CN102649975A - Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method - Google Patents
Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method Download PDFInfo
- Publication number
- CN102649975A CN102649975A CN2011100432266A CN201110043226A CN102649975A CN 102649975 A CN102649975 A CN 102649975A CN 2011100432266 A CN2011100432266 A CN 2011100432266A CN 201110043226 A CN201110043226 A CN 201110043226A CN 102649975 A CN102649975 A CN 102649975A
- Authority
- CN
- China
- Prior art keywords
- antibody
- complement factor
- ldl
- cfh
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention aims to provide a diagnostic reagent for the occurrence and development of age-related macular degeneration (AMD) diseases. The invention relates to the technical schemes of the determination of two complement factor H genotypes of rs10611170 (Y402H)/rs2274700, the determination of oxidized specific antigen, a kit thereof and a quantitative determination method. The quantitative determination method disclosed by the invention comprises the following steps of: (a) extracting peripheral blood genome deoxyribonucleic acid (DNA) and determining the primers and sequences of rs10611170 (Y402H)/rs2274700; (b) making an antibody of anti-phosphorylcholine contact with an OxLDL-containing test plasma sample; determining the content of oxidized phospholipids; (c) making the test plasma contact with the oxidized specific antigen; and determining the combination amount of complement factor H and the oxidized specific antigen. The invention provides a reliable reference index for diagnosing the occurrence and development of the AMD diseases.
Description
Technical field
The present invention relates to the genotype identification of complement factor H (CFH); CFH is to the combination of oxidation specific antigens; And the upward detection of oxidized phospholipids of low-density lipoprotein (LDL), and, AMD is carried out diagnosis of early warning property and treatment guidance through the resulting data of above detection.Be specifically related to relevant quantitative detecting method and test kit thereof.
Background technology
Full genome research (GWAS) has promoted the complex character disease
[1]The research of molecular basis aspect.But, still not enough for the research of disease incidence mechanism and heritable variation dependency.Such as the pathogenesis of AMD (AMD) and the dependency of complement factor H gene (CFH).AMD accounts for the first place in old blinding property illness in eye, nearly all over the world more than 3,000 ten thousand AMD patients.The heavy losses of AMD patient's vision are because CNV (CNV) is hemorrhage and ooze out mostly, or moist AMD.AMD pathogenesis and CFH gene replication have closely related property.Comprise two kinds of common ill risk haplotypes at the CFH gene locus: i.e. rs10611170 (Y402H) and rs2274700
[2345678]Surpass 60%AMD patient according to this two kinds of risk haplotype labels are arranged.
Existing research shows that numerous disease is relevant with oxidative damage, comprises atherosclerosis, senile dementia and AMD
[9,10 11 12]The retina photosensory cell contains abundant pufas phosphatide, and like Yelkin TTS (PtC), PtC is prone under oxygenizement, modified or produce multiple degradation production.For example, under the oxidative modification effect, the head end of PtC---phosphorylcholine (PC) can occurred conformation changes and exposes an oxidation epi-position, and this structure can be by the natural antibody of PC---and T15 discerns (accompanying drawing 1).T15 is the part of natural immune system, and it can discern some bacterium, and as streptococcus pneumoniae, the PC on cell walls surface also interacts with it,, this mechanism is avoided fatal infection for the protection host
[13]
T15 antibody can not combine the PC on human cell membrane or the lipoprotein to combine usually.But, when oxidative damage takes place after, like Ox LDL (oxLDL), oxidized light sensation cell acromere (OS) or apoptotic cells, the change of structure picture can take place in the PC in its adipose membrane structure, by previous stealthy state, changes into dominance condition.So can by the natural antibody T15 identification of anti-phosphorylcholine (PC) with combine, remove oxidative damage structure, the function of maintaining organism balance thereby reach.Oxidizing reaction also can cause the further oxygenolysis of pufas side chain, and produces some high reactivity molecules, and like mda (MDA), these active intermediates will further form mixture with protein with the fat reaction.For example, the reaction of MDA and acetaldehyde generate mda-acetaldehyde (MAA) and with protein or lipid coupling mutually.These structures relevant with oxPC and MAA can stimulate and cause the intensive inflammatory reaction
[14,15]Both through with retinal pigment epithelium (RPE) and scavenger cell surface receptor---combine like CD36, excite downstream cascade inflammatory reaction.
Therefore, natural antibody not only plays an important role in body opposing infectation of bacteria, in oxidative damage, also can protect cell and molecular structure, keeps homeostaticly, eliminates unsound cell; As remove the oxidation sight sensor acromere of apoptotic cell or sight sensor.Existing research proof: the target position that these natural antibodies discerned is the oxidation epi-position on these molecules just, like oxPC, and the dependency structure of MDA and MAA
[13; 14]
In view of natural antibody in the innate immune system and complement form body defending system jointly, resist multiple exogenous paathogenic factor, like infection and remove endogenic oxidative damage; Simultaneously, on gene level, the AMD morbidity has stronger dependency with CFH.
Lipoprotein is the main carrier of plasma cholesterol and triglyceride level.Low-density lipoprotein (LDL) is formed (accompanying drawing 1) by phosphatide, ApoB polypeptied chain, SUV, triglyceride level, glucide etc.The oxidation state variation that it is found that low-density lipoprotein in recent years is relevant with numerous disease, like mellitus, renal failure and preeclampsia.People find that also Ox LDL and cardiovascular disorder have confidential relation.For example, in arterial wall and other sites, LDL is oxidized to Ox LDL (OxLDL).OxLDL no longer by the identification of the ldl receptor on the normal cell, is discerned by the scavenger receptor on the scavenger cell on the contrary.Make scavenger cell picked-up OxLDL not modulated, the lipid among the OxLDL (comprising oxidized lipid) is just cumulative in scavenger cell as a result becomes foam cell up to scavenger cell.It is believed that the various factors that cause thrombocyte shakiness and coagulation of blood of this foam cell secretion.In addition, the death of these foam cells causes lipid deposition and causes inflammatory reaction.
Although people have known that the generation of oxidative damage and multiple disease, development have certain getting in touch at present; Also some detection methods have been proposed to OxLDL; But these detection methods all can not accomplish the degree of OxLDL content and oxidative damage and the degree of disease are contacted directly, so its practicality is not very big.For example Young etc. (referring to U.S. Patent number 5,460,947) discloses and uses immune analysis method to detect the content of ApoB in the serum.But what this method was measured is oxidation and non-oxide LDL sum, and can not differentiate with non-oxide LDL oxidation.In addition, the oxidation of LDL is the process of a complicacy, and its oxidized degree does not still have quantitative standards at present.Therefore, the OxLDL that obtains with external catalysis is used as standard substance, confirms the OxLDL of generation in the body, has both lacked the solid theories support, can cause the systematic error between each measurement again.
Summary of the invention
The technical problem that the present invention will solve provides the genotypic test kit of a kind of identifier's of being used for tissue samples DNA complement factor H.This test kit comprises following ingredients:
A, from people's tissue samples, extract the reagent of dna profiling;
B, be used for from the primer of DNA masterplate amplification complement factor H gene fragment; Comprise:
The genotypic amplimer of complement factor H: rs2274700 is right:
Upstream primer: 5 '-CAGCCCCCACAAAAAGACTA-3 ' (SEQ ID No 1);
Downstream primer: 5 '-TGCTTGTCTTTTTCTTATTCTCTTCC-3 ' (SEQ ID No 2);
The genotypic amplimer of and complement factor H: rs1061170 is right:
Upstream primer: 5 '-TTTTTGGATGTTTATGCAATCTT-3 ' (SEQ ID No 3);
Downstream primer: 5 '-GGATGCATCTGGGAGTAGGA-3 ' (SEQ ID No 4);
And c, be used for the segment of DNA cloning product is carried out the primer sequence of genotype identification, comprising:
The primer sequence of CFH rs10611170 genotype identification:
5’-TTG?TTA?TGG?TCC?TTA?GGA?AAA?TGT?TAT?TTT?CCT?TAT?TTG?GAA?AAT?GGATA?T?AAT?CAA?AAT-3’(SEQ?ID?No?5)；
The primer sequence of CFH rs2274700 genotype identification:
5’-ATC?CTG?ATG?TTT?CAC?CAT?CTG?CTG?TTA?CAT?ATC?CTA?GTT?TGC?ATT?GATATT?T-3’(SEQ?ID?No 6)。
Wherein, the above-mentioned described people's tissue samples of test kit kind is the peripheral blood sample.
The present invention also provides the genotypic method of complement factor H among a kind of identifier's tissue samples DNA, it is characterized in that this method may further comprise the steps:
A, from people's tissue samples, extract and the purify DNA template;
The gene fragment of b, the complement factor H that from dna profiling, increases, amplification primers comprises:
The genotypic amplimer of complement factor H: rs2274700 is right:
Upstream primer: 5 '-CAGCCCCCACAAAAAGACTA-3 ';
Downstream primer: 5 '-TGCTTGTCTTTTTCTTATTCTCTTCC-3 ';
The genotypic amplimer of and complement factor H: rs1061170 is right:
Upstream primer: 5 '-TTTTTGGATGTTTATGCAATCTT-3 '
Downstream primer: 5 '-GGATGCATCTGGGAGTAGGA-3 ';
The primer sequence of c, use genotype identification increases to the gene fragment of the complement factor H that step b obtains, and product order-checking the carrying out genotype SNP that obtains identifies, if wherein protectiveness allelotrope is that homozygote is labeled as TT; If being homozygote, wherein pathogenic allelotrope is labeled as CC; If wherein protectiveness and pathogenic allelotrope are that heterozygote is labeled as TC;
The primer sequence of described genotype identification comprises:
The primer sequence of CFH rs10611170 genotype identification:
5’-TTG?TTA?TGG?TCC?TTA?GGA?AAA?TGT?TAT?TTT?CCT?TAT?TTG?GAA?AAT?GGATA?T?AAT?CAA?AAT-3’；
The primer sequence of CFH rs2274700 genotype identification:
5’-ATC?CTG?ATG?TTT?CAC?CAT?CTG?CTG?TTA?CAT?ATC?CTA?GTT?TGC?ATT?GATATT?T-3’。
The present invention also provides the test kit of oxidized phospholipids on a kind of detection by quantitative apolipoprotein B in addition.This test kit comprises following ingredients:
A, anti-apolipoprotein B antibody are in order to capture low-density lipoprotein in the blood plasma;
The antibody of b, anti-phosphorylcholine is in order to contact with the sample that contains Ox LDL of capturing;
Wherein, the encoding sox of antibody described in the mentioned reagent box contains S107VH variable region of heavy chain and V-kappa22VL variable region of light chain.
The present invention also provides the method for oxidized phospholipids on the detection by quantitative apolipoprotein B simultaneously.This method may further comprise the steps:
A, low-density lipoprotein in the blood plasma is captured with anti-apolipoprotein B antibody;
B, will resist the antibody of phosphorylcholine to contact with the sample that contains Ox LDL;
C, make said antibody and oxidation phosphoric acid choline binding;
The binding capacity of d, the said antibody of mensuration and Ox LDL.
Wherein, the antibody described in the aforesaid method is any one in monoclonal antibody, polyclonal antibody or the single-chain antibody variable region fragment.
Wherein, the encoding sox of the antibody described in the aforesaid method contains S107VH variable region of heavy chain and V-kappa22VL variable region of light chain.
Wherein, the Ox LDL sample that contains described in the aforesaid method is serum, blood plasma, tissue homogenate or tissue extract.
Wherein, the steps d described in the aforesaid method can adopt the binding capacity of the next said antibody Ox LDL of at least a method in chemiluminescence immunoassay, EUSA method, biotin-avidin system assay method, the radioimmunoassay.
Wherein, also can comprise step e in the aforesaid method, that is:, confirm the amount of the oxidation specific antigen determinant on Ox LDL surface according to being the typical curve that standard substance record with the phosphorylcholine compound.
The present invention also provides a kind of quantitatively determined complement factor H (complement factor H in peripheral blood or the blood plasma) and oxidation specific antigens bonded test kit.This test kit includes: the oxidation specific antigens; The antibody of anticomplement Factor H.
Described oxidation specific antigens is: the oxidized phospholipids on the low-density lipoprotein (oxPL on LDL oroxLDL), mda (MDA) and protein and fat reaction formation mixture (MDA-LDL; MDA-BSA; Etc), the reaction of MDA and acetaldehyde generates mda-acetaldehyde (MAA) and forms mixture (MAA-LDL with protein or lipid reactant; MAA-BSA, at least a in etc).
The present invention also provides a kind of quantitatively determined complement factor H and oxidation specific antigens bonded method.This method also comprises the following operations step:
A, preparation oxidation specific antigens;
B, encapsulate the oxidation specific antigens on microwell plate;
C, complement factor H in the blood plasma is combined with the oxidation specific antigens;
D, with the TPPA complement factor H of anticomplement Factor H and the binding capacity of oxidation specific antigens.
Wherein, the antibody of the anticomplement Factor H described in the aforesaid method is any in monoclonal antibody, polyclonal antibody or the single-chain antibody variable region fragment.
Wherein, the encoding sox of the antibody described in the aforesaid method contains S107VH variable region of heavy chain and V-kappa22VL variable region of light chain.
Wherein, the steps d described in the aforesaid method can adopt the binding capacity of the next said antibody Ox LDL of at least a method in chemiluminescence immunoassay, EUSA method, biotin-avidin system assay method, the radioimmunoassay.
Wherein, also comprising step e in the aforesaid method, that is: is the typical curve that standard substance record according to purifying CFH, measures the quantitative of CFH, and the ratio of CFH and oxidation specific antigens binding capacity and CFH content.
According to first bright aspect of this law, we have discovered two kinds of genotypic CFH and AMD, and we are respectively to detect each disease haplotype with the mode of combination separately.Through the calculation formula that we set up, we can infer the probability of AMD morbidity.
The use of test kit of the present invention comprises following step and material.
A) the peripheral blood genomic dna is as the preparation of measuring masterplate;
B) preparation of genotype identification primer;
C) the pulsating genotype identification sequence of DNA cloning product.
The extraction and purification of peripheral blood genomic dna among the present invention can be through biological engineering method preparation well known in the art, and we advise using the blood DNA purification kit of Qiagen company.
The method of measuring the preparation of masterplate is:
10XNEB?Buffer?1ul
dNTP(10uM) 0.25ul
Primer-F(10uM)?0.25ul
Primer-R(10uM)?0.25ul
NEB?Taq(5U/ul)?0.05ul
DNA(25-50ng/ul)?1-1.5ul
H2O is supplemented to 10ul
PCR:95 degree 5min
95 degree 30s
58 degree 30s,
72 degree 30s 30-32cycle
72 degree 5min
Whether run glue checking PCR successful.
The primer of DNA masterplate preparation is among the present invention:
The CFH:rs2274700 genotype
Upstream primer: 5 '-CAGCCCCCACAAAAAGACTA-3 ' (SEQ ID No 1)
Downstream primer: 5 '-TGCTTGTCTTTTTCTTATTCTCTTCC-3 ' (SEQ ID No 2);
The CFH:rs1061170 genotype
Upstream primer: 5 '-TTTTTGGATGTTTATGCAATCTT-3 ' (SEQ ID No 3)
Downstream primer: 5 '-GGATGCATCTGGGAGTAGGA-3 ' (SEQ ID No 4);
The reaction that SNPs measures among the present invention is:
SNaPShot?mix?0.5μl
Purified?PCR?mix?1μl
SnapShot?primer(n)0.2μl×n
H
2O?to?Total?5μl
96℃10sec
50℃5sec
60℃30sec
25cycles
The primer that the genotype that is adopted among the present invention (SNP) is identified is:
The primer sequence of CFH rs10611170 genotype identification: 60-Forward-C/T
5’-TTG?TTA?TGG?TCC?TTA?GGA?AAA?TGT?TAT?TTT?CCT?TAT?TTG?GAA?AAT?GGATA?T?AAT?CAA?AAT-3’(SEQ?ID?No 5)
The primer sequence of CFH rs2274700 genotype identification: 52-Forward-A/G
5’-ATC?CTG?ATG?TTT?CAC?CAT?CTG?CTG?TTA?CAT?ATC?CTA?GTT?TGC?ATT?GATATT?T-3’(SEQ?ID?No 6)
The pulsating genotype identification sequence of DNA cloning product among the present invention, we adopt (but being not restricted to) ABI3100XL analyser, and (CA USA) carries out gene type according to explanation for ABI, Foster City.All SNPs carry out success ratio＞99.9% of gene type, and accuracy＞99% is judged by 20% random rearrangement sequence.
The sequence of identifying of CFH rs2274700 protective gene type (T) is (SEQ ID No 7):
ATAGGGACTTTATGAGAATATCTATATAATTTATACATCTATTAATTATAAAAACTAAAGATAAGTAATA
TTGAATATTGATATTTCTTTTTGTGCAAACCTTTGTTAGTAACTTTAGTTCGTCTTCAGTTATACATTAT
TTTTGGATGTTTATGCAATCTTATTTAAATATTGTAAAAATAATTGTAATATACTATTTTGAGCAAATTT
ATGTTTCTCATTTACTTTATTTATTTATCATTGTTATGGTCCTTAGGAAAATGTTATTTTCCTTATTTGG
AAAATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAAATCTATAGACGTTGCCTGCCATCC
TGGCTACGCTCTTCCAAAAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCTCCTACTCCCAGA
TGCATCCGTGTCAGTAAGTACACTACTCTGAAATCCTAGCATGTTCATGTCTTTCTAAGTAACATAGATG
ACATTCTAAGACTCATCTATATTAATTGTGGCAAAATGTTTATGTCACCTTGTTTTACCAATGGACCTAT
TTAGTTTTTGGTTTTTCAACTGTGTATAAATGAATATACAA。
The sequence of identifying of CFH rs10611170 pathogenic gene type (C) is (SEQ ID No 8):
ATAGGGACTTTATGAGAATATCTATATAATTTATACATCTATTAATTATAAAAACTAAAGATAAGTAATA
TTGAATATTGATATTTCTTTTTGTGCAAACCTTTGTTAGTAACTTTAGTTCGTCTTCAGTTATACATTAT
TTTTGGATGTTTATGCAATCTTATTTAAATATTGTAAAAATAATTGTAATATACTATTTTGAGCAAATTT
ATGTTTCTCATTTACTTTATTTATTTATCATTGTTATGGTCCTTAGGAAAATGTTATTTTCCTTATTTGG
AAAATGGATATAATCAAAATCATGGAAGAAAGTTTGTACAGGGTAAATCTATAGACGTTGCCTGCCATCC
TGGCTACGCTCTTCCAAAAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCTCCTACTCCCAGA
TGCATCCGTGTCAGTAAGTACACTACTCTGAAATCCTAGCATGTTCATGTCTTTCTAAGTAACATAGATG
ACATTCTAAGACTCATCTATATTAATTGTGGCAAAATGTTTATGTCACCTTGTTTTACCAATGGACCTAT
TTAGTTTTTGGTTTTTCAACTGTGTATAAATGAATATACAA。
The sequence of identifying of CFH rs2274700 protective gene type (T) is (SEQ ID No 9):
TAACAGTCATAAAGGTCTCAGCTAAAGCAAAATCAGTTTAAACCAGAATACACATAAAGCTCCCTAACTT
GTTTCTGTAACACAGAATGCTTTAGAGTAGGAAAAGCCTGAATGGAAAGACAGACTAATATCTGAGTAAT
TAATGTGAAAAGGAAAAAAAATTGATGTCTGCTTTGTTCCTGCAGGTTTTTTTTTCTTATCTTTTCAAAT
GAAATTATATCAGCCCCCACAAAAAGACTAAAGTTAGTAAACTTTTGTGTATCATCTGGATAATCAATAC
AAACATAATAAATTACTTACTAATGCACGTGGGTTGAGCTGACCATCCATCTTTCCCACATGTAATTGAT
CCTGATGTTTCACCATCTGCTGTTACATATCCTAGTTTGCATTGATATTTTGCTTTTTCTTTTAAGGCAT
ATGTATACTGAGATTCAGAAATAAACCCATTCTCAATATCTATACTTGATTTGGAACATGTTTCTAAAAG
GGAAGAGAATAAGAAAAAGACAAGCATATGATCAATAACATTTTATAAGAATTTAAGTAATATGTAAATA
TAAAAAATAATGAGTCATTTGTAACTGAAAACCTGGATAACCATAAGCATTCAAATACTTAAGTCAAGGA
AAATAAGCTCAGAGTTGCCAAAGACATTACATCAAGACTCTTCATCACTTTTTAAAACAAGGCTCTATTT
AAGACACTTACAATTATTTCTAAGAAATTATTGGAAATCTGTTTGTCTAATGGATTTGGAATTCTACAGC
ATGTCAGAACTCAATAGACAATGAGTATTAT。
The sequence of identifying of CFH rs2274700 pathogenic gene type (C) is (SEQ ID No 10):
TAACAGTCATAAAGGTCTCAGCTAAAGCAAAATCAGTTTAAACCAGAATACACATAAAGCTCCCTAACTT
GTTTCTGTAACACAGAATGCTTTAGAGTAGGAAAAGCCTGAATGGAAAGACAGACTAATATCTGAGTAAT
TAATGTGAAAAGGAAAAAAAATTGATGTCTGCTTTGTTCCTGCAGGTTTTTTTTTCTTATCTTTTCAAAT
GAAATTATATCAGCCCCCACAAAAAGACTAAAGTTAGTAAACTTTTGTGTATCATCTGGATAATCAATAC
AAACATAATAAATTACTTACTAATGCACGTGGGTTGAGCTGACCATCCATCTTTCCCACATGTAATTGAT
CCTGATGTTTCACCATCTGCTGTTACATATCCTAGTTTGCATTGATATTTCGCTTTTTCTTTTAAGGCAT
ATGTATACTGAGATTCAGAAATAAACCCATTCTCAATATCTATACTTGATTTGGAACATGTTTCTAAAAG
GGAAGAGAATAAGAAAAAGACAAGCATATGATCAATAACATTTTATAAGAATTTAAGTAATATGTAAATA
TAAAAAATAATGAGTCATTTGTAACTGAAAACCTGGATAACCATAAGCATTCAAATACTTAAGTCAAGGA
AAATAAGCTCAGAGTTGCCAAAGACATTACATCAAGACTCTTCATCACTTTTTAAAACAAGGCTCTATTT
AAGACACTTACAATTATTTCTAAGAAATTATTGGAAATCTGTTTGTCTAATGGATTTGGAATTCTACAGC
ATGTCAGAACTCAATAGACAATGAGTATTAT。
If wherein protectiveness allelotrope is that homozygote is labeled as (TT);
If being homozygote, wherein pathogenic allelotrope is labeled as (CC);
If wherein protectiveness/pathogenic allelotrope is that heterozygote is labeled as (TC).
According to a second aspect of the invention, we discover that low-density lipoprotein surface behind oxidative modification presents the same antigenic determinant of antigenic determinant with the shape phosphorylcholine (PC) that dissociates, or claim the epi-position structure.Therefore, anti-phosphorylcholine antibody can only combine with Ox LDL (OxLDL), and does not combine with inoxidized low-density lipoprotein, and the bonded amount is directly proportional with the degree of LDL oxidation.The present invention discovers that this PC epi-position is relevant with CFH pathogenic gene type in the amount that apolipoprotein B appears, the antibody of this anti-phosphorylcholine and plasma apolipoprotein B go up PC epi-position bonded amount in homozygote CFH rs10611170 pathogenic gene type (CC) for the highest; At protectiveness/pathogenic allelotrope is that heterozygote (TC) is for inferior high; At protectiveness allelotrope is that homozygote (TT) is minimum.(referring to accompanying drawing 2A).Therefore, the invention provides the new application of the antibody of anti-phosphorylcholine, promptly the specific reaction detection by quantitative through antigen-antibody goes out in the sample degree that the content of PC epi-position on the apolipoprotein B is used for oxidative damage in the human body.And can judge the risk of the morbidity of AMD according to this content.
So the invention provides the reagent and the working method of PC epi-position on a whole set of detection by quantitative apolipoprotein B, it comprises the following steps:
A) with anti-apolipoprotein B antibody low-density lipoprotein in the blood plasma is captured;
B) will resist the antibody of phosphorylcholine to contact with the sample that contains Ox LDL;
C) make said antibody and oxidation phosphoric acid choline binding;
D) binding capacity of said antibody of mensuration and oxidation phosphorylcholine.
In the method for the invention, the antibody of said anti-apolipoprotein B antibody and anti-phosphorylcholine can be bought from market also and can prepare through biological engineering method well known in the art.For example, Anti-human ApoB (LDL) and the TEPC15 available from Sigma chemical company promptly can be used as the antibody in the inventive method.In addition; Can prepare anti-apolipoprotein B antibody (method that promptly prepares the antiserum(antisera) IgG purification) with routine immunization method with purifying human apolipoprotein b injection goat; The antibody that perhaps prepares anti-phosphorylcholine with biological engineering method, the gene of the antibody of the said anti-phosphorylcholine of optimized encoding contain S107 VH variable region of heavy chain and V-kappa 22VL variable region of light chain.The particular content of relevant this respect; Can be referring to document: (Shaw; Et al.:Natural antibodieswith the T15 idiotype may act in atherosclerosis; Apoptotic clearance, andprotective immunity.J.Clin.Invest.105:1731-1740 (2000)
13These antibody can be to be selected from anti-phosphorylcholine monoclonal antibody, anti-phosphorylcholine polyclonal antibody or single-chain antibody variable region fragment.(see document: Moragan G, Berek C, Miller JF.An idiotypic determinantformed by both immunoglobulin constant and variable regions.Nature 1983 like TEPC15; 301 (5902): 720-2).
Two lipid acid tails that term used herein " phosphorylcholine " (Phosphocholine) refers to phosphatidylcholine (Yelkin TTS) removed the back remaining structure division.
Method of the present invention can be used for detecting any biological sample that contains the Ox LDL of band PC epi-position.Said sample is preferably serum, blood plasma, tissue homogenate, tissue extract, most preferably is serum.
Method of the present invention is a kind of immune labeled measuring method based on the susceptibility of specificity of reacting between antigen-antibody and markers tests.Promptly adopt enzyme, fluorescent agent, ri, luminous agent or electron dense material traget antibody or antigen, carry out the specific reaction between antigen-antibody, thus can detection by quantitative antibody or antigenic amount.Be direct method with the method that detects behind the antigen-specific antibodies mark wherein, the method that the SA of employing mark amplifies detected result is an indirect method.
Therefore; In the method for the invention, step (d) can adopt direct chemical luminescent immunoassay, indirect chemiluminescence immunoassay, directly radioimmunoassay, indirect radioimmunoassay method, directly EUSA method, indirect enzyme-linked immunosorbent assay method, directly the biotin-avidin system assay method, any in the biotin-avidin system assay method accomplished indirectly.And above-mentioned these direct methods and indirect method can be divided into sandwich assay and non-sandwich assay respectively further.
Double antibody sandwich method can be accomplished as follows: will resist phosphorylcholine antibody to be fixed on the solid phase carrier earlier; Add the sample that contains Ox LDL; Make the two contact, add anti-ApoB antibody again and (or claim anti-LDL antibody, Sigma); Make it to contact, measure amount and the quantitative content of Ox LDL of anti-ApoB antibody with Ox LDL.Perhaps, will resist ApoB antibody to be fixed on the solid phase carrier earlier, add the sample that contains Ox LDL; Make the two contact; Add anti-phosphorylcholine antibody again, make it to contact, measure amount and the quantitative content of Ox LDL of anti-phosphorylcholine antibody with Ox LDL.
Non-sandwich assay can be accomplished as follows: encapsulate solid phase carrier with the sample that contains Ox LDL earlier; The first antibody that adds anti-phosphorylcholine again; Make it to contact (the SA that also can further add anti-phosphorylcholine antibody if necessary with Ox LDL; Make it the first antibody contact of anti-phosphorylcholine and combine), measure amount and the quantitative content of Ox LDL of anti-phosphorylcholine antibody then.
For fear of manual operation, the test kit different batches is different with test apparatus and the error that causes in the method for the invention, comprises also that preferably step (e) is that standard substance make typical curve with the phosphorylcholine compound, and is and quantitative according to this typical curve.The amount of the oxidation specific antigen on the apolipoprotein B surface of measured binding capacity representative.That is, the establishing criteria curve calculates the content of the PC epi-position that is appeared among the ApoB of Board Lot, thereby confirms the oxidized in vivo degree of low-density lipoprotein.
Various phosphorylcholine compounds all can be used as phosphorylcholine compound used in step (d), such as but not limited to: phosphorylcholine, chlorination phosphorylcholine, acetylize phosphorylcholine, with serum albumin or keyhole keyhole limpet hemocyanin link coupled phosphorylcholine, with serum albumin or keyhole keyhole limpet hemocyanin link coupled phosphorylcholine, chlorination phosphorylcholine or acetylize phosphorylcholine.
According to a third aspect of the present invention, we discover: in view of natural antibody in the innate immune system and complement form body defending system jointly, resist multiple exogenous paathogenic factor, like infection and remove endogenic oxidative damage; Simultaneously, on gene level, the AMD morbidity has stronger dependency with CFH.This hypothesis is verified in our research---be CFH maybe with have the specific molecular antigen epi-position of oxidation, combine like oxPC, MAA, thereby the process of AMD regulated and controlled in the inflammatory reaction that causes thus.
So the present invention provides a whole set of quantitatively determined plasma C FH and oxidation specific antigens bonded reagent and working method in view of the above, it comprises the following steps:
A) preparation of oxidation specific antigens;
B) oxidation specific antigens encapsulating at microwell plate;
C) the combining of CFH and oxidation specific antigens in the blood plasma;
D) with the binding capacity of anti-CFH TPPA CFH and oxidation specific antigens.
Oxidation specific antigens used in the present invention comprises (but being not restricted to):
Oxidized phospholipids on the low-density lipoprotein (oxPL on LDL or oxLDL);
Mda (MDA) and protein form with the fat reaction mixture (MDA-LDL, MDA-BSA, etc);
The reaction of MDA and acetaldehyde generate mda-acetaldehyde (MAA) and form with protein or lipid reactant mixture (MAA-LDL, MAA-BSA, etc).
The statement of these antigenic preparations or existing document, but in reagent of the present invention with its stdn.Wherein LDL prepares through branch's centrifuging separation with the blood plasma that normal volunteer contributed
[16]Natural LDL is kept in the phosphoric acid buffer (PBS) that contains 0.27mM EDTA, and 4 ℃ of preservations were used in 2 weeks.With the copper sulfate of LDL (1mg/mL) adding 10 μ M, hatched 18 hours, and obtained OxLDL for 37 ℃.MDA-LDL uses by 1,1,3,3-tetramethyl propyl ether, and the fresh MDA that processes adds LDL and obtains.MAA-LDL is synthesized under pH 5.0 and 37 ℃ of conditions of 4 hours by the MDA and the acetaldehyde (LDL/MDA/AA=1mg/50 μ mol/100 μ mol) of prepared fresh.
The specificity of these oxidation specific antigenss can be used after must using two kinds of antibody tests: TEPC15 (Sigma) and Anti-MDA-OxLDL (Abcam Cat #ab17354).Natural LDL is necessary can not be by any combination of two kinds of antibody; The OxLDL that is used for oxidized phospholipids is merely able to combined and can not be combined by Anti-MDA-OxLDL by TEPC15; MDA-LDL, MDA-BSA, MAA-LDL, perhaps MAA-BSA is merely able to combined and can not be combined by TEPC15 by Anti-MDA-OxLDL.(seeing accompanying drawing 3) then can not use if any cross coupled.
The above-mentioned b of the present invention) in, needs the oxidation specific antigens is dissolved in the phosphoric acid buffer (PBS) that contains 0.27mM EDTA, earlier antigen (5 μ g/ml are dissolved among the PBS) is encapsulated in the micropore enzyme plate, place 4 ℃ to spend the night.Blood plasma 1: 100 dilution (combining dilution in 1: 1000 with MAA-LDL) back is added in microwell plate, then with biotin labeling resist-CFH is as first antibody, and detect with the SA of SEAP (AP) mark.The amount of CFH in the plasma sample of each identical extension rate in the gained data as standard, is used to revise the absolute value of this sample CFH and antigen bonded, and obtains the per-cent of CFH and antigen bonded.
Method of the present invention is a kind of immune labeled measuring method based on the susceptibility of specificity of reacting between antigen-antibody and markers tests.Promptly adopt enzyme, fluorescent agent, ri, luminous agent or electron dense material traget antibody or antigen, carry out the specific reaction between antigen-antibody, thus can detection by quantitative antibody or antigenic amount.Be direct method with the method that detects behind the antigen-specific antibodies mark wherein, the method that the SA of employing mark amplifies detected result is an indirect method.
Therefore; In the method for the invention, step (d) can adopt direct chemical luminescent immunoassay, indirect chemiluminescence immunoassay, directly radioimmunoassay, indirect radioimmunoassay method, directly EUSA method, indirect enzyme-linked immunosorbent assay method, directly the biotin-avidin system assay method, any in the biotin-avidin system assay method accomplished indirectly.
Description of drawings
Accompanying drawing 1 1-a representes the structure of low-density lipoprotein, the oxidation specific antigens decision family of TEPC15.1-b representes the phosphorylcholine (part in the circle) on the oxidized phospholipids.
CFH and oxidation specific antigens combines in accompanying drawing 2 (A) blood plasma.(B) and (C) CFH of different genotype; Comprise that its rs10611170 (Y402H)/rs2274700 is CC/CC (19 example); The combination of TT/CC (13 example) and TT/TT type (16 example) all has with OxLDL (B) or MAA-LDL (C) to have the very different combinations of notable difference.Income value is adjusted by CFH reading in the identical extent of dilution plasma sample, gets it very.Data are expressed as relative light unit (RLU)/100 millisecond, mean+SD.
Accompanying drawing 3 T15 and anti-MAA/MDA-LDL (Abcam Cat#ab17354) combine with oxidation epitope on the LDL; But (unmodified) LDL that debond is natural; Data logging mode---relative light unit (RLU)/100 millisecond is got the MV of replicate measurement three times.
The oxPL/ apolipoprotein B level of the blood plasma of the CFH of accompanying drawing 4 (4-a) different genotype (representing) with the suitable light unit of RLU.(4-b) relative combining of genotype plasma C FH and oxidation specific antigens.
The genotypic evaluation collection of illustrative plates of accompanying drawing 5.CFH rs10611170.5-a is TT, and 5-b is CT, and 5-c is CC.
Embodiment
The genotypic evaluation of CFH.
The method of Qiagen is adopted in the extraction of peripheral blood genomic dna.
A) the genotype identification masterplate prepares with the PCR method:
System is following:
10XNEB?Buffer?1ul
dNTP(10uM)?0.25ul
Primer-F(10uM)?0.25ul
Primer-R(10uM)?0.25ul
NEB?Taq(5U/ul)?0.05ul
DNA(25-50ng/ul)?1-1.5ul
H2O is supplemented to 10ul
The primer of DNA masterplate preparation is:
The CFH:rs2274700 genotype
Primer-F：CAGCCCCCACAAAAAGACTA
Primer-R：TGCTTGTCTTTTTCTTATTCTCTTCC
The CFH:rs1061170 genotype
Primer-F：TTTTTGGATGTTTATGCAATCTT
Primer-R：GGATGCATCTGGGAGTAGGA
PCR condition: 95 degree 5min
95 degree 30s
58 degree 30s,
72 degree 30s 30-32cycle
72 degree 5min
Whether run glue checking PCR successful
The PCR product purification: system at this moment will be regarded several snp as, if only do one, with regard to PCR product purifying all.If be several snp in an individual system, will each PCR product add different amounts and carry out purifying.Particular case will be according to the preliminary experiment result.
PCR(n)8-9μl
SAP?2μl(1U/μl)
ExoI?1μl(1U/μl)
Total?11-12μl
37℃1h
75℃15min
1cycle
B) SNaPShot reactive system
SNaPShot?mix 0.5μl
Purified?PCR?mix?1μl
SnapShot?primer(n)0.2μl×n
H2O?to?Total?5μl
96℃10sec
50℃5sec
60℃30sec
25cycles
The n here is exactly, if 1 snp is exactly 1, if several snp does together, will all will add by each primer.System is different like this.
The purifying of SNaPShot product
1μl?SAP?per?well
37℃1h
75℃15min
1cycle
The sex change of SNaPShot product
Product 1μl
HiDi 7μl
95℃5min
Ice?chill?immediately
C) going up ABI sequencer sequenator operates
The result reads, and is the principle according to snp, and our designed primer length is different with being with fluorescence and read.Such as rs1061170, be C or T, we distinguish according to color is different just in the figure the inside.If a black peak is attended school CC, if TT is attended school at a red peak, or 2 peaks, be read as CT (accompanying drawing 5).
ELISA (ELISA) is measured the oxidized phospholipids on the apolipoprotein B
Adopt double antibody method to measure the oxidation specific antigens OxPC on the ApoB in the serum sample.
Material: MicroFluor droplet plate, goat anti people source ApoB antibody, PBS detects sample; BSA, TEPC15, the anti-TEPC15 SA of SEAP (AP) mark; LumiPhos 530 (Lumigen Inc., Southfield, Michigan; USA), Glomax nitometer (Promega), phosphorylcholine (PC) compound.
Method: use trapping antibody, the hole of promptly anti-ApoB antibody sandwich MicroFluor droplet plate.These antibody can be to be selected from monoclonal antibody, polyclonal antibody or single-chain antibody.With PBS washing hole three times, will detect then sample-blood plasma with PBS (BSA-PBS) dilution (1: 50 to 1: 1000) that contains 1%BSA after, add the hole of droplet plate.Incubated at room 20-60 minute, preferred 50 minutes.With PBS washing hole three times, the first antibody TEPC15 of BSA-PBS dilution is added in the hand-hole, and under room temperature incubation.With PBS washing hole three times.The anti-TEPC15 SA that adds SEAP (AP) mark.Behind PBS washing hole three times, then use water rinse, and add LumiPhos 530 solution.Use the Glomax nitometer to measure light emission with relative light unit (RLU).Simultaneously encapsulate the hole behind the continuous 10 times of gradient dilutions of phosphorylcholine (PC-Cl) compound with concentration known, add in the hand-hole with the first antibody TEPC15 of BSA-PBS dilution, and under room temperature incubation.With PBS washing hole three times.The anti-TEPC15 SA that adds SEAP (AP) mark.Then use water rinse, and add LumiPhos530 solution, measure RLU, the production standard curve.Measured value per sample finds out the content of OxPC oxidation epi-position.
We have measured the value of OxPL/ApoB in the blood plasma with this method and have found that they and CFH are genotypic oppositely relevant.We show that to the mensuration of OxPL/apoB in patient's AMD blood plasma its OxPL/apoB value is relevant with this patient's CFH genotype.Because CFH disease type monoploid 1 (Y402H) is topmost disease type monoploid; Our mensuration is found; OxPL/ apolipoprotein B level (representing) with blood plasma of CFH state of risk Y402H genotype (CC) with the suitable light unit of RLU; Be higher than the blood plasma with CFH protection type Y402H genotype (TT): (the CC type is that 46006 ± 2333 Vs.CT types are 40806 ± 1363, and the P value is 0.018; The Vs.TT type is 34706 ± 1929, and the P value is 0.00027, RLU ± standard deviation) (seeing accompanying drawing 4).This shows that CFH is reverse relevant with the avidity of oxPL and the level of blood plasma oxPL.This can be interpreted as combining of CFH and OxPL, has reduced the integrality of oxidative damage in the blood.
Embodiment 3
ELISA (ELISA) mensuration CFH combines with the oxidation specific antigens
Material: MicroFluor droplet plate, the oxidation specific antigens, PBS detects sample; BSA, anti-CFH antibody, the anti-CFH SA of SEAP (AP) mark, LumiPhos 530 (Lumigen Inc.; Southfield, Michigan, USA), Glomax nitometer (Promega).
Method: use the oxidation specific antigens, comprise natural LDL (as negative control), OxLDL, MDA-LDL, MAA-LDL is diluted in PBS with 2 mcg/ml, adds the hole that every hole 50 microlitres encapsulate MicroFluor droplet plate.With PBS washing hole three times, will detect then sample-blood plasma with PBS (BSA-PBS) dilution (1: 50 to 1: 1000) that contains 1%BSA after, add the hole of droplet plate.Incubated at room 20-60 minute, preferred 50 minutes.With PBS washing hole three times, add biotin labeled anti-CFH antibody.With PBS washing hole three times, add the Neutravdin SA of SEAP (AP) mark.Behind PBS washing hole three times, then use water rinse, and add LumiPhos 530 solution.Use the Glomax nitometer to measure light emission with relative light unit (RLU).
Experimental observation is arrived, CFH and OxLDL, and MDA-LDL and MAA-LDL have stronger bonding force.With after blood plasma (containing CFH) 1: 100 dilution, CFH wherein can be adsorbed on microwell plate on antigen combine CFH and oxidation-LDL not; Ox-LDL; The bonding force of MDA-LDL and MAA-LDL is respectively 7.9 ± 0.19,19.9 ± 0.80,37.7 ± 1.60 and 102.4 ± 1.44 (mean+SD); All have the significance difference opposite sex (ANOVA statistics: N=70, P=6.4xE-164) (Fig. 2 A).
Owing to there are two kinds of main type AMD disease haplotypes relevant with CFH, we are respectively to detect the bonding force of each disease haplotype separately with the mode of combination.Isozygoty rs10611170CC (402H risk allelotrope) than the CFH of protectiveness TT (402Y) for OxLDL (16.3 ± 0.77Vs.23.3 ± 1.21, P=1.06xE-5) or MAA (99.2 ± 1.93 Vs.105.2 ± 2.18, bonding force P=0.04) all a little less than.Equally; The CFH allelic bonding force of rs2274700CC of isozygotying has a little less than the bonding force than allelotrope TT; Both with oxLDL combine be respectively that (CC is 16.3 ± 0.94 to 25.8 ± 1.67 to TT; P=0.00034), both with MAA-LDL combine be respectively that (CC is 97.6 ± 2.10 to 109.1 ± 4.09 to TT, P=0.028).
Our further analysis is worked as two haplotypes and is made the additive effect whether time spent exists keying action simultaneously.Combine the statistical result showed compare with OxLDL: a pair of protection haplotype TT/TT compares with a risk haplotype that (TT/TT is 27.7 ± 1.05 to 21.7 ± 1.83 than TT/CC; P=0.010); TT/TT compares with a pair of risk haplotype that (TT/TT compares CC/CC; Be 27.7 ± 1.05 to 16.8 ± 0.97, P=4.68xE-8) (Fig. 2 B), promptly the bonding force of haplotype TT/TT and OxLDL is showing and is increasing.Because being combined in to dilute at 1: 100 of CFH and MAA-LDL almost reaches capacity, we detect its influence to bonding force after with 1: 1000 dilution proportion of blood plasma.The statistical result showed of comparing with the MAA-LDL combination; A pair of protection haplotype TT/TT compares with a risk haplotype TT/CC that (TT/TT is 59.7 ± 2.46Vs. 50.1 ± 3.13 than TT/CC; P=0.026); A pair of protection haplotype TT/TT compare with a pair of risk haplotype (TT/TT is 59.7 ± 2.46Vs.40.8 ± 2.46 than CC/CC, P=3.37xE-6) is that the bonding force of a pair of protection haplotype TT/TT and MAA-LDL significantly increases (accompanying drawing 2C).
Reference:
1.Manolio?TA，Brooks?LD，Collins?FS.A?HapMap?harvest?of?insights?into?the?geneticsof?common?disease.J?Clin?Invest?2008；118：1590-605.
2.Klein?RJ，Zeiss?C，Chew?EY，et?al.Complement?factor?H?polymorphism?in?age-relatedmacular?degeneration.Science?2005；308：385-9.
3.Maller?J，George?S，Purcell?S，et?al.Common?variation?in?three?genes，includinga?noncoding?variant?in?CFH，strongly?influences?risk?of?age-related?maculardegeneration.Nat?Genet?2006；38：1055-9.
4.Haines?JL，Hauser?MA，Schmidt?S，et?al.Complement?factor?H?variant?increasesthe?risk?of?age-related?macular?degeneration.Science?2005；308：419-21.
5.Hageman?GS，Anderson?DH，Johnson?LV，et?al.A?common?haplotype?in?the?complementregulatory?gene?factor?H(HF1/CFH)predisposes?individuals?to?age-related?maculardegeneration.Proc?Natl?Acad?Sci?U?S?A?2005；102：7227-32.
6.Edwards?AO，Ritter?R，3rd，Abel?KJ，Manning?A，Panhuysen?C，Farrer?LA.Complementfactor?H?polymorphism?and?age-related?macular?degeneration.Science?2005；308：421-4.
7.Li?M，Atmaca-Sonmez?P，Othman?M，et?al.CFH?haplotypes?without?the?Y402H?codingvariant?show?strong?association?with?susceptibility?to?age-related?maculardegeneration.Nat?Genet?2006；38：1049-54.
8.Raychaudhuri?S，Ripke?S，Li?M，et?al.Associations?of?CFHR1-CFHR3?deletion?anda?CFH?SNP?to?age-related?macular?degeneration?are?not?independent.Nat?Genet；42：553-5；author?reply?5-6.
9.Binder?CJ，Chang?MK，Shaw?PX，et?al.Innate?and?acquired?immunity?in?atherogenesis.Nat?Med?2002；8：1218-26.
10.Brewer?GJ.Iron?and?copper?toxicity?in?diseases?of?aging，particularlyatherosclerosis?and?Alzheimer’s?disease.Exp?Biol?Med(Maywood)2007；232：323-35.
11.Beatty?S，Koh?H，Phil?M，Henson?D，Boulton?M.The?role?of?oxidative?stress?in?the?pathogenesis?of?age-related?macular?degeneration.Surv?Ophthalmol2000；45：115-34.
12.Hollyfield?JG，Bonilha?VL，Rayborn?ME，et?al.Oxidative?damage-inducedinflammation?initiates?age-related?macular?degeneration.Nat?Med?2008；14：194-8.
13.Shaw?PX，Horkko?S，Chang?MK，et?al.Natural?antibodies?with?the?T15?idiotype?mayact?in?atherosclerosis，apoptotic?clearance，and?protective?immunity.J?Clin?Invest2000；105：1731-40.
14.Chou?MY，Hartvigsen?K，Hansen?LF，et?al.Oxidation-specific?epitopes?are?importanttargets?of?innate?immunity.J?Intern?Med?2008；263：479-88.
15.Thiele?GM，Duryee?MJ，Willis?MS，et?al.Malondialdehyde-acetaldehyde(MAA)modified?proteins?induce?pro-inflammatory?and?pro-fibrotic?responses?by?liverendothelial?cells.Comp?Hepatol?2004；3?Suppl?1：S25.
16.Havel?RJ，Eder?HA，Bragdon?JH.The?distribution?and?chemical?composition?ofultracentrifugally?separated?lipoproteins?in?human?serum.J?Clin?Invest1955；34：1345-53.
Claims (18)
1. one kind is used for the genotypic test kit of identifier's tissue samples DNA complement factor H, and this test kit comprises following ingredients:
A, from people's tissue samples, extract the reagent of dna profiling;
B, be used for from the primer of DNA masterplate amplification complement factor H gene fragment; Comprise:
The genotypic amplimer of complement factor H: rs2274700 is right:
Upstream primer: 5 '-CAGCCCCCACAAAAAGACTA-3 ';
Downstream primer: 5 '-TGCTTGTCTTTTTCTTATTCTCTTCC-3 ';
The genotypic amplimer of and complement factor H: rs1061170 is right:
Upstream primer: 5 '-TTTTTGGATGTTTATGCAATCTT-3 '
Downstream primer: 5 '-GGATGCATCTGGGAGTAGGA-3 ';
And:
C, be used for the segment of DNA cloning product is carried out the primer sequence of genotype identification, comprise:
The primer sequence of CFH rs10611170 genotype identification:
5’-TTG?TTA?TGG?TCC?TTA?GGA?AAA?TGT?TAT?TTT?CCT?TAT?TTG?GAA?AATGGA?TAT?AAT?CAA?AAT-3’；
The primer sequence of CFH rs2274700 genotype identification:
5’-ATC?CTG?ATG?TTT?CAC?CAT?CTG?CTG?TTA?CAT?ATC?CTA?GTT?TGC?ATTGAT?ATT?T-3’。
2. according to the described test kit of claim, it is characterized in that described people's tissue samples is the peripheral blood sample.
3. the genotypic method of complement factor H among identifier's tissue samples DNA is characterized in that this method may further comprise the steps:
A, from people's tissue samples, extract and the purify DNA template;
The gene fragment of b, the complement factor H that from dna profiling, increases, amplification primers comprises:
The genotypic amplimer of complement factor H: rs2274700 is right:
Upstream primer: 5 '-CAGCCCCCACAAAAAGACTA-3 ';
Downstream primer: 5 '-TGCTTGTCTTTTTCTTATTCTCTTCC-3 ';
The genotypic amplimer of and complement factor H: rs1061170 is right:
Upstream primer: 5 '-TTTTTGGATGTTTATGCAATCTT-3 '
Downstream primer: 5 '-GGATGCATCTGGGAGTAGGA-3 ';
The primer sequence of c, use genotype identification increases to the gene fragment of the complement factor H that step b obtains, and product order-checking the carrying out genotype SNP that obtains identifies, if wherein protectiveness allelotrope is that homozygote is labeled as TT; If being homozygote, wherein pathogenic allelotrope is labeled as CC; If wherein protectiveness/pathogenic allelotrope is that heterozygote is labeled as TC;
The primer sequence of described genotype identification comprises:
The primer sequence of CFH rs10611170 genotype identification:
5’-TTG?TTA?TGG?TCC?TTA?GGA?AAA?TGT?TAT?TTT?CCT?TAT?TTG?GAA?AATGGA?TAT?AAT?CAA?AAT-3’；
The primer sequence of CFH rs2274700 genotype identification:
5’-ATC?CTG?ATG?TTT?CAC?CAT?CTG?CTG?TTA?CAT?ATC?CTA?GTT?TGC?ATTGAT?ATT?T-3’。
4. the test kit of oxidized phospholipids on the detection by quantitative apolipoprotein B, this test kit comprises following ingredients:
A, anti-apolipoprotein B antibody are in order to capture low-density lipoprotein in the blood plasma;
The antibody of b, anti-phosphorylcholine is in order to contact with the sample that contains Ox LDL of capturing.
5. test kit according to claim 4 is characterized in that the encoding sox of said antibody contains S107VH variable region of heavy chain and V-kappa 22VL variable region of light chain.
6. the method for oxidized phospholipids on the detection by quantitative apolipoprotein B:
A, low-density lipoprotein in the blood plasma is captured with anti-apolipoprotein B antibody;
B, will resist the antibody of phosphorylcholine to contact with the sample that contains Ox LDL;
C, make said antibody and oxidation phosphoric acid choline binding;
The binding capacity of d, the said antibody of mensuration and Ox LDL.
7. method according to claim 6 is characterized in that said antibody is any one in monoclonal antibody, polyclonal antibody or the single-chain antibody variable region fragment.
8. method according to claim 7 is characterized in that the encoding sox of said antibody contains S107VH variable region of heavy chain and V-kappa 22VL variable region of light chain.
9. method according to claim 6 is characterized in that said the Ox LDL sample is arranged is serum, blood plasma, tissue homogenate or tissue extract.
10. method according to claim 6 is characterized in that: said step (d) can adopt at least a method in chemiluminescence immunoassay, EUSA method, biotin-avidin system assay method, the radioimmunoassay to come the binding capacity of said antibody Ox LDL.
11., it is characterized in that: also comprise step e, that is:, confirm the amount of the oxidation specific antigen determinant on Ox LDL surface according to being the typical curve that standard substance record with the phosphorylcholine compound according to each described method of claim 6～10.
12. quantitatively determined complement factor H and oxidation specific antigens bonded test kit, this test kit contains: the oxidation specific antigens; The antibody of anticomplement Factor H.
13. quantitatively determined complement factor H and oxidation specific antigens bonded method comprise the following operations step:
A, preparation oxidation specific antigens;
B, encapsulate the oxidation specific antigens on microwell plate;
C, complement factor H in the blood plasma is combined with the oxidation specific antigens;
D, with the TPPA complement factor H of anticomplement Factor H and the binding capacity of oxidation specific antigens.
14. method according to claim 13, the antibody that it is characterized in that said anticomplement Factor H are in monoclonal antibody, polyclonal antibody or the single-chain antibody variable region fragment any.
15. method according to claim 14 is characterized in that said anticomplement Factor H is any one in monoclonal antibody, polyclonal antibody or the single-chain antibody variable region fragment.
16. method according to claim 14 is characterized in that the encoding sox of said antibody contains S107VH variable region of heavy chain and V-kappa 22VL variable region of light chain.
17. method according to claim 13 is characterized in that: said steps d can adopt at least a method in chemiluminescence immunoassay, EUSA method, biotin-avidin system assay method, the radioimmunoassay to come the binding capacity of said antibody Ox LDL.
18. according to each described method of claim 6～11; It is characterized in that: also comprise step e; That is: be the typical curve that standard substance record according to the purifying complement factor H; Measure the quantitative of complement factor H, and the ratio of complement factor H and oxidation specific antigens binding capacity and complement factor H content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100432266A CN102649975A (en) | 2011-02-23 | 2011-02-23 | Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100432266A CN102649975A (en) | 2011-02-23 | 2011-02-23 | Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102649975A true CN102649975A (en) | 2012-08-29 |
Family
ID=46692102
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100432266A Pending CN102649975A (en) | 2011-02-23 | 2011-02-23 | Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102649975A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104142401A (en) * | 2014-07-25 | 2014-11-12 | 北京普恩光德生物科技开发有限公司 | Bladder tumor-associated antigen detection kit |
| CN106519030A (en) * | 2016-12-22 | 2017-03-22 | 广州泰诺迪生物科技有限公司 | Complement factor H inhibitor and application related to same |
| CN107118273A (en) * | 2017-05-15 | 2017-09-01 | 广州泰诺迪生物科技有限公司 | A kind of full people source anticomplement factor H antibody |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1536365A (en) * | 2003-04-08 | 2004-10-13 | 旭 萧 | Quvantitative determination of oxidative low-density lipoprotein by using anti-phosphorylcholine antibody and its application in diagonosis of atherosis |
-
2011
- 2011-02-23 CN CN2011100432266A patent/CN102649975A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1536365A (en) * | 2003-04-08 | 2004-10-13 | 旭 萧 | Quvantitative determination of oxidative low-density lipoprotein by using anti-phosphorylcholine antibody and its application in diagonosis of atherosis |
Non-Patent Citations (3)
| Title |
|---|
| ALIREZA JAVADZADEH ET AL: ""Plasma oxidized LDL and thiol-containing molecules in patients with exudative age-related macular degeneration"", 《MOLECULAR VISION》, vol. 16, 6 December 2010 (2010-12-06) * |
| MOTOBIRO KAMEI ET AL.: ""Scavenger Receptors for Oxidized Lipoprotein in Age-Related Macular Degeneration"", 《INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE》, vol. 48, no. 4, 30 April 2007 (2007-04-30) * |
| 唐炜: ""复杂疾病连锁不平衡分析及诱变小鼠模型研究"", 《中国博士学位论文全文数据库 医药卫生科技辑》, no. 2, 28 February 2009 (2009-02-28) * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104142401A (en) * | 2014-07-25 | 2014-11-12 | 北京普恩光德生物科技开发有限公司 | Bladder tumor-associated antigen detection kit |
| CN106519030A (en) * | 2016-12-22 | 2017-03-22 | 广州泰诺迪生物科技有限公司 | Complement factor H inhibitor and application related to same |
| CN106519030B (en) * | 2016-12-22 | 2020-01-07 | 广州泰诺迪生物科技有限公司 | Complement factor H inhibitors and uses related thereto |
| CN107118273A (en) * | 2017-05-15 | 2017-09-01 | 广州泰诺迪生物科技有限公司 | A kind of full people source anticomplement factor H antibody |
| CN107118273B (en) * | 2017-05-15 | 2020-02-18 | 广州泰诺迪生物科技有限公司 | Fully human anti-complement factor H antibody |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11920199B2 (en) | Methods and compositions for screening and treating developmental disorders | |
| US10415100B2 (en) | Methods for detecting target DNA sequences | |
| CN101970689A (en) | Gene expression markers for inflammatory bowel disease | |
| US9963741B2 (en) | Screening methods for transfusion related acute lung injury (TRALI) | |
| JP2008505649A (en) | Immune cell biosensor and method of use thereof | |
| KR20180048422A (en) | Nanocomposite consisting of magnetic nanoparticles and gold nanoclusters and method for manufacturing the same | |
| CN102649975A (en) | Quantitative determination kit for complement factor H genotype, oxidized phosphorylcholine on apolipoprotein and plasma complement factor H and determination method | |
| WO2018220129A1 (en) | Mmp-8 as a marker for identifying infectious disease | |
| EP2600151B1 (en) | Reagent and reagent kit for measurement of fdp, and measurement method | |
| WO2007068830A1 (en) | Distinction between bacterial meningitis and viral meningitis | |
| Ranjbar et al. | Helicobacter pylori infection: conventional and molecular strategies for bacterial diagnosis and antibiotic resistance testing | |
| US20090176245A1 (en) | Rheumatoid Arthritis Test Method and Treating Method | |
| AU2021267650A1 (en) | Detection of complement proteins | |
| Isoshima et al. | Microbiome composition comparison in oral and atherosclerotic plaque from patients with and without periodontitis | |
| US12077827B2 (en) | Methods for predicting the risk of developing pulmonary colonization/infection by Pseudomonas aeruginosa | |
| US20210180131A1 (en) | Methods for detecting and treating atopic dermatitis | |
| ES2427407T3 (en) | Proteins used for the diagnosis of a Lyme borreliosis | |
| KR101295019B1 (en) | Diagnosing composition for MCI, KIT by measurement lipocalin 2 and providing method of information about diagnosis MCI | |
| TW201314209A (en) | A method for predicting clinical benefit in the treatment of neurodevelopmental, neurological or neuropsychiatric disorders | |
| EP3775281A1 (en) | Methods for predicting the risk of developing pulmonary colonization/infection by pseudomonas aeruginosa | |
| WO2019027929A1 (en) | Methods and apparatus for determining risk of autism spectrum disorder | |
| US20070161006A1 (en) | Single nucleotide polymorphisms in protein-tyrosine phosphatase receptor-type delta for the diagnosis of susceptibility to infection and asthma | |
| CN117487906B (en) | GAMT gene mutant, reagent, kit and application | |
| WO2020158811A1 (en) | Method for identifying helicobacter pylori strain and kit for identification | |
| Halankar et al. | Uromodulin levels in chronic kidney disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120829 |