said recombinant expression vector can be any suitable recombinant expression vector, and can be used for transforming or any appropriate host cell of transfection.Appropriate carriers comprises and is designed for breeding and amplification or is used for expressing, or is used for the two simultaneously, like plasmid or virus.Said carrier can be serial through following independent assortment: pUC series, pcDNA, and pBluescript, pET series, pGEX is serial and pEX is serial.Can also use phage vector, such as λ GT10, λ GT11, λ ZaPII, λ EMBL4 etc.Plant expression vector can comprise pBI01, pBI101.2, pBI101.3, pBI121 and pBIN19.The animal expression carrier can comprise pEUK-C1, pMAM and pMAMneo.Preferably, the present invention provides pcDNA the plasmid of series.

Can use standard recombinant dna technology preparation recombinant expression vector of the present invention.Can prepare annular or linear expression vector establishment body, to be included in acting dubbing system in protokaryon or the eukaryotic host cell.Ideally, said recombinant expression vector comprises regulating and controlling sequence, such as transcribing and translation initiation and terminator codon.The host type that said regulating and controlling sequence is introduced for said carrier (for example, bacterium, fungi, plant or animal) is specific.

Said recombinant expression vector can comprise one or more marker gene, and it allows to select host that transform or transfection.Marker gene comprises the resistance to biocide, and is for example complementary so that prototroph to be provided in the auxotrophy host to the resistance of microbiotic, heavy metal etc., and catalysis biological fluorescence or the like.The marker gene suitable for expression vector of the present invention comprise, for example, and Xin Meisu/G418 resistant gene, the plain reporter gene of luciferase, hygromycin gene, histidinol resistant gene, tetracycline resistance gene and ampicillin resistance gene.

Said recombinant expression vector can comprise natural or non-natural promotor.The selection of promotor, for example, strong, weak, induction type, organizing specific type and grow Idiotype are within technician's common skill.Similarly, the combination of nucleotide sequence and promotor is also within technician's technical ability.Promotor can be non-viral promotors or viral promotors, for example, and cytomegalovirus (CMV) promotor, SV40 promotor, RSV promotor and the promotor that in murine stem cell virus length is terminal repetition, exists.Recombinant expression vector of the present invention can be designed for transient expression, is used for stably express or is used for the two.In addition, said recombinant expression vector can be prepared into and be used for constitutive expression or be used for inducible expression.

In addition, said recombinant expression vector can comprise suicide gene.The gene that causes necrocytosis after " suicide gene " is meant and in cell, expresses.Suicide gene can influence the susceptibility of cell to certain reagent such as medicine after expressing, and then causes necrocytosis.Suicide gene in this area be known (referring to, for example, suicide gene therapy: method and summary (Suicide Gene Therapy:Methods and Reviews); Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton; Surrey; UK), Humana Press, 2004); For example simple scar exanthema virus (HSV) thymidine kinase (TK) gene and purine nucleoside phosphatase, and TNT nitroreductase etc.

Host cell

The present invention also provides the host cell that comprises any recombinant expression vector as herein described.Host cell is the cell that comprises any kind of recombinant expression vector of the present invention.Host cell can be an eukaryotic cell, and for example, plant, animal, fungi or algae perhaps can be prokaryotic cell prokaryocytes, for example, and bacterium or protozoon.Host cell can be cultured cells or primary cell, that is, and directly from organism such as the isolating primary cell of people.Host cell can be the cell of attached cell or suspension, that is, and and the cell of in suspension, growing.Appropriate host cell is known in this area, comprises, for example, DH5 α Bacillus coli cells, Chinese hamster ovary cell, monkey VERO cell, COS cell, HEK293 cell, or the like.For the purpose that increases or duplicate said recombinant expression vector, said host cell is prokaryotic cell prokaryocyte preferably.For the polypeptide or the proteic purpose that produce recombinant modified, host cell is mammalian cell preferably.Human archeocyte is preferred host cell.Host cell can be any cell type, can be from the tissue of any kind, and can be any etap.

The present invention also provides the cell colony that comprises at least a host cell as herein described.Said cell colony can be an xenogenesis colony, comprises the host cell that comprises any said recombinant expression vector, and at least a other cell; For example, the host cell (for example, T cell) that does not comprise any said recombinant expression vector; Or the cell except that the T cell; For example, B cell, scavenger cell, neutrophilic granulocyte, red corpuscle, liver cell, endotheliocyte, epithelial cell, myocyte, brain cell, or the like.Alternatively, said cell colony can be same basically kind of groups, and wherein said colony mainly comprises the host cell (for example, mainly being made up of the host cell that comprises said recombinant expression vector) that comprises said recombinant expression vector.Said colony can also be the clonal population of cell, and all cells of wherein said colony is the clone who comprises the single host cell of recombinant expression vector, so that all cells of this colony comprises said recombinant expression vector.In one embodiment of the invention, said cell colony is the clonal population that comprises the host cell that comprises recombinant expression vector as herein described.

Conjugate

The present invention also comprises conjugate, for example, bioconjugates, it comprises in polypeptide of the present invention (comprising function fragment and functional variant) and peptide mimics, polynucleotide, recombinant expression vector or the host cell any.Conjugate; And the method for synthetic usually conjugate in this area also be known (referring to; For example, Hudecz, F.; Molecular biology method (Methods Mol.Biol.) 298:209-223 (2005) and Kirin etc., inorganic chemistry (Inorg.Chem.) 44 (15): 5405-5415 (2005)).

Pharmaceutical composition

Above-mentioned various materials provided by the present invention comprise that (generally being called " material of the present invention ") such as polypeptide (comprising function fragment and functional variant) and peptide mimics, derivative of fatty acid, polynucleotide, recombinant expression vector and host cell (comprising its colony), conjugates can be isolating, purifying, synthetic and/or reorganization.

Material of the present invention can also be mixed with compsn, such as pharmaceutical composition.In this; The present invention provides and comprises any said polypeptide (comprising function fragment and functional variant) and peptide mimics, derivative of fatty acid, conjugate, nucleic acid, recombinant expression vector and host cell (comprising its colony), and the pharmaceutical composition of pharmaceutical carrier.The pharmaceutical composition of the present invention that comprises any material of the present invention can comprise more than a kind of material of the present invention, for example: polypeptide and nucleic acid, or two kinds or more different polypeptides.Alternatively, said pharmaceutical composition can comprise the combination with another kind of or multiple pharmaceutically active agents or medicine.Said another kind or multiple pharmaceutically active agents or medicine preferably can comprise such as chemotherapeutics, for example, and asparaginase, busulfan, carboplatin; Cis-platinum, daunorubicin, Dx, Fluracil; Gemcitabine, hydroxyurea, methotrexate, taxol; Rituximab, vinealeucoblastine(VLB), vincristine(VCR), or the like.

In a preferred embodiment of the invention, said pharmaceutical composition comprises the material of the present invention that makes up with lipid.Said lipid can be any lipid, comprises lipid acid, phosphatide, sterol, sphingolipid, terpene, glyceride, glycerophosphate, isopentene alcohol ester, glycolipid and polyketide etc.Said fat is known in this area.

About pharmaceutical composition, pharmaceutical carrier can be used those of any conventional, and they can only pass through the chemical physics factor, such as the reactivity of solvability and shortage and active compound, and the approach through using, and limit.Pharmaceutical carrier of the present invention, for example, vehicle, adjuvant, vehicle and thinner etc. are well known to a person skilled in the art, and are obtained by the public easily.Preferably, said pharmaceutical carrier is chemically inert to active agent, under working conditions, does not have harmful side effect or toxicity.

The selection of carrier should be by specific material of the present invention and by the ad hoc approach decision that is used to use material of the present invention.Therefore, the multiple suitable preparation that has pharmaceutical composition of the present invention.Followingly be used in oral, aerosol, parenteral, subcutaneous, intravenously, intramuscular, intra-arterial, the sheath, the preparation of intraperitoneal, rectum and vaginal is exemplary, and restriction never in any form.Can use more than a kind of approach and use material of the present invention, in particular condition, specific approach can provide the more direct and more efficient methods than another kind of approach.

In a preferred embodiment of the invention, said pharmaceutical composition is topical formulations, iv formulation or subcutaneous preparations.In a preferred embodiment of the invention, said drug regimen is a topical formulations.Topical formulations is well known to a person skilled in the art.Be administered in the situation of skin peptide in the present invention, said preparation is particularly suitable for.Topical formulations of the present invention can be, for example, and paste, washing lotion, ointment, paster, oil, paste, sprays, the liquid of for example aerosol spray agent, gel, roll daubing type, solid bar etc.Preferably, topical formulations of the present invention is paste, washing lotion, ointment or paster.

Be applicable to that Orally administered preparation can be made up of following: a) liquor, such as the material of the present invention that is dissolved in the significant quantity in thinner such as water, salt solution or the orange juice; B) capsule, tablet, lozenge etc., each comprises really quantitative in advance, solid or granular activeconstituents; C) pulvis; D) suspension in suitable liquid; And e) suitable emulsion.Liquid preparation can comprise thinner, and such as water and alcohol, for example, ethanol, phenylcarbinol and polyoxyethylene glycol can add or not add medicinal surfactant.Capsule form can be common hard or soft-shelled gelatin type, and it comprises, for example, and tensio-active agent, lubricant and inert filler such as lactose, sucrose, calcium phosphate and W-Gum.Tablet form can comprise one or more in following: lactose, sucrose, N.F,USP MANNITOL, W-Gum, yam starch, alginic acid, Microcrystalline Cellulose, Sudan Gum-arabic, gelatin, X 5363, silica colloidal, talcum, Magnesium Stearate, calcium stearate, Zinic stearas, the Triple Pressed Stearic Acid vehicle compatible with other vehicle, tinting material, thinner, buffer reagent, disintegrating agent, wetting agent, sanitas, seasonings and other medicines.Lozenge form can comprise and is in seasonings normally at the material of the present invention of sucrose or Sudan Gum-arabic; And comprise the pastille that is in the material of the present invention in inert base such as gelatin and glycerine or sucrose and the Sudan Gum-arabic, comprise emulsion, gel of vehicle known in the art etc. in addition.

Material of the present invention, independent or with other suitable composition combination, can process the aerosol formulation of using through sucking.These aerosol formulations can be placed in the pressurization available medium, such as Refrigerant 12, propane, nitrogen etc.They can also be mixed with non-pressurised preparation, as in atomizer or spraying gun.Said spray agent can also be used for spraying to mucous membrane.

The preparation that is suitable for parenteral administration comprises water-based and non-aqueous, isotonic sterile injection liquid; It can comprise inhibitor, buffer reagent, fungistat and make said preparation and expection acceptor's the isoosmotic solute of blood; And water-based and non-aqueous sterile suspension, it can comprise suspensoid, solubilizing agent, thickening material, stablizer and sanitas.Material of the present invention can be in pharmaceutical carrier physiology with using in the thinner; Such as sterile liquid or liquid mixture; Comprise water, salt solution, aqueous glucose and relevant sugar soln, alcohol like ethanol or hexadecanol, glycol such as Ucar 35 or polyoxyethylene glycol, dromisol, glycerine, ketal as 2,2-dimethyl--1,3-dioxolane-4-methyl alcohol, ether, oil, lipid acid, fatty ester or glyceryl ester; Or acetylizad glycerin fatty acid ester; Add or do not add medicinal surfactant such as soap or stain remover, suspensoid such as pectin, methylcellulose gum, Vltra tears or n-formyl sarcolysine base Mierocrystalline cellulose, or emulsifying agent and other medicinal adjuvant.

The oil that can be used in the parenteral administration comprises oil, animal oil, vegetables oil or synthetic oil.The specific examples of oil comprises peanut oil, VT 18, til, Oleum Gossypii semen, Semen Maydis oil, sweet oil, oil and MO.The suitable lipid acid that is used in the parenteral administration comprises oleic acid, Triple Pressed Stearic Acid and Unimac 5680.

The suitable soap that is used in the parenteral administration comprises fatty basic metal and triethanolamine salt etc., and contains suitable stain remover, for example a) cationic detergent: dimethyl dialkyl ammonium halide and alkyl halide pyridine; B) anionic detergent: alkyl, aryl, olefin sulfonate, alkyl, alkene, ether, single sulfuric ester of glycerol and sulfosuccinic ester etc.; C) nonionic detergent: fatty amine oxide, Marlamid and T 46155 polypropylene copolymer etc.: d) both sexes stain remover: alkyl-β-An Jibingsuan ester and 2-alkyl-imidazoline quaternary ammonium salt; E) their mixture.

Said parenteral administration can contain the material of the present invention that is approximately 0.5-25% (bulking value percentage concentration) in solution.Can use sanitas and buffer reagent.In order to minimize or eliminate the pungency in the injection site, said compsn can comprise the nonionogenic tenside of one or more wetting ability-lipophilic balance (HLB).Amount of surfactant is about 5-15% (bulking value percentage concentration) in said preparation.Suitable tensio-active agent comprises the high molecular weight adducts of polyoxyethylene glycol sorbitan fatty(acid)ester and oxyethane and hydrophobic group, and said adducts forms through condensed epoxy propane and Ucar 35.Said parenteral administration may reside in unitary dose or the multiple doses sealed vessel, and can be kept under the condition of lyophilize (freeze-drying), only need before be about to using, add the sterile liquid vehicle such as water is used for injection.Can be by sterile powder, granule and the tablet prepn of previous said kind interim injection solution and suspension.

Material of the present invention or comprise that the compsn of said material of the present invention can also process injectable formulation.Injectable composition is known to a person of ordinary skill in the art to the needs of effective pharmaceutical carrier.Preferably, when being applied to cell for example during dendritic cell, said cell is used through injection.

In addition, invention material of the present invention, or comprise the compsn of said invention material can be prepared into suppository through mixing with various matrix such as emulsifying base or water-soluble base.For example be suitable for that the preparation of vaginal can exist with vaginal suppository, tapon, paste, gel, paste, foaming agent or spray agent, except its activeconstituents, also comprise known those suitable carriers in this area.

It will be understood by a person skilled in the art that except aforementioned pharmaceutical compositions invention material of the present invention can also be formulated as and comprise mixture, comprises mixture such as Schardinger dextrins, or liposome.

In order to reach the object of the invention, amount of substance of using of the present invention or dosage should produce for example treatment or prevention response in experimenter or animal in the reasonable time scope.For example, the dosage of material of the present invention should be enough to constantly about more than 2 hours as in 12-24 hour or the longer time durations from using, and the propagation of inhibition diseased cells plays and treats or the effect of preventing disease (for example, tumour, cancer etc.).In certain embodiments, said time durations even can be longer.Dosage should be by the situation of the effect of specific material of the present invention and animal to be treated (for example, the people), and the body weight of animal (for example, people) is confirmed.Many measuring methods of confirming application dosage are known in the art.The dosage of material of the present invention also will be confirmed through existence, the nature and extent of using any spinoff that specific material of the present invention possibly follow.

Those of ordinary skills should understand easily, and material of the present invention can be modified by any way, to improve the treatment or the prevention effects of material of the present invention.For example, material of the present invention can be directly or through linker indirectly and the part of target put together.Make compound, for example, material of the present invention, the practice with targeting moiety is puted together is known in the art.As referring to, Wadwa etc., drug targeting magazine (J.Drug Targeting), 3:111, (1995) and U.S. Patent number 5,087,616.In another embodiment, material of the present invention can be modified to the depots form again, so as to make material of the present invention be discharged into its intravital mode of using in time and body, be controlled aspect the position (referring to, for example, U.S. Patent number 4,450,150).The depots form of material of the present invention can be, for example, comprises the implantable compsn of material of the present invention and porous or non-porous material such as polymkeric substance, and material wherein of the present invention spreads through the degraded of said material and/or said non-porous material.Then, the desired site that depots is implanted, and material of the present invention discharges from said implant with predetermined speed.

It should be appreciated by those skilled in the art that provided by the invention preventing and the method for anticancer growth and propagation, comprise diseased cells is contacted with the of the present invention any pharmaceutical composition with effective inhibitory amount.Can adopt the method for any conventional that pharmaceutical composition according to the invention is passed to cancer cells.In an embodiment preferred of the inventive method, give the host through topical application with said pharmaceutical composition.In another preferred embodiment, said pharmaceutical composition is applied directly to cancer cells, for example, and intra-tumor delivery.

Pharmaceutical composition of the present invention; Comprise polypeptide (comprising function fragment and functional variant) and peptide mimics, nucleic acid, recombinant expression vector and/or host cell; Can be used in and prevent and suppress the hepatitis b virus infected chronic hepatopathy that brings out; Comprise hepatitis, and in the method for consequent liver cirrhosis and liver cancer.Those of ordinary skills should understand easily, and the chronic hepatopathy that is brought out by hepatitis B virus of the present invention may reside among any host.Preferably, said host is a Mammals.Particularly preferably, said host is the people.

Below in conjunction with specific embodiment, the present invention is done further to set forth explanation.Should be understood that these embodiment only to be used to the present invention is described and do not lie in the restriction scope of the present invention.Experimental technique among the following embodiment like no specified otherwise, is ordinary method; Used material like no specified otherwise, is to buy from routine biochemistry reagent company and obtains.

Embodiment one: the design of polypeptide and preparation

Artificial synthetic polypeptide function fragment Anti-HBxP3#:

The present invention uses artificial synthetic method to synthesize the polypeptide (to call Anti-HBxP3#) of aminoacid sequence as Met-Glu-Pro-Gly-Ala-Gly-His-Leu-Asp-Gly-His-Arg-Ala-Gly-Ser-Pro (SEQ ID NO:1).Solid phase synthesis process is adopted in the preparation of this polypeptide; As use AAPPTECApex396 type Peptide synthesizer device (available from the global analytical and testing instrument in Hong Kong ltd); In airtight implosion guard reactor drum, make amino acid by the sequence shown in the SEQ ID NO:1; To N end-aminoterminal, this is meant that first amino acid monomer that is added into this aminoacid sequence Met-Glu-Pro-Gly-Ala-Gly-His-Leu-Asp-Gly-His-Arg-Ala-Gly-Ser-Pro is the Pro of C-terminal, and then is Ser from C end-carboxyl terminal; Be Gly again; Until the last Glu and the Met of N-terminal, constantly add, reaction, synthetic, operation finally obtain the aminoacid sequence that will have.Solid-phase synthesis has alleviated the difficulty that per step product is purified greatly.In order to prevent the generation of side reaction, the amino acid whose side chain of participating in reaction all is shielded.Carboxyl terminal is a free, and must activation before reaction.

Concrete synthesizing is made up of following several cycles:

1) go protection: the pillar of Fmoc protection and monomer must use a kind of basic solvent (piperidine) to remove amino blocking group.

2) activate and crosslinked: next amino acid whose carboxyl is by the activation of a kind of acvator institute.The amino cross-linking reaction of activatory monomer and free forms peptide bond.Using a large amount of ultra concentration reagent to order about reaction in this step accomplishes.Circulation: this two-step reaction circulates repeatedly and accomplishes up to synthetic.

3) wash-out and deprotection: polypeptide elutes from post, and its blocking group is by a kind of deprotection agent (TFA) wash-out and deprotection.Synthetic from C end (carboxyl terminal) to N end (aminoterminal), be fixed on first amino acid Pro of C end on the resin, slough the amino acid whose blocking group of Pro; And the carboxyl terminal of the next amino acid Ser of activation, make it to contract and react, arrive by that analogy synthesized last amino acid after; Cut down from resin, thick peptide obtains the Anti-HBxP3# of 98% purity through the HPLC purifying; Do further evaluation through mass spectrum at last, its molecular weight is 1589.4Kd.

In solid phase synthesis, the prolongation of peptide chain is carried out on insoluble polystyrene resin carrier.Earlier terminal and chloromethyl polystyrene resin (Benzyl Chloride ester resin) the reaction formation benzyl ester of the C-of synthetic polypeptide is added up the protected amino acid of aminoterminal by the order of peptide chain primary structure then one by one, makes peptide elongation.

Artificial synthetic polypeptide Anti-HBxP3# analyzes with HPLC (HPLC) (using PLC Agela C18 post), shows that the purity that is obtained is 98.997% (Fig. 1).

Embodiment two: the anti-HBx of (in vitro) polypeptide that exsomatizes is active

Adopt two kinds of methods to detect the activity of the anti-HBx of the polypeptide among the embodiment one under the situation of exsomatizing: first method is to adopt molecule clone technology; The cDNA that expresses the polypeptide among the embodiment one is cloned on the carrier for expression of eukaryon pcDNA3.1 (+); Through gene transfection; In liver cancer cell, realize expressing the purpose of the polypeptide of studying, and then the polypeptide of observation post's research suppresses the effect of HBx; Second method is to adopt the polypeptide of synthetic, directly joins in the nutrient solution of cultivating liver cancer cell, observes the effect that polypeptide suppresses HBx.

The liver cancer cell that adopts in the experiment has two kinds: a kind ofly be the liver cancer HepG2-X cell of constitutive expression HBx (the liver cancer HepG2 cell of stable transfection HBx); A kind of is the liver cancer HepG2.2.15 cell (the liver cancer HepG2 cell of the full gene of stable transfection HBV) of the full gene of constitutive expression hepatitis B virus.Because HBx has the effect of activating transcription factor NF-κ B,, detect HBx at molecular level and whether be suppressed through the luciferase reporter gene detection method; Because HBx has the effect that promotes liver cancer cell growth and propagation in liver cancer cell; Can pass through 3-(4; 5-dimethyl--2-thiazole)-2, the polypeptide among 5-phenylbenzene tetrazole bromine salt (MTT) the detection embodiment one is to the influence of above-mentioned HepG2-X cell and HepG2.2.15 cell proliferation.

A. polypeptide Construction of eukaryotic

1. main raw:

1) bacterial strain: E.coli DH5 α (available from Yuanping City white (Tianjin) Bioisystech Co., Ltd)

Plasmid: pcDNA3.1 (+) (available from Invitrogen), pEGFP-C2 (available from Invitrogen)

2. main agents

3. main solution preparation:

1) LB liquid nutrient medium

Tryptone 2.0g

Yeast extract 1.0g

NaCl 2.0g

Add the distilled water dissolving and be settled to 200ml

1.03 * 10 ⁵Pa steam sterilizing 20min.

2) LB solid medium

1.03 * 10 ⁵Pa steam sterilizing 20min.

3) 10mg/ml ethidium bromide

Ethidium bromide 0.2g

Distilled water 20ml

Working fluid: 0.5ug/ml

4) TBE electrophoretic buffer

5 * stock solution:

Tris alkali 54g

Boric acid 27.5g

0.5mol/L?EDTA(pH?8.0) 20ml

Add distilled water and be settled to 1000ml

4. annealing system

5. annealing conditions: 95 ℃, 2 minutes; Descended 0.1 ℃ to 25 ℃ 90 minutes in per 8 seconds; 4 ℃, ∞.

6.pcDNA3.1 a small amount of of (+) empty plasmid carrier is extracted

The DH5 α bacterial strain that contains pcDNA3.1 (+) plasmid that this laboratory is preserved carries out activation, and the picking mono-clonal adds (containing ammonia benzyl mycin 100mg/L) 37 ℃ of incubated overnight in the LB liquid nutrient medium.Use the little extraction reagent kit of TransGen plasmid to extract plasmid.

7. double digestion reaction system:

Behind the mixing, 37 ℃ were reacted 3-6 hour.

8. ligation system:

16 ℃ of reactions are spent the night behind the mixing.The synthetic alkali basic sequence comprises atggagccaggtgcaggtcacctcgacggtcac

Cgcgcgg ggagccca (SEQ ID NO:7), it is as shown in Figure 8 to connect synoptic diagram.

9. step of converting

1) DH5 α competence bacterial strain (available from TianGen, 100 μ l) is thawed on ice;

2) in super clean bench, 25 μ l in the step 8 are connected product and contain in the centrifuge tube of competence bacterium whole the adding,, left standstill on ice 30 minutes with rifle head mixing;

3) centrifuge tube is put into the accurate heat shock of 42 ℃ of water-baths 90 seconds;

4) put into immediately and leave standstill 2 minutes on ice;

5) in centrifuge tube, add 500 μ l non-resistant LB liquid nutrient mediums, cultivated 45 minutes in advance for 37 ℃;

6) get 100 μ l bacterium liquid (can do the appropriateness adjustment) and evenly coat on the LB solid culture plate and (contain ammonia benzyl mycin 100mg/L) according to the dense degree that forms the clone, treat that liquid infiltrates substratum after, be inverted 37 ℃ of overnight cultures;

7) treat to grow on the flat board after the apparent mono-clonal bacterial plaque, with connecing independently mono-clonal 37 ℃ of overnight cultures in the LB liquid nutrient medium of the careful picking of acicula.

10. bacterium colony PCR reaction system

11. bacterium colony PCR reaction conditions:

Negate answered product in 1.5% sepharose, to carry out electrophoretic analysis after reaction finished.Positive colony is delivered biotech firm to check order.And with this plasmid called after p-Anti-HBxP3#.

B. external validity experiment

1. clone:

The clone of using in table 1 experiment

2. main agents

3. two luciferase reporter gene analyses

(1) with the cell of logarithmic phase (for the cell of enumerating in the above-mentioned table 1) with 0.75 * 10 ⁵The density of individual/ml is inoculated in 24 porocyte culture plates, and 500 μ l cells are inoculated in every hole, when cell converges to 90%, carry out gene transfection.

(2) promotor reporter gene carrier (pGL3-NF-κ B; 0.3 μ g; Available from Yuanping City white (Tianjin) Bioisystech Co., Ltd) be confidential reference items simultaneously with liposome transfection to cell respectively with renilla luciferase expression vector (pRL-TK, 0.1 μ g can be available from Promega company).The polypeptide plasmid (0.25 μ g, 0.5 μ g and 0.75 μ g) that is obtained by steps A of transfection different mass or add the synthetic polypeptide (0.1 μ M, 1 μ M, 10 μ M and 100 μ M) that is obtained by embodiment 1 of different concns simultaneously, each concentration repeats 3 holes.

(3) 48 hours (or using artificial synthesizes back 24 hours of polypeptide A nti-HBxP3# effect) after transfection, cell is washed 3 times with PBS.

(4) add 100 μ l, 1 * Passive Lysis Buffer (PLB) to every hole cells transfected, effect 15min makes the abundant cracking of cell under room temperature, with the cell sleaker cell lysate is scraped off, and changes in 1.5ml Eppendorf (EP) pipe.

The centrifugal 30min of (5) 12,000rpm sucks supernatant in the new EP pipe.

(6) (Luciferase Assay Buffer II adds the equivalent cell pyrolysis liquid, mixing in EP pipe LARII) to each 100 μ l luciferase assay damping fluids to be housed.

(7) immediately the EP pipe is put into biochemiluminescence detector (Turner Biosystems Company products), after the 2sec balance, the light output behind the mensuration 10sec.

(8) add 100 μ l fluorescent quenching agent (Stop & Glo Buffer), the cancellation Photinus pyralis LUC starts the renilla luciferase reaction simultaneously.

(9) the light output behind the mensuration 10sec.

Primary fluorescence numerical value is relative reactivity with the ratio of the fluorescence numerical value second time.

The independent repetition all done in every group of experiment 3 times, as the statistics foundation, carries out Student ' s t test statistical analysis with Mean ± SD.

As shown in Figure 2; P-Anti-HBxP3# is active inhibited to NF-B promotor in HepG2-X cell, L-O2-X cell and the HepG2.2.15 cell; Its restraining effect is dose-dependently, and HepG2 liver cancer cell and L-O2 liver cell that no HBx is expressed do not have influence.Utilize this experiment further to show, contain gene pairs HepG2-X cell and L-O2-X cell NF-B promotor active inhibited of 5 kinds of functional varianies of Anti-HBxP3#. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

As shown in Figure 3, using artificial synthetic polypeptide A nti-HBxP3#, active inhibited to NF-B promotor in HepG2-X cell, L-O2-X cell and the HepG2.2.15 cell is dose-dependently.And the HepG2 liver cancer cell of no HBx and the L-O2 liver cell of no HBx are not had influence. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

4.MTT detect

(1) inoculating cell: the cell (for the cell of enumerating in the table 1) of logarithmic phase is made into the individual cells suspension with the RPMI1640 or the DMEM nutrient solution that contain 10% foetal calf serum; With every hole 4000-5000 cell inoculation in 96 porocyte culture plates, every pore volume 100ul.

Culturing cell: treat cell attachment behind the 12h; The synthetic polypeptide that in embodiment 1, is obtained (0.1 μ M, the 1 μ M of polypeptide plasmid that in the step B of present embodiment, is obtained of transfection different mass (0.05 μ g, 0.1 μ g and 0.15 μ g) or adding different concns; 10 μ M and 100 μ M); Each concentration repeats 8 holes, with general culture condition, cultivates 48h.0.3 μ gpEGFP-C2 plasmid is mixed the back cotransfection with 1 μ g p-Anti-HBxP3#, under inverted fluorescence microscope, observe green fluorescence after 24 hours, confirm that its transfection efficiency can reach 70%.

(2) colour generation: every hole adds MTT solution (5mg/ml joins with PBS < pH=7.4 >) 20 μ l.

(3) continue to hatch 4 hours, stop cultivating, the careful suction abandoned culture supernatant liquid in the hole.Every hole adds 150ul DMSO, vibrates 10 minutes, and crystallisate is fully melted.

(4) colorimetric: select the 490nm wavelength, on the enzyme linked immunological monitor, measure each hole absorbance value, the record result carries out Student ' s t test statistical analysis.

As shown in Figure 4, p-Anti-HBxP3# is to HepG2-X cell, L-O2-X cell and the growth of HepG2.2.15 cell and breed inhibitedly, is its restraining effect and is dose-dependently.The HepG2 liver cancer cell of no HBx and the L-O2 liver cell of no HBx then there is not influence.Similarly, the growth of 5 of p-Anti-HBxP3# kinds of functional variant gene pairs HepG2-X cells and L-O2-X cell and breed inhibited. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

As shown in Figure 5, MTT detects, and using artificial synthetic polypeptide A nti-HBxP3# is to HepG2-X cell, L-O2-X cell and the growth of HepG2.2.15 cell and breed inhibitedly, is dose-dependently.And the HepG2 liver cancer cell of no HBx and the L-O2 liver cell of no HBx are not had influence. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Embodiment three: (in vivo) polypeptide validity experiment in the animal body

The HepG2-X cell or the HepG2.2.15 cell of logarithmic phase are processed cell suspension with trysinization, calculate cell count, with aseptic saline water cell dilution to 1 * 10 ⁷Individual cell/ml puts in the frozen water and deposits.Get 12 4 to 6 all female BALB/C nude mices again, mouse is divided into 2 groups at random: 1. control group, the cell 0.2ml after every above-mentioned dilution of mouse right fore oxter subcutaneous injection only injects 0.5ml sterile purified water (not containing polypeptide drugs); 2. experimental group (dosage is the 10mg/kg body weight).Cell 0.2ml after every above-mentioned dilution of mouse right fore oxter subcutaneous injection injects after 7 days gross tumor volume (V=L * W ²* 0.5) reaches 100mm ³, distinguish subcutaneous injection aforementioned polypeptides medicine (with the freeze dried polypeptide drugs of 0.5ml aseptic distillation water dissolution) again, injection in per two days is once injected 10 times altogether, measures gross tumor volume before the per injection.After the last administration 24 hours, the body weight of weighing mouse is taken off cervical vertebra with mouse then and is put to death, and strips knurl body tissue and weighs, and calculates tumour inhibiting rate by following formula.

With shown in Figure 7, the experimentation on animals detected result shows like table 1 and Fig. 6 and table 2, and using artificial synthetic polypeptide A nti-HBxP3# is to the growth of HepG2-X and HepG2.2.15 cell and breed inhibited. ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Table 1: the polypeptide A nti-HBxP3# of synthetic is to the effect of HepG2-X cell:

Table 2: the polypeptide A nti-HBxP3# of synthetic is to the effect of HepG2.2.15 cell:

Embodiment four: the function fragment of polypeptide and variant

The present invention has also inquired into the effect of the functional variant of polypeptide and function fragment thereof.Sequence shown in the following table is for being that the basis is carried out aminoacid addition (for example, at amino acid of distolateral interpolation) or the conservative amino acid replacement amino acid of another same type of amino-acid substitution (for example, with) and obtained with Anti-HBxP3#.Carry out artificial synthetic polypeptide fragment (method as above) according to said sequence, then, adopt the method for above-mentioned reporter gene and MTT, the variation of the effect of the polypeptide that observation post gets.

As shown in Figure 2, the gene pairs HepG2-X cell and the activity of L-O2-X cell NF-B promotor that contain 5 kinds of functional varianies of Anti-HBxP3# have certain restraining effect. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

As shown in Figure 4, contain Anti-HBxP3# 5 kinds of functional varianies gene pairs HepG2-X cell and L-O2-X cell growth and breed inhibited. ^*P＜0.05, ^*Student ' s t test statistical analysis is carried out in P＜0.01.

Embodiment five: the polypeptide drugs acute toxicity test

Get the Kunming small white mouse, 10 every group, each 5 of every group of male and female.Divide experimental group and control group.Experimental group, with the concentration of 1g/kg from mouse tail vein single injection polypeptide A nti-HBxP3# (with the freeze dried 2.5mg polypeptide of 0.125ml aseptic distillation water dissolution); Control group injection 0.25ml sterile purified water.The injection back was observed 24 hours continuously.

The polypeptide drugs The acute toxicity tests shows, the no abnormal performance of mouse.Compare the no abnormal variation of body weight with control group.

All reference that the present invention quotes comprise publication, patented claim and patent, are incorporated into this by reference, and are incorporated into this fully.Any and all embodiment that this paper provides, or exemplary language (for example, such as etc.) only is intended to set forth better the present invention, do not form limitation of the scope of the invention, only if requirement in addition.The invention describes preferred embodiment, comprise the known enforcement of inventor optimal mode of the present invention.The present invention comprises the possible variation of these preferred embodiments; The inventor is intended to specifically describe different mode embodiment of the present invention with these with this paper; Equally, those of ordinary skills are also clear to understand these variations, and expection can expertly utilize said variation.In the scope that law can allow, present invention includes all modifications and the Equivalent of the theme of in accompanying claims, quoting, only if this paper indicates in addition, or obviously and context inconsistent.

Claims

1. isolated polypeptide or peptide mimics; It comprises aminoacid sequence or its function fragment or functional variant shown in SEQ ID NO:1; Said polypeptide or peptide mimics have and suppress the proteic function of hepatitis B virus X, and can suppress the generation and the development of the chronic hepatopathy after hepatitis b virus infected.

2. described polypeptide of claim 1 or peptide mimics, the chronic hepatopathy behind the said hepatitis B virus infection comprises hepatitis, liver cirrhosis and liver cancer.

3. described polypeptide of claim 1 or peptide mimics, its aminoacid sequence that comprises, its function fragment or functional variant have the homogeny with the aminoacid sequence at least 70% shown in the SEQ ID NO:1.

4. described polypeptide of claim 1 or peptide mimics, its aminoacid sequence that comprises, its function fragment or functional variant have the homogeny with the aminoacid sequence at least 80% shown in the SEQ ID NO:1.

5. described polypeptide of claim 1 or peptide mimics, its aminoacid sequence that comprises, its function fragment or functional variant have the homogeny with the aminoacid sequence at least 90% shown in the SEQ ID NO:1.

6. described polypeptide of claim 1 or peptide mimics, it comprises any aminoacid sequence shown in SEQ ID NOs:1-6.

7. isolating polynucleotide, said polynucleotide comprise be selected from down the group in a kind of:

A) polynucleotide of aminoacid sequence, its function fragment or the functional variant shown in the coding SEQ ID NO:1; Perhaps

B) with a) polynucleotide of complementary or strict hybridization of polynucleotide.

8. the polynucleotide of claim 7, said polynucleotide comprise and are selected from down a kind of in the group:

A) polynucleotide of any aminoacid sequence shown in the coding SEQ ID NOs:1-6; Perhaps

9. recombinant expression vector, it comprises claim 7 or 8 described polynucleotide.

10. the host cell that comprises recombinant expression vector as claimed in claim 9.

11. the application of arbitrary said polypeptide in the medicine of making the metainfective chronic hepatopathy of hepatitis B virus resisting among the claim 1-6.

12. the application of arbitrary said Nucleotide in the medicine of making the metainfective chronic hepatopathy of hepatitis B virus resisting among the claim 7-8.

13. the application of recombinant expression vector described in the claim 9 in the medicine of making the metainfective chronic hepatopathy of hepatitis B virus resisting.

14. any among the claim 11-13 used, the said therapeutic vaccine of making resistance of hepatitis B that is applied as.

15. pharmaceutical composition, it comprises arbitrary described polypeptide or peptide mimics among the claim 1-6, and optional pharmaceutical carrier.

16. pharmaceutical composition, it comprises arbitrary described polynucleotide among the claim 7-8, and optional pharmaceutical carrier.

17. pharmaceutical composition, it comprises the recombinant expression vector described in the claim 9, and optional pharmaceutical carrier.