CN102660640A - Method for specific signal amplification and detection of DNA targeted sequence - Google Patents
Method for specific signal amplification and detection of DNA targeted sequence Download PDFInfo
- Publication number
- CN102660640A CN102660640A CN201210112406XA CN201210112406A CN102660640A CN 102660640 A CN102660640 A CN 102660640A CN 201210112406X A CN201210112406X A CN 201210112406XA CN 201210112406 A CN201210112406 A CN 201210112406A CN 102660640 A CN102660640 A CN 102660640A
- Authority
- CN
- China
- Prior art keywords
- probe
- target sequence
- downstream
- sequence
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for specific signal amplification and detection of a DNA targeted sequence of a system needing to be detected. The method is characterized in that through distinguishing effects of a single-abasic site dual-labeled fluorogenic probe and selective cutting effects of an incision enzyme 1V and a Lamdba excision enzyme, high-sensitivity, high-selectivity and fast detection of a DNA targeted sequence is realized under mild conditions. The method provided by the invention can distinguish a targeted sequence from a single-basic group difference interference sequence and is suitable for detection of single nucleotide polymorphism (SNP) genotyping and low-abundance mutation.
Description
Technical field
The present invention relates to the dna sequence dna detection range, comprise technical fields such as nucleic acid signal amplification, SNP (SNP) somatotype and low abundance point mutation detection.Specifically, relate to a kind of amplification system that utilizes restriction endonuclease IV/Lambda excision enzyme prozyme system and single dealkalize base probe, realize highly sensitive under the mild conditions, highly selective, detect target dna sequence apace.
Background technology
The nucleic acid signal amplifying technique had obtained development rapidly in recent years, and having set up with restriction enzyme, exonuclease III and DNA enzyme respectively is the based signal amplification method.The testing tool of this type technology all is a dna probe, is hopeful to be applied to carry out in the life system original position, live body detection in theory.On the other hand, amplification process is generally constant temperature, operates comparatively easy.Thereby the nucleic acid signal amplifying technique has certain advantage than PCR.But, some method for amplifying signal of present development, insufficient sensitivity is desirable, and than the low 4-5 one magnitude of PCR, and the performance of specificity aspect is also comparatively general: the differentiation for single base mismatch is also not obvious.So the main application of these method for amplifying signal still is confined to other detection architecture of coupling, be these detection architecture amplification detection signals.
In fact; The advantage that signal amplifies not merely is to improve the ratio of signal with respect to substrate; Dna probe can also be used for the amplifying signal difference: if can effectively be distinguished coupling and single base mismatch fully; Signal amplification technique then can effectively amplify this difference so, thereby is arrived by instrument detecting.Detect for SNP somatotype and the sudden change of low abundance, the link of most critical is exactly to distinguish the signal that matees fully with single base mismatch.So the signal amplification technique that specificity is high, universality is good can be applied to this two fields easily, and compares with existing detection method, signal amplification technique has simple to operate, advantages such as easy design.
Therefore, press for the signal amplification system that exploitation has highly selective, the advantage of signal amplification technique is applied to the detection of SNP somatotype and the sudden change of low abundance.
Summary of the invention
The objective of the invention is to set up a kind of can be under mild conditions the amplification system of (for example under 37 ℃ the physiological temp condition) selectivity amplification target dna sequence signal, thereby realize highly selective, highly sensitive, easy-operating DNA detection.
Restriction endonuclease IV is a kind of depurination/pyrimidine (AP) endonuclease, the complete AP site on the hydrolysis DNA (dealkalize base location), and first phosphodiester bond that cutting 5 ' end links to each other with AP site, it is terminal to produce 3 '-OH and 5 '-P, and its righttest working temperature is 37 ℃.Lamdba excision enzyme catalysis double chain DNA molecule carries out hydrolysis progressively from 5 '-P end, discharges 5 '-mononucleotide, but the 5 '-OH that can not degrade is terminal.According to the above-mentioned characteristic of these two kinds of enzymes, the present invention utilizes the differentiation effect of single dealkalize base probe, and the cutting action in conjunction with restriction endonuclease IV and Lamdba excision enzyme adopts following technical scheme, and the DNA target sequence is carried out signal amplification and detection.
Design the double-tagging fluorescent probe of single dealkalize base, probe is the terminal single stranded DNA of 5 '-OH, and dealkalize base location (AP site) is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and the downstream (can at the middle part or the 3 ' end of probe chain) that another is marked at a group are separated by three more than the nucleotide residue between the two.This probe is mixed with system to be measured; Add restriction endonuclease IV and Lamdba excision enzyme then, under 37 ℃ detected temperatures, if exist in the system to be measured can with said probe specificity bonded DNA target sequence; Then the dealkalize base room in probe and the formed double-stranded DNA of this target sequence is by restriction endonuclease IV identification and cutting; The probe that is incorporated on the target sequence is cut into short chain and the remaining long-chain of 3-6 nt by restriction endonuclease IV, and the short chain of 3-6 nt can disintegrate down from target sequence, keeps 5 '-P end of bonded residue long-chain then to cause the further cutting of Lamdba excision enzyme with target sequence; After the nucleotide residue of fluorophor or quencher group mark is cut; Fluorescence group and quencher group away from, FRET (FRET) is destroyed, thereby sends fluorescent signal; And the nucleotide residue of probe rest segment is by the hydrolysis one by one of Lamdba excision enzyme; The target sequence that discharges is still intact, can continue to combine with another probe specificity the above-mentioned reaction of re-initiation; Repeat said process, realize that the signal of target sequence amplifies and detection, detected fluorescence intensity is high more to show that the content of target sequence in the system to be measured is high more.
Further, the present invention has also found an important phenomenon in research process:
Referring to Fig. 1; Except that AP site, when DNA target sequence and probe have a base mispairing, and this mispairing (defining this position is No. 1 site when being positioned at first base position, 3 ' downstream of probe AP site; Definition second base position, probe AP site 3 ' downstream is No. 2 sites; The rest may be inferred for No. 3 sites, No. 4 sites or the like), said signal amplification process obtains quickening, that is: the fluorescence climbing speed situation of mating fully greater than DNA target sequence and probe.On the other hand, when DNA target sequence and probe during No. 3 site mispairing, the signal amplification process is suppressed largely; If during mispairing simultaneously, the signal amplification process receives the inhibition degree higher 1, No. 3 position for target dna sequence and probe, fluorescence rises very slow.
According to the inspiration of above-mentioned phenomenon, probe has following principle when specifically designing:
1. (the interference dna sequence dna here refers in particular to the DNA target sequence only has a base different sequences when the DNA target sequence does not receive the interference of other dna sequence dnas; Note is made " single base difference interference sequence "); Can probe be arranged to and the target sequence mispairing in No. 1 site; Other parts are mated except that AP site fully, to quicken amplification process, improve sensitivity.
2. when DNA target sequence and single base difference interference sequence exist simultaneously; At first confirm the difference base of target sequence and interference sequence; And find the position of the pairing base that probe and difference base pair answer, then with the abasic site design of probe the 4th base place, the 5 ' upper reaches in difference base pairing site.Like this, probe is with after target sequence or interference sequence combine, and difference base position just just is in No. 3 sites of probe.On the other hand, No. 3 sites of probe are designed to and target sequence coupling, nature, probe is mispairing in No. 3 sites and interference sequence.Simultaneously, deliberately base and the target sequence mispairing in No. 1 site of designing probe, it is different only in No. 3 sites a base being arranged owing to interference sequence with target sequence, thereby probe and interference sequence are mispairing in No. 1 site equally.As a whole, designing the result who causes like this is: probe and target dna sequence are No. 1 site mispairing, and the signal amplification process obtains quickening; And the mispairing simultaneously in 1, No. 3 site of probe and single base difference interference sequence, the signal amplification process is suppressed greatly.
In fact, DNA target sequence mentioned above and single base difference interference sequence are very common clinically: the relation in the SNP (SNP) between the range gene type comes to this.In addition, during the sudden change of DNA origination point, the relation of mutant and wild-type is like this equally.Therefore, method of the present invention can be used for the detection of SNP somatotype and low abundance mutator gene.The SNP somatotype detects unique different being with low abundance sudden change: during the SNP somatotype; Sample only contains wherein a kind of genotype, suddenlys change when detecting and hang down abundance, contains mutant sequence and wild-type sequence in the sample simultaneously; And the mutant abundance is lower, some in addition be lower than 1%.Therefore, we can say that the way that can carry out the SNP somatotype not necessarily can be hanged down the detection of abundance sudden change, and the method that can hang down abundance sudden change detection necessarily can be used in the SNP somatotype.
Detecting with low abundance sudden change below is example, further specifies our ratio juris:
Mutant is regarded as target sequence, and wild-type is regarded as single base difference interference sequence, then according to principle 2 designing probes mentioned above.So probe and mutant sequence are No. 1 bit mismatch, probe and wild-type sequence are 1, No. 3 bit mismatch.After probe and the sample mix, the signal of mutant sequence is amplified fast, and the rising of the signal of wild-type sequence is very slow, like this, even the abundance of mutant sequence is very low, still can detect it through its signal of quick amplification.
Therefore, in one aspect of the invention,, the invention provides as follows the DNA target sequence in the system to be measured carried out the method that specific signals is amplified and detected to there not being the situation that the interference sequence of a base difference is only arranged with target sequence in the system to be measured:
1) the single dealkalize base double-tagging fluorescent probe of preparation, this probe is the terminal single stranded DNA of 5 '-OH, its dealkalize base location (AP site) is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence mate complementation fully, perhaps only in first base position, dealkalize base location 3 ' downstream and target sequence mispairing;
2) probe with the step 1) preparation mixes with system to be measured; Add restriction endonuclease IV and Lamdba excision enzyme then; Carrying out real-time fluorescence at 37 ℃ measures: said probe combines with target sequence specificity in the system to be measured, after restriction endonuclease IV and Lamdba excision enzyme cut, sends fluorescence, and the target sequence continuation that discharges combines with another probe specificity; Repeat said process, thereby realize the signal of target sequence is amplified and detection through the fluorescence that sends.
To there being the situation that the different interference sequence of base is only arranged with target sequence in the system to be measured, the invention provides as follows the DNA target sequence in the system to be measured carried out the method that specific signals is amplified and detected:
1) the single dealkalize base double-tagging fluorescent probe of preparation, this probe is the terminal single stranded DNA of 5 '-OH, its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence be first base position mispairing in dealkalize base location 3 ' downstream only, and with interference sequence in dealkalize base location 3 ' downstream first and the 3 two base position mispairing;
2) probe with the step 1) preparation mixes with system to be measured; Add restriction endonuclease IV and Lamdba excision enzyme then; Carrying out real-time fluorescence at 37 ℃ measures: said probe combines with target sequence specificity in the system to be measured, after restriction endonuclease IV and Lamdba excision enzyme cut, sends fluorescence, and the target sequence continuation that discharges combines with another probe specificity; Repeat said process, the fluorescent signal fast rise; And said probe is with after interference sequence specificity in the system to be measured combines, and fluorescent signal rises and is suppressed; Thereby realize the signal of target sequence is amplified and detection through the fluorescence that sends.
Abasic site in the probe of the present invention (AP site) can directly obtain through chemical synthesis, also can obtain through other approach; For example: preparation earlier contains the double-tagging fluorescent probe in single uridylic (U) deoxynucleotide site; (Uracil DNA-glycosylase UDG) handles, excision uridylic base to use uridylic-DNA-glycosylase then; Remaining ribodesose residue obtains single abasic site (AP site).
Probe length according to the invention is traditionally arranged to be the 20-30 nucleotide residue.
It is right that fluorophor on the said probe and quencher group are selected from FRET group commonly used, like fluorophor FAM and quencher group B HQ1, and fluorophor FAM and quencher group TAMRA, fluorophor TET and quencher group B HQ2.Fluorophor and the mark position of quencher group on probe can be exchanged.
In another aspect of this invention; Provide a kind of DNA target sequence in the system to be measured has been carried out the test kit that specific signals is amplified and detected; Comprise: single dealkalize base double-tagging fluorescent probe, restriction endonuclease IV and Lambda excision enzyme; Wherein said probe is the terminal single stranded DNA of 5 '-OH, and its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream, and one in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream; Another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence mate complementation fully, perhaps only in first base position, dealkalize base location 3 ' downstream and target sequence mispairing; There is not the interference sequence that a base difference is only arranged with target sequence in the system to be measured that this test kit was directed against.Under mild conditions (37 ℃), the probe of mentioned reagent box adds restriction endonuclease IV and Lambda excision enzyme with after system to be measured is mixed; Utilize the specific recognition function of the mixed enzyme system of restriction endonuclease IV and Lambda excision enzyme, fluorescence is sent in cutting and DNA target sequence specificity bonded probe; The DNA target sequence that discharges can combine with new probe; Repeat said process, realize that signal amplifies, thereby measure the content that the result reflects target sequence in the system to be measured through real-time fluorescence.
The present invention also provides another kind of DNA target sequence in the system to be measured has been carried out the test kit that specific signals is amplified and detected, and possibly have the interference sequence that a base difference is only arranged with target sequence in the system to be measured that is directed against; This test kit comprises: single dealkalize base double-tagging fluorescent probe, restriction endonuclease IV and Lambda excision enzyme; Wherein said probe is the terminal single stranded DNA of 5 '-OH; Its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence be first base position mispairing in dealkalize base location 3 ' downstream only, and with interference sequence in dealkalize base location 3 ' downstream first and the 3 two base position mispairing.Under mild conditions (37 ℃), the probe of mentioned reagent box adds restriction endonuclease IV and Lambda excision enzyme with after system to be measured is mixed; Utilize the specific recognition function of the mixed enzyme system of restriction endonuclease IV and Lambda excision enzyme, fly-cutting and DNA target sequence specificity bonded probe, and cutting and single base difference interference sequence bonded probe very slowly; Simultaneously; After the bonded probe was cut, the DNA target sequence that discharges can combine with new probe, repeated said process; The realization signal amplifies, thereby measures the content that the result reflects target sequence in the system to be measured through real-time fluorescence.
In the test kit of the present invention, said probe length is traditionally arranged to be the 20-30 nucleotide residue.
It is right that fluorophor on the said probe and quencher group are selected from FRET group commonly used, like fluorophor FAM and quencher group B HQ1, and fluorophor FAM and quencher group TAMRA, fluorophor TET and quencher group B HQ2.Fluorophor and the mark position of quencher group on probe can be exchanged.
Than other signal amplification techniques, the present invention has some significant advantages:
1. universality, restriction endonuclease IV and Lambda excision enzyme do not have particular requirement to sequence, and the position in room and No. 1 site mispairing that deliberately is provided with can be according to the target sequence flexible design.
2. highly selective; Restriction endonuclease IV/Lambda excision enzyme mixed enzyme system has very strong selectivity to the mispairing of different positions, and simultaneously, an object chain combines with a plurality of probes; Be actually and carried out repeatedly selecting; Selectivity has also obtained amplification, thereby has realized that superelevation optionally detects, and selectivity exceeds every other method for amplifying signal.
3. mild condition, feasibility is high.Amplification system does not need heating, under mild conditions, just can realize.The more important thing is that the selectivity of system derives from the inherent character of enzyme own, thereby can very easily realize highly selective.The control of experimental design and condition is all very easy.
Description of drawings
Fig. 1 is that the present invention carries out the principle schematic that specific signals is amplified and detected to the DNA object chain.
Fig. 2 is the fluorescent value change curve that 1 couple of lower concentration DNA of embodiment target sequence detects, the corresponding different respectively target sequence amount of each curve among the figure.
Fig. 3 is that 2 pairs of dissimilar dna sequence dnas of embodiment carry out the effect comparison diagram that signal amplifies.
Fig. 4 is the fluorescent value change curve that 3 pairs of lower concentrations of embodiment, 1 bit mismatch DNA target sequence detects.
Fig. 5 is the fluorescent value change curve that 4 pairs of low abundance sudden changes of embodiment detect.
Embodiment
Below in conjunction with accompanying drawing, further set forth the present invention through specific embodiment.It will be understood by those of skill in the art that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.
In this embodiment, target compound is the dna single chain, and except that abasic site, probe and target dna strand mate fully.The concentration gradient of a series of dna single chains is set in the experiment, and hope can detect the least possible object chain.Detect principle referring to Fig. 1, concrete steps are following:
1. design and synthesize the double-tagging fluorescent probe that contains uridylic deoxynucleotide residue, use the UDG enzyme to handle then and obtain single dealkalize base probe;
2. single dealkalize base probe that will obtain mixes with the target dna sequence of different concns, adds restriction endonuclease IV and Lambda excision enzyme then, and rapid test mixing solutions fluorescent value over time.
In this embodiment, the designed probe sequence is following:
5’-TCGUCT(-FAM)CCACAGACACATACTCCA-BHQ?1-3’(SEQ?ID?No.1)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
Target sequence is following:
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGAGA
CGAGAGTAAG-3 ' (SEQ ID No.2) (underscore part and the complementary coupling of probe)
In the 50 μ L reaction systems of different concns target sequence: probe amount: 5pmol; Target sequence amount: 5pmol, 1pmol, 0.1pmol, 10fmol, 1fmol; Add the restriction endonuclease IV of 0.1U and the Lambda excision enzyme of 5U in each reaction system.
Blank system: probe 5pmol, target sequence amount: 0.
Hot program: 37 ℃ of 2400s, every 8s measures the first order fluorescence value.
The fluorometric assay instrument is real-time fluorescence PCR appearance rotor-gene 6000, and the sensitivity of detector during detection (gain level) is: 7.
Detected result: the fluorescent value change curve is as shown in Figure 2, and curve a, b, c, d, e and f correspond respectively to and add 5pmol, 1pmol; 0.1pmol, 10fmol, 1fmol and 0 target sequence amount; In the preceding 600s after the reaction beginning, fluorescent value is along with the time increases gradually, behind the 30min; In the reaction system of target sequence amount more than 1pmol, fluorescent value reaches platform.Embodiment 2 < dissimilar dna sequence dna amplification effect contrast >
In this embodiment, target compound is the dna single chain.The dna single chain of series of different is set in the experiment: except that abasic site, the two fluorescence labeling probes of single dealkalize base and these strands 1 bit mismatch are mated 2 bit mismatch, 3 bit mismatch or 1,3 bit mismatch fully.Detect principle referring to Fig. 1, concrete steps are following:
1. design and synthesize the double-tagging fluorescent probe that contains uridylic deoxynucleotide residue, use the UDG enzyme to handle then and obtain single dealkalize base probe;
2. single dealkalize base probe (5 pmol) that will obtain mixes with dissimilar target dna sequences (1 pmol), adds restriction endonuclease IV and Lambda excision enzyme then, and rapid test mixing solutions fluorescent value over time.Hot program: 37 ℃ of 1600s, every 8s measures the first order fluorescence value.The fluorometric assay instrument is real-time fluorescence PCR appearance rotor-gene6000, and the sensitivity of detector during detection (gain level) is: 7.
This embodiment comprises three experiments:
(1) experiment 1 result sees Fig. 3 (a) and (b).
It is following to test 1 used probe sequence:
5’-TCGUCT(-FAM)CCACAGACACATACTCCA-BHQ?1-3’(SEQ?ID?No.1)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
Target sequence is following:
(note is made 1-C:T to 1 bit mismatch sequence I; Fig. 3 (b) post 1):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGA 
A
CGAGAGTAAG-3 ' (SEQ ID No.3) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
(note is made 1-C:C to 1 bit mismatch sequence II; Fig. 3 (b) post 2):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGA 
A
CGAGAGTAAG-3 ' (SEQ ID No.4) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
(note is made 1-C:A to 1 bit mismatch sequence III; Fig. 3 (a) curve a, Fig. 3 (b) post 3):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGA 
A
CGAGAGTAAG-3 ' (SEQ ID No.5) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
Complete matching sequence (Fig. 3 (a) curve b, Fig. 3 (b) post 4):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGAGA
CGAGAGTAAG-3 ' (SEQ ID No.2) (underscore part and the complementary coupling of probe);
(note is made 2-T:T to 2 bit mismatch sequences; Fig. 3 (a) curve c):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGG 
GA
CGAGAGTAAG-3 ' (SEQ ID No.6) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
(note is made 3-C:A to 3 bit mismatch sequences; Fig. 3 (a) curve d):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
AGA
CGAGAGTAAG-3 ' (SEQ ID No.7) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
1, (note is made 1-C:A to 3 bit mismatch sequence I, 3-C:T; Fig. 3 (a) curve e, Fig. 3 (b) post 5):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A A
CGAGAGTAAG-3 ' (SEQ ID No.8) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
1, (note is made 1-C:A to 3 bit mismatch sequence II, 3-C:A; Fig. 3 (b) post 6):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A A
CGAGAGTAAG-3 ' (SEQ ID No.9) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
1, (note is made 1-C:A to 3 bit mismatch sequence III, 3-C:C; Fig. 3 (b) post 7):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A A
CGAGAGTAAG-3 ' (SEQ ID No.10) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch).
(2) result of experiment 2 sees Fig. 3 (c).
It is following to test 2 used probe sequences:
5’-TCGUCT(-FAM)TCACAGACACATACTCCA-BHQ?1-3’ (SEQ?ID?No.11)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
Target sequence is following:
(note is made 1-C:A to 1 bit mismatch sequence; Fig. 3 (c) post 1):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGAA A
CGAGAGTAAG-3 ' (SEQ ID No.9) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
Complete matching sequence (Fig. 3 (c) post 2):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGA AGA
CGAGAGTA AG-3 ' (SEQ ID No.12) (underscore part and the complementary coupling of probe);
1, (note is made 1-C:A to 3 bit mismatch sequences, 3-T:G; Fig. 3 (c) post 3):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A 
A
CGAGAGTAAG-3 ' (SEQ ID No.5) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
1, (note is made 1-C:A to 3 bit mismatch sequences, 3-T:T; Fig. 3 (c) post 4):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A 
A
CGAGAGTAAG-3 ' (SEQ ID No.8) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch).
(3) corresponding diagram as a result 3 (d) of experiment 3.
It is following to test 3 used probe sequences:
5’-TCAUCT(-FAM)GCACAGACACATACTCCA-BHQ1-3’ (SEQ?ID?No.13)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
Target sequence is following:
(note is made 1-C:A to 1 bit mismatch sequence; Fig. 3 (d) post 1):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGCA 
A
TGAGAGTAAG-3 ' (SEQ ID No.14) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
Complete matching sequence (Fig. 3 (d) post 2):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGCAGA
TGAGAGTAAG-3 ' (SEQ ID No.1 5) (underscore part and the complementary coupling of probe);
1, (note is made 1-C:A to 3 bit mismatch sequences, 3-G:G; Fig. 3 (d) post 3):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A 
A
TGAGAGTAAG-3 ' (SEQ ID No.16) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
1, (note is made 1-C:A to 3 bit mismatch sequences, 3-G:A; Fig. 3 (d) post 4):
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG A 
A
TGAGAGTAAG-3 ' (SEQ ID No.17) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch).
Experimental result shows: the dna sequence dna of three kind of 1 bit mismatch can both amplify by signal for faster, and seven kind 1, the dna sequence dna of 3 bit mismatch all significantly hinder the signal amplification process.
In this embodiment, target compound is the dna single chain, and except that abasic site, probe and target dna strand are No. 1 site mispairing.The concentration gradient of a series of dna single chains is set in the experiment, and hope can detect the least possible object chain.Detect principle referring to Fig. 1, concrete steps are following:
1. design and synthesize the double-tagging fluorescent probe that contains uridylic deoxynucleotide residue, use the UDG enzyme to handle and obtain single dealkalize base probe;
2. single dealkalize base probe that will obtain mixes with the target dna sequence of different concns, adds restriction endonuclease IV and Lambda excision enzyme then, and rapid test mixing solutions fluorescent value over time.
In this embodiment, the designed probe sequence is following:
5’-TCGUCT(-FAM)CCACAGACACATACTCCA-BHQ?1-3’(SEQ?ID?No.1)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
Target sequence is following:
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGA 
A
CGAGAGTAAG-3 ' (SEQ ID No.5) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
In the 50 μ L reaction systems of different concns target sequence: probe amount: 5pmol; Target sequence amount: 5pmol, 1pmol, 0.1pmol, 10fmol, 1fmol; Add the restriction endonuclease IV of 0.1U and the Lambda excision enzyme of 5U in each reaction system.
Blank system: probe 5pmol, target sequence amount: 0.
Hot program: 37 ℃ of 1600s, every 8s measures the first order fluorescence value.
The fluorometric assay instrument is real-time fluorescence PCR appearance rotor-gene 6000, and the sensitivity of detector during detection (gain level) is: 7.
Detected result: the fluorescent value change curve is as shown in Figure 4, and curve a, b, c, d, e and f correspond respectively to and add 5pmol, 1pmol; 0.1pmol, 10fmol, 1fmol and 0 target sequence amount; Preceding 200s after the reaction beginning, fluorescent value is along with the time increases gradually, behind the 10min; In the reaction system of target sequence amount more than 1pmol, fluorescent value reaches platform.
Embodiment 4 < low abundance sudden change detects >
In this embodiment, system to be measured is the mixed system of wild chain, sudden change chain, except that abasic site, probe design be with wild chain 1, No. 3 bit mismatch, with the chain that suddenlys change No. 1 bit mismatch.The total amount of two kinds of chains is 1pmol, but a series of different mutant proportions are set, and hope can detect alap mutant proportion.Detect principle referring to Fig. 1, the practical implementation step is following:
1. prepare single dealkalize base probe, method is with step 1 among the embodiment 1;
2. single dealkalize base probe is mixed with the compound target system that contains different ratios sudden change chain, add restriction endonuclease IV and Lambda excision enzyme, the rapid test fluorescent value over time.
In this embodiment, the designed probe sequence is following:
5’-TCGUCT(-FAM)CCACAGACACATACTCCA-BHQ?1-3’(SEQ?ID?No.1)
5 ' of this probe is held and is-OH, and 5 ' the 4th in downstream of end are abasic site, and the 2nd the nucleotide residue marked in abasic site downstream has fluorophor FAM, probe 3 ' end mark quencher group B HQ1.
The sudden change chain-ordering is following:
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTGGA 
A
CGAGAGTAAG-3 ' (SEQ ID No.5) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch);
Wild chain-ordering is following:
5 '-GTTTTAAATTA
TGGAGTATGTGTCTGTG 
A 
A
CGAGAGTAAG-3 ' (SEQ ID No.8) (underscore part and the complementary coupling of probe, what add mark of emphasis is base mismatch).
50 μ L reaction systems of different ratios sudden change chain-ordering: probe amount: 5pmol; Sudden change chain ratio: 10%, 5%, 2.0%, 1%, 0.5%, combination chain (sudden change chain and wild chain) total amount is 1pmol; Add the restriction endonuclease IV of 0.1U and the Lambda excision enzyme of 5U in each reaction system.
Blank group: probe amount: 5pmol; Mutant proportion: 0%.
Hot program: 37 ℃ of 1200s, every 8s measures the first order fluorescence value.
The fluorometric assay instrument is real-time fluorescence PCR appearance rotor-gene 6000, and the sensitivity of detector during detection (gain level) is: 7.
Detected result: the fluorescent value change curve is as shown in Figure 5, and it is 10%, 5% that curve a, b, c, d, e and f correspond respectively to sudden change chain ratio; 2.0%, 1%, 0.5% and 0 compound target system; Fluorescent value is along with the time increases gradually, and the rate of rise descends with the mutant abundance.
Claims (10)
1. there is not the interference sequence that a base difference is only arranged with target sequence in the method that the DNA target sequence in the system to be measured is carried out the specific signals amplification and detects in the said system to be measured, and this method comprises the steps:
1) the single dealkalize base double-tagging fluorescent probe of preparation, this probe is the terminal single stranded DNA of 5 '-OH, its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence mate complementation fully, perhaps only in first base position, dealkalize base location 3 ' downstream and target sequence mispairing;
2) probe with the step 1) preparation mixes with system to be measured; Add restriction endonuclease IV and Lamdba excision enzyme then; Carrying out real-time fluorescence at 37 ℃ measures: said probe combines with target sequence specificity in the system to be measured, after restriction endonuclease IV and Lamdba excision enzyme cut, sends fluorescence, and the target sequence continuation that discharges combines with another probe specificity; Repeat said process, thereby realize the signal of target sequence is amplified and detection.
2. possibly there is the interference sequence that a base difference is only arranged with target sequence in the method that the DNA target sequence in the system to be measured is carried out the specific signals amplification and detects in the said system to be measured, and this method comprises the steps:
1) the single dealkalize base double-tagging fluorescent probe of preparation, this probe is the terminal single stranded DNA of 5 '-OH, its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence be first base position mispairing in dealkalize base location 3 ' downstream only, and with interference sequence in dealkalize base location 3 ' downstream first and the 3 two base position mispairing;
2) probe with the step 1) preparation mixes with system to be measured; Add restriction endonuclease IV and Lamdba excision enzyme then; Carrying out real-time fluorescence at 37 ℃ measures: said probe combines with target sequence specificity in the system to be measured, after restriction endonuclease IV and Lamdba excision enzyme cut, sends fluorescence, and the target sequence continuation that discharges combines with another probe specificity; Repeat said process, the fluorescent signal fast rise; And said probe is with after interference sequence specificity in the system to be measured combines, and fluorescent signal rises and is suppressed; Thereby realize the signal of target sequence is amplified and detection.
3. according to claim 1 or claim 2 method is characterized in that on said probe, one in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the middle part or the 3 ' end of probe.
4. according to claim 1 or claim 2 method is characterized in that step 1) prepares said single dealkalize base double-tagging fluorescent probe through chemical synthesis; Perhaps, preparation earlier contains the double-tagging fluorescent probe in single uridylic deoxynucleotide site, with uridylic-DNA-glycosylase it is handled then, and excision uridylic base obtains single dealkalize base double-tagging fluorescent probe.
5. according to claim 1 or claim 2 method is characterized in that said probe length is the 20-30 nucleotide residue.
6. according to claim 1 or claim 2 method is characterized in that, said fluorophor and quencher group be following groups to one of: FAM and TAMRA, FAM and BHQ1, perhaps TET and BHQ2.
7. test kit that the DNA target sequence in the system to be measured is carried out that specific signals is amplified and detects; There is not the interference sequence that a base difference is only arranged with target sequence in the said system to be measured; This test kit comprises: single dealkalize base double-tagging fluorescent probe, restriction endonuclease IV and Lambda excision enzyme; Wherein said probe is the terminal single stranded DNA of 5 '-OH, and its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream, and one in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream; Another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence mate complementation fully, perhaps only in first base position, dealkalize base location 3 ' downstream and target sequence mispairing.
8. possibly there is the interference sequence that a base difference is only arranged with target sequence in the test kit that the DNA target sequence in the system to be measured is carried out the specific signals amplification and detects in the said system to be measured; This test kit comprises: single dealkalize base double-tagging fluorescent probe, restriction endonuclease IV and Lambda excision enzyme; Wherein said probe is the terminal single stranded DNA of 5 '-OH; Its dealkalize base location is positioned at nucleotide residue place, 3-6 position, probe 5 ' terminal downstream; One in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, and another is marked at the downstream of a group, is separated by three between the two more than the nucleotide residue; Except that the dealkalize base location, this probe and DNA target sequence be first base position mispairing in dealkalize base location 3 ' downstream only, and with interference sequence in dealkalize base location 3 ' downstream first and the 3 two base position mispairing.
9. like claim 7 or 8 described test kits, it is characterized in that said probe length is the 20-30 nucleotide residue.
10. like claim 7 or 8 described test kits, it is characterized in that on said probe, one in fluorophor and the quencher group is marked in six nucleotide residues in dealkalize base location downstream, another is marked at the middle part or the 3 ' end of probe; Said fluorophor and quencher group be following groups to one of: FAM and TAMRA, FAM and BHQ1, perhaps TET and BHQ2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210112406XA CN102660640A (en) | 2012-04-16 | 2012-04-16 | Method for specific signal amplification and detection of DNA targeted sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210112406XA CN102660640A (en) | 2012-04-16 | 2012-04-16 | Method for specific signal amplification and detection of DNA targeted sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102660640A true CN102660640A (en) | 2012-09-12 |
Family
ID=46770215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210112406XA Pending CN102660640A (en) | 2012-04-16 | 2012-04-16 | Method for specific signal amplification and detection of DNA targeted sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102660640A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882128A (en) * | 2014-03-13 | 2014-06-25 | 北京大学 | Method for signal amplification and detection on target deoxyribonucleic acid (DNA) sequence at normal temperature |
| CN110511984A (en) * | 2019-09-10 | 2019-11-29 | 北京大学 | The rapid fluorescence detection method and application of 19 exon deletion mutation of EGFR gene |
| CN113481280A (en) * | 2021-03-16 | 2021-10-08 | 华中科技大学同济医学院附属协和医院 | Rapid and universal low-abundance mutation detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296116A (en) * | 2011-09-02 | 2011-12-28 | 北京大学 | Method for signal amplification and detection of target sequence of DNA |
-
2012
- 2012-04-16 CN CN201210112406XA patent/CN102660640A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296116A (en) * | 2011-09-02 | 2011-12-28 | 北京大学 | Method for signal amplification and detection of target sequence of DNA |
Non-Patent Citations (2)
| Title |
|---|
| XIANJIN XIAO ET AL.: "A universal mismatch-directed signal amplification platform for ultra-selective and sensitive DNA detection under mild isothermal conditions", 《CHEMICAL SCIENCE》, vol. 3, no. 7, 13 April 2012 (2012-04-13), pages 2257 - 2261 * |
| XIANJIN XIAO ET AL.: "Ultra-selective and sensitive DNA detection by a universal apurinic/apyrimidinic probe-based endonuclease IV signal amplification system", 《CHEM COMM》, vol. 48, no. 14, 25 October 2011 (2011-10-25), pages 1964 - 1966 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882128A (en) * | 2014-03-13 | 2014-06-25 | 北京大学 | Method for signal amplification and detection on target deoxyribonucleic acid (DNA) sequence at normal temperature |
| CN110511984A (en) * | 2019-09-10 | 2019-11-29 | 北京大学 | The rapid fluorescence detection method and application of 19 exon deletion mutation of EGFR gene |
| CN113481280A (en) * | 2021-03-16 | 2021-10-08 | 华中科技大学同济医学院附属协和医院 | Rapid and universal low-abundance mutation detection method |
| CN113481280B (en) * | 2021-03-16 | 2022-06-07 | 华中科技大学同济医学院附属协和医院 | Rapid and universal low-abundance mutation detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200165650A1 (en) | Polynucleotide enrichment using crispr-cas system | |
| USRE44265E1 (en) | Nucleic acid amplification method | |
| EP1991698B1 (en) | High throughput sequence-based detection of snps using ligation assays | |
| CA2910861C (en) | High throughput screening of mutagenized populations | |
| AU2002210862B2 (en) | Method for the amplification and optional characterisation of nucleic acids | |
| CN1863927B (en) | Nucleic acid detection assay | |
| US7939299B2 (en) | Nucleic acid amplification method | |
| CN116064748A (en) | Method for variant detection | |
| US9359639B2 (en) | Method for the detection of multiple single nucleotide variations or single nucleotide polymorphisms in a single tube | |
| CA2400240A1 (en) | Multiplex ligatable probe amplification | |
| CN101974638B (en) | Method for inspecting nucleic acid signal amplification of ligation nucleic acid intrusive reaction and cutting endonuclease reaction | |
| EP1633888A2 (en) | Means and method for the detection of target nucleotide sequences using ligation assays with improved oligonucleotide probe pairs | |
| EP3385396B1 (en) | Reporter dye for isothermal nucleic acid amplification, isothermal-based dual functional oligonucleotide containing quencher, and method for nucleic acid amplification and measurement using same | |
| AU2012240460B2 (en) | High through-put analysis of transgene borders | |
| CA2810856C (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample | |
| EP1780292A1 (en) | Gene methylation assay controls | |
| US20060094009A1 (en) | Method for the characterisation of nucleic acid molecules | |
| CN102660640A (en) | Method for specific signal amplification and detection of DNA targeted sequence | |
| CN102296116A (en) | Method for signal amplification and detection of target sequence of DNA | |
| CN103571932A (en) | Detection method for single nucleotide polymorphism based on heat-resistant nuclease HII | |
| CN106868111B (en) | Method and kit for detecting SNP (Single nucleotide polymorphism) by using universal TaqMan probe | |
| CN103882128A (en) | Method for signal amplification and detection on target deoxyribonucleic acid (DNA) sequence at normal temperature | |
| CN117512076B (en) | RNA reverse transcription-free detection method based on split Cas9 system | |
| US20230348957A1 (en) | Methods and compositions for nucleic acid analysis | |
| CN106755402A (en) | A kind of method for detecting single nucleotide polymorphism based on heat stable nuclease HII |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120912 |