CN102653760B - Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof - Google Patents
Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof Download PDFInfo
- Publication number
- CN102653760B CN102653760B CN 201210118460 CN201210118460A CN102653760B CN 102653760 B CN102653760 B CN 102653760B CN 201210118460 CN201210118460 CN 201210118460 CN 201210118460 A CN201210118460 A CN 201210118460A CN 102653760 B CN102653760 B CN 102653760B
- Authority
- CN
- China
- Prior art keywords
- seq
- piks
- pik
- enzyme
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rice blast resistance gene Pik-s functional specific molecular marker, as well as a method and application thereof. The molecular marker consists of Piks-1FNP, Piks-2FNP and Piks-3FNP, which are nucleotide sequences amplified from SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6 of rice total DNA (ribonucleic acid) respectively by primers. Three single base differences different from the Pik-s functional specificity of an affected allele and other rice blast genes can be obtained by analysis with a method of comparing Pik-s allele sequences of a plurality of rice blast resistance genes with the Piks-1 and Piks-2 sequences, and the primers can be obtained through design, and the rice DNA is amplified to respectively obtain the Pik-s functional specific molecular markers Piks-1FNP, Piks-2FNP and Piks-3FNP. The rice blast resistance gene Pik-s functional specific molecular marker can be used for screening and identifying a functional resistance gene in massive rice germplasm resources, and can be applied to molecular marker assisted selective breeding, gene pyramiding breeding and transgenic breeding.
Description
Technical field
The invention belongs to agricultural biological technical field, particularly a kind of rice blast resistance gene Pik-s specific Function molecule marker PiksFNP and method and application.
Background technology
Paddy rice is one of most important food crop in the world, approximately has population over half to take rice as staple food.The rice blast caused by Pyricularia oryzae (Magnapothe oryzae) is one of disease the most serious to Rice Production harm, all causes serious grain loss every year.From the viewpoint of environment protection and agricultural sustainable development, the incubation of disease-resistant variety and utilization are control rice blast methods the most safely and effectively.Traditional paddy rice resistance breeding depends on the evaluation of resistant phenotype, this not only requires the breeder must possess abundant inoculation, investigation experience, but also easily be subject to the impact of environment and human factor, and qualification result easily causes error, and the efficiency of selection of target gene is often lower.Along with generation and the utilization of molecular marking technique, it is convenient, directly, the advantage such as not affected by environment makes the using value of this technology and prospect more and more receive publicity.Aspect breeding, by exploitation and the closely linked molecule marker of target gene, particularly at the molecule marker of its specific Function of the inner exploitation of gene, target gene is selected, not only select reliability high, but also greatly accelerated the breeding paces.
Contain 5 and there is different anti-spectrums and the specific allelotrope Pik-m of microspecies, Pik, Pik-p, Pik-h and Pik-s owing to being positioned at Pik site on the 11st karyomit(e) long arm end, so this site is the research hot topic of rice blast resistance always.Wherein, Pik-m (Ashikawa et al.2008.Two adjacent nucleotide-binding site-leucine rich repeat class genes are required to confer Pikm-specific rice blast resistance.Genetics 180:2267-2276), Pik (Zhai et al.2011.The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication.New Phytologist 189:321-334) and Pik-p (Yuan et al.2011.The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes.Theor Appl Genet 122:1017-1028) successfully identified and cloned.Research shows, these 3 allelic rice blast resistances must be mediated jointly by 2 adjacent NBS-LRR class disease-resistant genes.Simultaneously, in Rice Population, comprise these 3 allelic genome areas and exist genotypic differentiation,, when 2 adjacent functional NBS-LRR genes exist simultaneously, this genotype is defined as the K type; And, when adjacent 2 functional NBS-LRR genes do not exist simultaneously, this genotype is defined as N-type (genotype Japanese fine with reference to kind with susceptible paddy rice identical).
The applicant finds in the Fine Mapping process of Pik-s, in the genome area that comprises the Pik-s site, Pik-s donor kind Shin 2 (Wang et al.2009.Characterization of rice blast resistance genes in the Pik cluster and fine mapping of the Pik-p locus.Phytopathology 99:900-905) and Pik-m, the donor kind of Pik and Pik-p has similar genome structure, and reference sequences Japan exist the insertion/deletion of large fragment between fine.Further the function complementation experiment result has proved that Pik-s and Pik-m, Pik, Pik-p are real allelotrope (applicant does not deliver data).
In order to accelerate the application of Pik-s in breeding for disease resistance work, as screened, identify this functional resistant gene in a large amount of Rice Germplasm Resources, and, in the pyramiding breeding of molecular marker assisted selection breeding, resistant gene Pik-s and other functional genes and the application in transgenic breeding, develop accurate and effective and be different from other allelic Pik-s specific Function molecule marker and seem and be even more important.
Summary of the invention
In order to overcome the deficiencies in the prior art and shortcoming, primary and foremost purpose of the present invention is to provide a kind of rice blast resistance gene Pik-s specific Function molecule marker PiksFNP.
Another object of the present invention is to provide the detection method of above-mentioned rice blast resistance gene Pik-s specific Function molecule marker PiksFNP.
Another object of the present invention is to provide the application of above-mentioned rice blast resistance gene Pik-s specific Function molecule marker PiksFNP.
The object of the invention is achieved through the following technical solutions:
A kind of rice blast resistance gene Pik-s specific Function molecule marker PiksFNP, it is combined by Piks-1FNP, Piks-2FNP and Piks-3FNP, respectively by primer pair SEQ ID NO:1 and SEQ ID NO:2, the nucleotide sequence that SEQ ID NO:3 and SEQ ID NO:4 and SEQ ID NO:5 and SEQ ID NO:6 increase out from rice total dna, and, after specific enzymes is cut, with rice blast resistance gene Pik-s, be the molecule marker of specificity banding pattern;
The nucleotide sequence of described primer pair is as follows:
SEQ?ID?NO.1(5’-3’)：GTCCTACGACCTGGATGATG；
SEQ?ID?NO.2(5’-3’)：CAGAGAAGCGATTGGAGGCA；
SEQ?ID?NO.3(5’-3’)：TAGACGAGCAAGTCCCTGA；
SEQ?ID?NO.4(5’-3’)：GCAAAGTTTACTCCAATCGC；
SEQ?ID?NO.5(5’-3’)：TTTCTGGAGGTCAGCCGAT；
SEQ?ID?NO.6(5’-3’)：CAACCGTTGTTTTGCCTCC；
Preferably, described rice varieties is Shin 2;
Described rice blast resistance gene Pik-s comprises gene Piks-1 and the Piks-2 of 2 coding NBS-LRR proteinoids.
Described specific enzymes is cut and is referred to the PCR product obtained by primer pair SEQ ID NO:1 and SEQ ID NO:2 amplification and cut by restriction enzyme SphI enzyme; The PCR product obtained by primer pair SEQ ID NO:3 and SEQ ID NO:4 amplification is cut by restriction enzyme Nco I enzyme; The PCR product obtained by primer pair SEQ ID NO:5 and SEQ ID NO:6 amplification is cut by restriction enzyme Spe I enzyme.
The detection method of described rice blast resistance gene Pik-s specific Function molecule marker PiksFNP, the method compared by the allelotrope sequence to a plurality of resistance gene of rice blast Pik-s and Piks-1 and Piks-2 sequence, analysis obtains being different from 3 single base differences (single nucleotide polymorphism of the Pik-s specific Function of its susceptible allelotrope and other rice blast resistance genes, SNP), obtain respectively SEQ ID NO.1 and SEQ ID NO.2 by design again, SEQ ID NO.3 and SEQ ID NO.4 and SEQ ID NO:5 and SEQ ID NO:6 primer, paddy DNA is increased, and after specific enzymes is cut, obtain respectively Pik-s specific Function molecule marker Piks-1FNP, Piks-2FNP and Piks-3FNP, preferably include following steps:
(1), by conventional PCR method amplification, obtain the allelic coding region of the Pik-s DNA sequence dna of a plurality of K type rice varieties;
(2) sequence alignment step (1) obtained, obtain Pik-s resistant gene special 3 specific Function list base difference Piks-1SNP, Piks-2SNP and Piks-3SNP;
(3) according to resulting 3 SNP of step (2), design respectively primer pair SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 and SEQ ID NO:5 and SEQ IDNO:6, and carry out pcr amplification reaction with these 3 groups of primer pair rice blast resistance rice total dnas, obtain respectively amplified production A, amplified production B and amplified production C; Then respectively amplified production is carried out that enzyme is cut, electrophoresis, comparatively validate, obtain respectively being with rice blast resistance gene Piks nucleotide fragments Piks-1FNP, Piks-2FNP and the Piks-3FNP of specificity banding pattern;
(4) molecule marker step (3) obtained is verified in different rice varieties, thus the molecule marker PiksFNP (being combined by Piks-1FNP, Piks-2FNP and Piks-3FNP) of the specific Function of definite Pik-s resistant gene.
It is preferred,
The described rice varieties of step (1) is Shin 2, Tsuyuake, Kusabue, K3, K60, black (Heijiao, HJ) and the Q1063 of handing over.
Sequence alignment described in step (2) is compared after being preferably nucleotide sequence being translated into to protein sequence;
The size of amplified production A described in step (3) is 124bp, and the size after enzyme is cut is 103bp;
The size of amplified production B described in step (3) is 145bp, and the size after enzyme is cut is 64bp and 81bp;
The size of amplified production C described in step (3) is 139bp, and the size after enzyme is cut is 119bp;
Primer described in step (3) is according to dCAPS mark principle, specific Function upstream primer Piks-1FNP-F in the design of Piks-1SNP site with base mismatch, and at the design function specificity downstream primer Piks-1FNP-R of 100～200bp place, its downstream, respectively as shown in SEQ ID NO.1 and SEQ ID NO.2; According to CAPS mark principle, design function specificity upstream and downstream primer Piks-2FNP-F and Piks-2FNP-R in each 100bp scope of the upstream and downstream in Piks-2SNP site, respectively as shown in SEQ ID NO.3 and SEQ ID NO.4; According to dCAPS mark principle, specific Function upstream primer Piks-3FNP-F in the design of Piks-3SNP site with base mismatch, and at the design function specificity downstream primer Piks-3FNP-R of 100～200bp place, its downstream, respectively as shown in SEQ ID NO.5 and SEQ ID NO.6;
The described pcr amplification reaction of step (3), wherein the pcr amplification reaction system of Piks-1FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme SphI to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 124bp, and it is 103bp that enzyme is cut rear resulting product size, and the former (can not be digested) be the specific Function molecule marker Piks-1FNP of resistant gene Pik-s.
The described pcr amplification reaction of step (3), wherein the pcr amplification reaction system of Piks-2FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme Nco I to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 145bp, and the product size that enzyme obtains after cutting is 64bp and 81bp, and the former (can not be digested) be the specific Function molecule marker Piks-2FNP of resistant gene Pik-s.
The described pcr amplification reaction of step (3), wherein the pcr amplification reaction system of Piks-3FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme Spe I to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 139bp, and the product size that enzyme obtains after cutting is 119bp, and the former (can not be digested) be the specific Function molecule marker Piks-3FNP of resistant gene pik-s.
The application of a kind of rice blast resistance gene Pik-s specific Function molecule marker PiksFNP, be included in Rice Germplasm Resources and fast, directly identify this resistant gene and the application in molecular marker assisted selection breeding, gene pyramiding breeding and transgenic breeding.
The present invention has following advantage and effect with respect to prior art:
Pik-s specific Function selective marker of the present invention be take round pcr as basis, can not only distinguish the genotype of rice varieties, and can convenient, fast, directly realize target gene Pik-s in Rice Germplasm Resources and the evaluation in the breeding offspring, the particularly discriminating between allelotrope, and be not subject to the impact of environment and human factor.Therefore, can be widely used, to reducing labour cost, improve the effect that breeding work efficiency plays positive important.
The accompanying drawing explanation
Fig. 1 is one of constitutive gene Piks-1 and 4 Pik site allelotrope and 2 the susceptible allelic sequence alignment of protein figure with resistance gene of rice blast Pik-s of specific Function SNP; The black asterisk means the amino acid whose change of the specific Function caused by Piks-1FNP; Black triangle number means the amino acid whose change of specific Function caused by Piks-3FNP.
Fig. 2 is one of constitutive gene Piks-2 and 4 Pik site allelotrope and 2 the susceptible allelic sequence alignment of protein figure with resistance gene of rice blast Pik-s of specific Function SNP; The black asterisk means the amino acid whose change of the specific Function caused by Piks-2FNP.
Fig. 3 is proof diagram, wherein:
Figure (A) is the proof diagram of Pik-s specific Function molecule marker Piks-1FNP in 9 rice varieties, wherein, and swimming lane 1: resistant gene donor kind Shin 2 (Pik-s); Swimming lane 2:IRBLks-S (Pik-s single-gene system); Swimming lane 3: resistant variety K3 (Pik-h); Swimming lane 4:IRBLkh-K3 (Pik-h single-gene system); Swimming lane 5:IRBLk-Ka (Pik single-gene system); Swimming lane 6:IRBLkm-TS (Pik-m single-gene system); Swimming lane 7:IRBLkp-K60 (Pik-p single-gene system); Swimming lane 8:IRBL7-M (Pi7 single-gene system); Swimming lane 9:IRBL1-CL (Pi1 single-gene system); Swimming lane M:DNAladder;
Figure (B) is checking and the detection figure of Pik-s specific Function molecule marker Piks-2FNP in 9 rice strains, wherein, and swimming lane 1: resistant gene donor kind Shin 2 (Pik-s); Swimming lane 2:IRBLks-S (Pik-s single-gene system); Swimming lane 3: resistant variety K3 (Pik-h); Swimming lane 4:IRBLkh-K3:(Pik-h single-gene system); Swimming lane 5:IRBLk-Ka (Pik single-gene system); Swimming lane 6:IRBLkm-TS (Pik-m single-gene system); Swimming lane 7:IRBLkp-K60 (Pik-p single-gene system); Swimming lane 8:IRBL7-M (Pi7 single-gene system); Swimming lane 9:IRBL1-CL (Pi1 single-gene system); Swimming lane M:DNAladder;
Figure (C) is checking and the detection figure of Pik-s specific Function molecule marker Piks-3FNP in 9 rice strains, wherein, and swimming lane 1: resistant gene donor kind Shin 2 (Pik-s); Swimming lane 2:IRBLks-S (Pik-s single-gene system); Swimming lane 3: resistant variety K3 (Pik-h); Swimming lane 4:IRBLkh-K3:(Pik-h single-gene system); Swimming lane 5:IRBLk-Ka (Pik single-gene system); Swimming lane 6:IRBLkm-TS (Pik-m single-gene system); Swimming lane 7:IRBLkp-K60 (Pik-p single-gene system); Swimming lane 8:IRBL7-M (Pi7 single-gene system); Swimming lane 9:IRBL1-CL (Pi1 single-gene system); Swimming lane M:DNAladder.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited to this.
The comparison of embodiment 1:Pik-s allelotrope coding region sequence and the evaluation of SNP
By conventional pcr amplification (Yuan et al.2011.The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NB S-LRR genes.Theor Appl Genet 122:1017-1028, Zhai et al.2011.The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication.New Phytologist 189:321-334), order-checking (Shanghai Ying Jun Bioisystech Co., Ltd, Guangzhou Branch), from 5 disease resisting rice kinds [Shin 2 (Pik-s donor kind), Tsuyuake (Pik-m donor kind), Kusabue (Pik donor kind), K60 (Pik-p donor kind), Wang et al.2009.Characterization of rice blast resistance genes in the Pik cluster and fine mapping of the Pik-p locus.Phytopathology 99:900-905], K3 (Pik-h donor kind, Xu et al.2008.Efficient authentic fine mapping of the rice blast resistance gene Pik-h in the Pik cluster, using new Pik-h-differentiating isolates.Molecular Breeding 22:289-299) and the black (Heijiao that hand over of 2 susceptible rice varieties of K type, HJ) and Q1063 (Zhai et al.2011.The isolation and characterization ofPik, a rice blast resistance gene which emerged after rice domestication.New Phytologist 189:321-334) obtain corresponding Pik-s allelotrope coding region DNA sequence dna [Pik-s (HQ662329) in, Pik-p (HM035369), Pik (HM048900), Pik-m (AB462256), have been disclosed in
http://www.ncbi.nlm.nih.gov], utilize Multiple Sequence Alignment Software tool (http://multalin.toulouse.inra.fr/multalin/), by the sequence alignment of protein analysis to after these sequence translations, identify and be present in Piks-1 gene cDNA the 347th site, the specific Function SNP in the 782nd site and Piks-2 gene cDNA the 1301st site.In Piks-1 gene the 347th site, the 116th site amino acid of Piks-1 coding is arginine (R), that Pikp-1, Pikh-1 and Pikl-63 encode is Histidine (H), therefore, this site can distinguish (Fig. 1) by Piks-1 and allelotrope Pikp-l, Pikh-1 and Pikl-63.And in Piks-1 gene the 782nd site, the 264th site amino acid of Piks-1 coding is L-Ala (A), allelotrope Pikm1-TS and Pik-1 coding be α-amino-isovaleric acid (V), therefore, this site can distinguish (Fig. 1) by Piks-1 and Pikm1-TS and Pik-1.And in Piks-2 gene the 1301st site, the 434th site amino acid of Piks-2 coding is Serine (S), allelotrope Pikh-2 and Pikp-2 coding be Threonine (T), therefore, this site can distinguish (Fig. 2) by Piks-2 and Pikh-2 and Pikp-2.Above 3 specific Function SNP sites be used in combination can by Pik-s and Pik-p, Pikm-TS, Pik, Pikh, and other rice blast resistance genes such as Pik-63 distinguish.
Embodiment 2:Pik-s specific Function molecule marker and design of primers and detection
According to dCAPS (Derived Cleaved Amplified Polymorphic Sequences; Neff et al.2002.Web-based primer design for single nucleotide polymorphism analysis.Trends in Genetics 18:613-615) and CAPS (Cleaved Amplified Polymorphic Sequences; Konieczny and Ausubel, 2002.A the procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers.Plant J 4:403-410) principle of design of mark, according to dCAPS mark principle, specific Function upstream primer Piks-1FNP-F in the design of Piks-1SNP site with base mismatch, and at the design function specificity downstream primer Piks-1FNP-R of 100～200bp place, its downstream, respectively as shown in SEQ ID NO.1 and SEQ ID NO.2; According to CAPS mark principle, design function specificity upstream and downstream primer Piks-2FNP-F and Piks-2FNP-R in each 100bp scope of the upstream and downstream in Piks-2SNP site, respectively as shown in SEQ ID NO.3 and SEQ ID NO.4; According to dCAPS mark principle, specific Function upstream primer Piks-3FNP-F in the design of Piks-3SNP site with base mismatch, and at the design function specificity downstream primer Piks-3FNP-R of 100～200bp place, its downstream, respectively as shown in SEQ ID NO.5 and SEQ ID NO.6.Carry the Pik-s gene and other allelic kind DNA profilings are increased by these 3 groups of primer pairs, obtain respectively amplified production A, amplified production B and amplified production C; Then respectively amplified production is carried out that enzyme is cut, electrophoresis, comparatively validate, obtain respectively being with rice blast resistance gene Piks nucleotide fragments Piks-1FNP, Piks-2FNP and the Piks-3FNP of specificity banding pattern.
The pcr amplification reaction system of Piks-1FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme SphI to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 124bp, and it is 103bp that enzyme is cut rear resulting product size, and the former (can not be digested) be the specific Function molecule marker Piks-1FNP of resistant gene Pik-s.
Step 3) described pcr amplification reaction, wherein the pcr amplification reaction system of Piks-2FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme Nco I to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 145bp, and the product size that enzyme obtains after cutting is 64bp and 81bp, and the former (can not be digested) be the specific Function molecule marker Piks-2FNP of resistant gene Pik-s.
Step 3) described pcr amplification reaction, wherein the pcr amplification reaction system of Piks-3FNP is as follows:
Amplified reaction temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations.
After the PCR reaction finishes, utilize restriction enzyme Spe I to carry out enzyme to obtained PCR product and cut, reaction system is as follows:
After enzyme is cut 3 hours under 37 ℃ of conditions, get appropriate enzyme and cut sample carry out electrophoresis detection on 8% polyacrylamide gel, deposition condition is 90V, 2 hours 30 minutes.The resulting PCR product size that increases is 139bp, and the product size that enzyme obtains after cutting is 119bp, and the former (can not be digested) be the specific Function molecule marker Piks-3FNP of resistant gene Pik-s.
Embodiment 3: the application of resistant gene Pik-s specific Function molecule marker in differentiating different rice blast resistance genes
9 rice strains that collection contains different rice blast resistance genes are respectively: Shin 2 (Pik-s donor kind, Wang et al.2009.Characterization of rice blast resistance genes in the Pik cluster and fine mapping of the Pik-p locus.Phytopathology 99:900-905), K3 (Pik-h donor kind, Xu et al.2008.Efficient authentic fine mapping of the rice blast resistance gene Pik-h in the Pik cluster, using new Pik-h-differentiating isolates.Molecular Breeding 22:289-299), IRBLkh-K3, IRBLk-Ka, IRBLkm-TS, IRBLkp-K60, IRBL7-M, IRBL 1-CL, IRBLks-S[Kobayashi et al.2007.Developmentof new sets of international standard differential varieties for blast resistance in rice (Oryza sativa L.) .JARQ 41:31-37] genomic dna, and as template, utilize the Piks-1FNP described in embodiment 2, pcr amplification reaction system and the reaction conditions of Piks-2FNP and Piks-3FNP, the molecule marker of antagonism gene Pik-s specific Function carries out pcr amplification, enzyme is cut and electrophoresis detection.Electrophoresis result is respectively as shown in Fig. 3 A, Fig. 3 B and Fig. 3 C.
As the accompanying drawing explanation, matching of test-results and design analysis, illustrate that resistant gene Pik-s specific Function molecule marker can be applied at discriminating Pik-s gene and other rice blast resistance genes.
Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and principle, substitutes, combination, simplify; all should be equivalent substitute mode, within being included in protection scope of the present invention.
Claims (4)
1. a rice blast resistance gene
pik-sspecific Function molecule marker PiksFNP is characterized in that: it is combined by Piks-1FNP, Piks-2FNP and Piks-3FNP; Respectively by primer pair SEQ ID NO. 1 and SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, and SEQ ID NO. 5 and SEQ ID NO. 6, nucleotide sequence Piks-1FNP, Piks-2FNP and Piks-3FNP increase out respectively from rice total dna, and after specific enzymes is cut, with rice blast resistance gene
pik-sthe molecule marker that is the specificity banding pattern;
Described primer pair SEQ ID NO. 1 and SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, and the nucleotide sequence of SEQ ID NO. 5 and SEQ ID NO. 6 is as follows:
SEQ?ID?NO.?1：?5’-GTCCTACGACCTGGATGATG-3’；
SEQ?ID?NO.?2：?5’-CAGAGAAGCGATTGGAGGCA-3’；
SEQ?ID?NO.?3：?5’-TAGACGAGCAAGTCCCTGA-3’；
SEQ?ID?NO.?4：?5’-GCAAAGTTTACTCCAATCGC-3’；
SEQ?ID?NO.?5：?5’-TTTCTGGAGGTCAGCCGAT-3’；
SEQ?ID?NO.?6：?5’-CAACCGTTGTTTTGCCTCC-3’；
Described paddy rice is rice varieties Shin 2;
Described specific enzymes is cut and is referred to the PCR product obtained by primer pair SEQ ID NO:1 and SEQ ID NO:2 amplification and pass through restriction enzyme
sphthe I enzyme is cut; The PCR product obtained by primer pair SEQ ID NO:3 and SEQ ID NO:4 amplification passes through restriction enzyme
ncothe I enzyme is cut; The PCR product obtained by primer pair SEQ ID NO:5 and SEQ ID NO:6 amplification passes through restriction enzyme
spethe I enzyme is cut;
The size of described Piks-1FNP is 124 bp, and the size after enzyme is cut is 103 bp;
The size of described Piks-2FNP is 145 bp, and the size after enzyme is cut is 64 bp and 81 bp;
The size of described Piks-3FNP is 139 bp, and the size after enzyme is cut is 119 bp.
2. rice blast resistance gene according to claim 1
pik-sthe preparation method of specific Function molecule marker PiksFNP is characterized in that having comprised following steps:
(1) by the amplification of conventional PCR method, obtain a plurality of K type rice varieties
pik-sallelic coding region DNA sequence dna;
(2) sequence alignment step (1) obtained, obtain
pik-s3 specific Function list base differences that resistant gene is special
piks-1sNP,
piks-2sNP and
piks-3sNP;
(3) according to resulting 3 SNP of step (2), design respectively primer pair SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO. 3 and SEQ ID NO. 4 and SEQ ID NO:5 and SEQ ID NO:6, and carry out pcr amplification reaction with these 3 groups of primer pair rice blast resistance rice total dnas, obtain respectively amplified production A, amplified production B and amplified production C; Then respectively amplified production is carried out that enzyme is cut, electrophoresis, comparatively validate, obtain respectively and rice blast resistance gene
piksnucleotide fragments Piks-1FNP, the Piks-2FNP and the Piks-3FNP that are the specificity banding pattern;
(4) molecule marker step (3) obtained is verified, thereby is determined in different rice varieties
pik-sthe molecule marker PiksFNP of the specific Function of resistant gene, this molecule marker PiksFNP is combined by Piks-1FNP, Piks-2FNP and Piks-3FNP.
3. rice blast resistance gene according to claim 2
pik-sthe preparation method of specific Function molecule marker PiksFNP is characterized in that:
The described rice varieties of step 1) is Shin 2, Tsuyuake, Kusabue, K3, K60, the black friendship and Q1063.
4. rice blast resistance gene according to claim 2
pik-sthe preparation method of specific Function molecule marker PiksFNP is characterized in that:
Pcr amplification reaction described in step (3), the amplification reaction system of Piks-1FNP is:
10 * PCR buffer, 2 μ l, 2.5 mM dNTP 1.6 μ l, 10 μ M SEQ ID NO.1:0.5 μ l, 10 μ M SEQ ID NO.2 0.5 μ l, 5 U/ μ l TaKaRa Taq
tM0.1 μ l, 50 ng/ μ l DNA template 1 μ l, ddH
2o mends to 20 μ l;
The temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations;
For Piks-1FNP, the reaction system that the enzyme described in step (3) is cut is as follows:
10X enzyme cutting buffering liquid 1.2 μ l, PCR product 5 μ l,
sph I0.25 μ l, ddH
2o mends to 12 μ l;
Pcr amplification reaction described in step (3), the amplification reaction system of Piks-2FNP is:
10 * PCR buffer, 2 μ l, 2.5 mM dNTP 1.6 μ l, 10 μ M SEQ ID NO.3:0.5 μ l, 10 μ M SEQ ID NO.4 0.5 μ l, 5 U/ μ l TaKaRa Taq
tM0.1 μ l, 50 ng/ μ l DNA template 1 μ l, ddH
2o mends to 20 μ l;
The temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations;
For Piks-2FNP, the reaction system that the enzyme described in step (3) is cut is as follows:
10 * enzyme cutting buffering liquid, 1.2 μ l, PCR product 5 μ l,
nco I0.25 μ l, ddH
2o mends to 12 μ l;
Pcr amplification reaction described in step (3), the amplification reaction system of Piks-3FNP is:
10 * PCR buffer, 2 μ l, 2.5 mM dNTP 1.6 μ l, 10 μ M SEQ ID NO.5:0.5 μ l, 10 μ M SEQ ID NO.6 0.5 μ l, 5 U/ μ l TaKaRa Taq
tM0.1 μ l, 50 ng/ μ l DNA template 1 μ l, ddH
2o mends to 20 μ l;
The temperature cycle condition is as follows: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 35 circulations; 72 ℃ 5 minutes; 10 ℃ of preservations;
For Piks-3FNP, the reaction system that the enzyme described in step (3) is cut is as follows:
10 * enzyme cutting buffering liquid, 1.2 μ l, PCR product 5 μ l,
spe I0.25 μ l, ddH
2o mends to 12 μ l.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210118460 CN102653760B (en) | 2012-04-20 | 2012-04-20 | Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210118460 CN102653760B (en) | 2012-04-20 | 2012-04-20 | Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102653760A CN102653760A (en) | 2012-09-05 |
| CN102653760B true CN102653760B (en) | 2013-12-25 |
Family
ID=46729491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210118460 Expired - Fee Related CN102653760B (en) | 2012-04-20 | 2012-04-20 | Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102653760B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112695114B (en) * | 2020-12-25 | 2022-05-20 | 华智生物技术有限公司 | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof |
-
2012
- 2012-04-20 CN CN 201210118460 patent/CN102653760B/en not_active Expired - Fee Related
Non-Patent Citations (8)
| Title |
|---|
| Bin Yuan等.The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes.《Theor Appl Genet》.2011,第122卷1017-1028. |
| The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes;Bin Yuan等;《Theor Appl Genet》;20111231;第122卷;1017-1028 * |
| The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes;Yohei KOIDE等;《JARQ》;20091231;第43卷(第4期);255-280 * |
| Yohei KOIDE等.The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes.《JARQ》.2009,第43卷(第4期),255-280. |
| 利用分子标记辅助选择聚合Pi-1和Pi-2基因改良两系不育系稻瘟病抗性;柳武革等;《作物学报》;20081231;第34卷(第7期);1128-1136 * |
| 利用微卫星标记鉴定水稻的稻瘟病抗性;李仕贵;《生物工程学报》;20000531;第16卷(第3期);324-327 * |
| 李仕贵.利用微卫星标记鉴定水稻的稻瘟病抗性.《生物工程学报》.2000,第16卷(第3期),324-327. |
| 柳武革等.利用分子标记辅助选择聚合Pi-1和Pi-2基因改良两系不育系稻瘟病抗性.《作物学报》.2008,第34卷(第7期),1128-1136. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102653760A (en) | 2012-09-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Prasad et al. | QTL analysis for grain protein content using SSR markers and validation studies using NILs in bread wheat | |
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| Sajib et al. | SSR marker-based molecular characterization and genetic diversity analysis of aromatic landreces of rice (Oryza sativa L.). | |
| CN102703443B (en) | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof | |
| Hossain et al. | Genetic diversity analysis of aromatic landraces of rice (Oryza sativa L.) by microsatellite markers | |
| Xia et al. | Single nucleotide polymorphisms in HSP17. 8 and their association with agronomic traits in barley | |
| Jiang et al. | A novel QTL on chromosome 5AL of Yangmai 158 increases resistance to Fusarium head blight in wheat | |
| Du et al. | Development and application of PCR markers specific to the 1Ns chromosome of Psathyrostachys huashanica Keng with leaf rust resistance | |
| Ma et al. | Construction of chromosome segment substitution lines of Dongxiang common wild rice (Oryza rufipogon Griff.) in the background of the japonica rice cultivar Nipponbare (Oryza sativa L.) | |
| Wang et al. | Development of EST-PCR markers for Thinopyrum intermedium chromosome 2Ai# 2 and their application in characterization of novel wheat-grass recombinants | |
| CN109337998A (en) | With InDel6 and the SSR229 label of corn plant height close linkage and its application | |
| CN102586238A (en) | Function specific molecular marker PilFNP of rice blast resistance gene Pil as well as method and application thereof | |
| Kojima et al. | Identification and validation of a quantitative trait locus associated with wheat yellow mosaic virus pathotype I resistance in a Japanese wheat variety | |
| CN103642803A (en) | Function specific molecular markers of rice blast resistance gene Pi63 as well as method and application of function specific molecular markers | |
| CN102732511A (en) | Functional specificity molecule marker Pi7FNP of blast-resistance gene Pi7, method and application thereof | |
| CN103789419B (en) | Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof | |
| CN104672315A (en) | Gene for controlling cucumber non-tendril character and cucumber tendril character-related SNP marker | |
| Yang et al. | Development of sequence-specific PCR markers associated with a polygenic controlled trait for marker-assisted selection using a modified selective genotyping strategy: a case study on anthracnose disease resistance in white lupin (Lupinus albus L.) | |
| Teturová et al. | Mapping of powdery mildew resistance genes in a newly determined accession of Hordeum vulgare ssp. spontaneum | |
| CN102653760B (en) | Rice blast resistance gene Pik-s functional specific molecular marker, as well as method and application thereof | |
| CN103937789A (en) | Genetically specific molecular marker Pita3N5s of rice resistance gene Pita3 as well as preparation method and application thereof | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| CN104673917B (en) | Rice blast resistance gene Pi35 functional molecular marker and its method and application | |
| Cheng et al. | TRAP markers generated with resistant gene analog sequences and their application to genetic diversity analysis of radish germplasm | |
| CN103468805B (en) | Marker and method for identifying cytoplasmic sterility homozygous restorer line of Gossypium harknessii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131225 |