CN102649959A - Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences - Google Patents
Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences Download PDFInfo
- Publication number
- CN102649959A CN102649959A CN2012101629806A CN201210162980A CN102649959A CN 102649959 A CN102649959 A CN 102649959A CN 2012101629806 A CN2012101629806 A CN 2012101629806A CN 201210162980 A CN201210162980 A CN 201210162980A CN 102649959 A CN102649959 A CN 102649959A
- Authority
- CN
- China
- Prior art keywords
- flanking sequence
- seq
- primer
- seconds
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer and method used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences. The primer is shown as follows: a-, an Ac terminal specific primer used for separating Ac/Ds 5' flanking sequences is a base sequence shown by SEQIDNO:1-SEQIDNO:7; b-, an Ac terminal specific primer used for separating Ac/Ds 3' flanking sequences is a base sequence shown by SEQIDNO:8-SEQIDNO:14. The invention relates to a specific primer and method used for identifying and distinguishing the Ac and Ds flanking sequences. The invention is characterized in that the primer is the base sequence shown by SEQIDNO:15-SEQIDNO:18. The Ac specific primers can be well amplified to obtain the Ac or Ds flanking sequences in a genome. The detection method is simple in operation and is an important technical means for obtaining the Ac flanking sequences of Ac mutants on a large scale and separating genes of Ac insertion mutants.
Description
Technical field
The present invention relates to be used for separating and identifying the Auele Specific Primer of corn Ac/Ds swivel base two mutants Ac/Ds transposon flanking sequence.
Background technology
Corn is global first food crop, is main grain source, the whole world.The ultimate production of China's corn has surpassed wheat, becomes the second largest food crop that are only second to paddy rice.And corn all is a kind of hereditary pattern plant for a long time.The genomic sequencing of corn B73 is accomplished, and this will accelerate the scientific research of corn aspect.There are 3.2 ten thousand genes at least in expectation in corn, the clone of these genes and functional analysis have become next important challenge.In the method for numerous gene clones, insert a kind of very effective means of mutation research.Comprise that mainly T-DNA inserts sudden change and transposon inserts sudden change.Because the restriction of transgenic technology is difficult to use the T-DNA interpolation and inserts mutation analysis in corn.But having endogenous transposon at corn is the instrument that well inserts mutation research.It is at present topmost in corn that to be used to create the transposon that inserts two mutants be Mutator (Mu) and two systems of Activator/Dissociator (Ac/Ds).It is high that the Mu factor has the swivel base frequency, the characteristics that the high and full genome range of forward mutation rate is inserted, existing several at home and abroad at present fairly large Mu insert mutant libraries, and be used for corn dividing from the corn clone gene.Though its swivel base frequency of Ac/Ds is low than the Mu transposon; But it is low at corn gene group copy number; Tend to chain site swivel base with tend to insert hypomethylated gene enrichment region, be used as in recent years to be widely used in and make up insert mutant library and insert mutation analysis with the orientation of carrying out gene with Mu complementary system.
In isolation identification swivel base system with utilize in the process of transposon tagging clone gene, the flanking sequence that separates transposon is an important link.The method of traditional separation Ac/Ds flanking sequence is that partial sequence with Ac or Ds is as probe; Hybridize through Southern and to identify pairing specific band in each swivel base based material; Reclaim the DNA in specific band zone then and carry out intramolecular from connecting; Come the amplifying specific band through the method for inverse PCR again, at last with order-checking of flank band and checking.This method is big to the requirement of DNA, and is Southern and inverse PCR is the method for time and effort consuming, is difficult to improve conventional efficient.Therefore set up simple to operate, Ac/Ds flanking sequence rapidly and efficiently separates and authentication method inserts the evaluation of two mutants and utilizes transposon tagging to carry out gene clone for Ac/Ds and all has great importance.
Siebert etc. utilize a kind of partially double stranded joint to be connected on the dna fragmentation of the flat end of cutting through enzyme, utilize the sequence of the primer of joint primer and gene specific through nested pcr amplification upstream region of gene or downstream then.Owing to terminally use amino-terminated, reduced because the non-purpose band that the joint primer increases and brings separately, thereby improved the specificity of PCR product at 3 ' of the short chain of joint.Ji and Braam utilize the endonuclease digestion genomic dna that produces 3 ' overhang; Be utilized in 3 ' of primer then and hold joint primer and the gene-specific primer amplification that has with the protruding terminus complementary base; Save step of connecting in this method, further improved the efficient of experiment.
Summary of the invention
One of the object of the invention is to provide a kind of Auele Specific Primer that is used for separating Ac/Ds swivel base two mutants Ac/Ds transposon flanking sequence.
Two of the object of the invention is to provide the method for utilizing this Auele Specific Primer to separate Ac/Ds transposon flanking sequence in the Ac/Ds swivel base two mutants.
Three of the object of the invention is to provide a kind of and is used to identify that above-mentioned Ac/Ds transposon flanking sequence is the Auele Specific Primer of Ac or the flanking sequence of Ds.
Four of order of the present invention is to provide and utilizes this Auele Specific Primer to distinguish the method for identifying Ac and Ds transposon flanking sequence.
For achieving the above object, the present invention adopts following technical scheme:
A kind of Auele Specific Primer that is used to separate Ac/Ds transposon flanking sequence is characterized in that this primer is:
A. the terminal Auele Specific Primer of Ac that is used to separate Ac/Ds 5 ' the distolateral wing sequence is the base sequence shown in SEQ ID NO:1～SEQ ID NO:7;
B. the terminal Auele Specific Primer of Ac that is used to separate Ac/Ds 3 ' the distolateral wing sequence is the base sequence shown in SEQ ID NO:8～SEQ ID NO:14.
A kind of method of separating Ac/Ds transposon flanking sequence adopts above-mentioned Auele Specific Primer, it is characterized in that the concrete steps of this method are:
A. after getting the DNA balanced mix of 10～15 strain plant, carry out digestion with restriction enzyme, obtain enzyme and cut product;
B. cut product for step a gained enzyme, flat in this way end products then behind the flat end fitting of connection, selects terminal Auele Specific Primer of a kind of corresponding Ac and joint primer to carry out first round pcr amplification, obtains amplified production;
C. with the pcr amplification product of step b gained after diluting as template, take turns the terminal Auele Specific Primer of Ac and joint primer with second again and carry out second and take turns pcr amplification, obtain Ac/Ds transposon flanking sequence.
D. cut product for step a gained enzyme, 3 ' protruding terminus product then selects terminal Auele Specific Primer of a kind of corresponding Ac and RSE joint primer to carry out first round pcr amplification in this way, obtains amplified production;
E. with the pcr amplification product of steps d gained after diluting as template, second take turns the terminal Auele Specific Primer of Ac and RSE joint primer and carry out second and take turns pcr amplification again, obtain Ac/Ds transposon flanking sequence.
The enzyme that above-mentioned steps a obtains is cut product for flat terminal, and the joint sequence of its jointing is that 2 annealing obtain with joint by joint 1; The sequence of described joint 1 is the base sequence shown in the SEQ ID NO:19; The sequence of described joint 2 is the base sequence shown in the SEQ ID NO:20; The joint primer of described first round pcr amplification is the base sequence shown in the SEQ ID NO:21.Described second take turns pcr amplification the joint primer be the base sequence shown in the SEQ ID NO:22.
Among the above-mentioned step b; The pcr amplification condition of flat terminal enzyme being cut product is: 94 ° of preparatory sex change of C 3 minutes, 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second; 72 ° of C 1 minute) 20 circulations (94 ° of C 30 seconds; 57 ° of C 20 seconds, 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
Among the above-mentioned step c; The pcr amplification condition of flat terminal enzyme being cut the first round PCR product of product is: 94 ° of preparatory sex change of C 3 minutes, 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second; 72 ° of C 1 minute) 30 circulations (94 ° of C 30 seconds; 57 ° of C 20 seconds, 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
It is that the enzyme of 3 ' overhang is cut product that the enzyme that obtains like above-mentioned step a is cut product, and the joint primer of its first round pcr amplification is the base sequence shown in SEQ ID NO:23, SEQ ID NO:24 or the SEQ ID NO:25; Its second take turns pcr amplification the joint primer be the base sequence shown in the SEQ ID NO:26.
It is that the enzyme of 3 ' overhang is cut product that the enzyme that above-mentioned step a obtains is cut product, and its first round pcr amplification condition is: 94 ° of preparatory sex change of C 3 minutes, 94 ° of C 30 seconds; 45 ° of C 20 seconds, 72 ° of 5 seconds of C, 11 circulations (94 ° of C 30 seconds;-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) 20 circulations (94 ° of C 30 seconds, 62 ° of C 20 seconds; 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
It is that the enzyme of 3 ' overhang is cut product that the enzyme that above-mentioned step a obtains is cut product; Its first round pcr amplification condition is: 94 ° of preparatory sex change of C 3 minutes, 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second; 72 ° of C 1 minute) 25 circulations (94 ° of C 30 seconds; 60 ° of C 20 seconds, 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
A kind of being used to identified the Auele Specific Primer of distinguishing Ac and Ds flanking sequence, it is characterized in that this primer is: the base sequence shown in SEQ ID NO:15～SEQ ID NO:18.
A kind of method of distinguishing Ac and Ds flanking sequence of identifying adopts above-mentioned Auele Specific Primer, it is characterized in that the concrete steps of this method are:
A. for the swivel base incident that comes from apt1-m1::Ac and bz-m2 (DI) system, we can use primer SEQ ID NO:17 and SEQ ID NO:15 and the primer amplification that cooperates corresponding flanking sequence.Judge according to the big I of product whether flanking sequence is the flanking sequence of Ac.Promptly obtain the segment of 2670bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac.Obtain the segment of 1361bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ds
B. for the swivel base incident that comes from su1::Ac and r1::m3 system; We need use primer SEQ ID NO:15～SEQ ID NO:18 to cooperate the primer amplification of corresponding flanking sequence, judge according to the big I of product whether flanking sequence is the flanking sequence of Ac.Promptly obtain the segment of 2670bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac; Obtain the segment of 3777bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:18; And SEQ ID NO:16 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 813bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac; Obtain the segment of 1257bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:18; And SEQ ID NO:16 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 813bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ds
Above-mentioned step a, among the b, the pcr amplification condition is: 94 ° of preparatory sex change of C 3 minutes, 30 circulations (94 ° of C 30 seconds, 57 ° of C 20 seconds, 72 ° of C 4 minutes) were excessively extended 72 ° of C 8 minutes.
The Ac5 ' of indication and Ac3 ' end are to be that the direction of the Ac sequence among the GU595147 is specified according to the sequence number among the Genebank in this programme, with the coding staff of Ac transposase to consistent.
The present invention compared with prior art have following outstanding substantive distinguishing features and a marked improvement: the present invention utilizes the terminal Auele Specific Primers of these Ac can fine amplification to obtain Ac or the flanking sequence of Ds in the genome.This detection method is simple to operate, is the large-scale important techniques means that obtain Ac flanking sequence with the gene that separates Ac insertion two mutants of Ac two mutants.
Description of drawings
Fig. 1 is the amplification of Ac flanking sequence among the Shu00071.Genomic dna is jointing after the EcoRV enzyme is cut.Sample for each group swimming lane 1-5 is Shu00071-1 in proper order, Shu00071-2, and W22 reports system,
AcDonor and blank.Shu00071-1 and two parts of Shu00071-2 independently contain the sample of identical known Ac transposon flanking sequence.A utilizes 3 ' terminal flanking sequence among the genomewalking method amplification Shu00071.Primer
Ac4131 are used as the terminal Auele Specific Primer of first round Ac.For 1,2,3,4,5 and 6 groups of primers
Ac4217,
Ac4411,
Ac4442,
Ac4490,
Ac4528 draws
Ac4547 are used as second respectively takes turns the terminal Auele Specific Primer of Ac.White arrow is illustrated in Shu00071-1 and Shu00071-2 increased band and this band that in the parent, do not increase of expection size.B utilizes 5 ' terminal flanking sequence among the genomewalking method amplification Shu00071.Primer
Ac317 are used as the terminal Auele Specific Primer of first round Ac.For 1,2,3,4,5 and 6 groups of primers
Ac281,
Ac215,
Ac169,
Ac86,
Ac53 draws
Ac22 are used as second respectively takes turns the terminal Auele Specific Primer of Ac.White arrow is illustrated in Shu00071-1 and Shu00071-2 increased band and this band that in the parent, do not increase of expection size.
Fig. 2 identifies swivel base Ac/Ds for utilizing the genomewalking method of modifying.From two parts of each swivel base system of apt1-m1::Ac transposon system independently sample cut through the EcoRV enzyme.Among the swimming lane 1-20, are two duplicate samples of swivel base system like swimming lane 1 and 2, swimming lane 3 and 4 is independently samples of another swivel base be two parts, and the like.Swimming lane 21 is 925H report system, and swimming lane 22 is an Ac donor 929.20, and swimming lane 23 is a blank.It is to take turns the terminal Auele Specific Primer of Ac the first round and second that primer Ac317 and Ac169 are used as respectively.The specific band that white arrow indicates the candidate has only appeared in two parts of independent sample of a certain swivel base system.
Fig. 3 is the affirmation of flanking sequence in apt1-152 and the apt1-323 swivel base system.The distolateral wing sequence specific primers of swimming lane 1-5:Ac5 ' respectively with the amplified production of Ac terminal (A and C) or inner (B and the D) Auele Specific Primer of Ac.The distolateral wing sequence specific primers of swimming lane 6-10:Ac3 ' respectively with the amplified production of Ac terminal (A and C) or inner (B and the D) Auele Specific Primer of Ac.Swimming lane 1 and 2 (swimming lane 5 and 6) is two parts of independent sample of a swivel base system, and swimming lane 3 and 8 is 925H, and swimming lane 4 and 9 is 929.20, and swimming lane 5 and 10 is a blank.A and B: swivel base is the evaluation of flanking sequence among the apt1-152.Combine the Auele Specific Primer of the corresponding flanking sequence big or small band of expection that all increased respectively with terminal Auele Specific Primer (A) of Ac and the inner Auele Specific Primer of Ac (B), being illustrated in the transposon that identifies among the apt1-152 is the Ac transposon.C and D: swivel base is the evaluation of flanking sequence among the apt1-323.Combine the Auele Specific Primer of the corresponding flanking sequence big or small band of expection that all increased respectively with terminal Auele Specific Primer (C) of Ac and the inner Auele Specific Primer of Ac3 ' ( swimming lane 6 and 7 among the D); Use the inner Auele Specific Primer of Ac5 ' and 5 ' the distolateral wing sequence specific primers increased a 1395bp band than the expection 2704bp little 1309bp, being illustrated in the transposon that identifies among the apt1-323 is the Ds transposon.
Fig. 4 is that the swivel base that comes from the su1::Ac transposon system is the affirmation of flanking sequence among the Ac178.Sample is Ac178-1 in proper order in every group, Ac178-2, and W22 reports system, su1::Ac and blank.The product (shown in the white arrow) of expection size has been arrived in the amplification of the terminal Auele Specific Primer of A:Ac5 ' and 5 ' the distolateral wing sequence specific primers.The product (shown in the white arrow) of expection size has been arrived in the amplification of the terminal Auele Specific Primer of B:Ac3 ' and 3 ' the distolateral wing sequence specific primers.The product (shown in the white arrow) of expection size has been arrived in the amplification of the C:Ac2655f and 5 ' the distolateral wing sequence specific primers.The product of expection size has been arrived in the amplification of the D:Ac2670r and 3 ' the distolateral wing sequence specific primers.It is Ac transposon (shown in the white arrow) that above-mentioned 4 results are illustrated in the transposon that identifies among the Ac178.
Fig. 5 is that the swivel base that comes from the su1::Ac transposon system is the affirmation of flanking sequence among the Ac83.Sample is Ac83-1 in proper order in every group, Ac83-2, and W22 reports system, su1::Ac and blank.The product (shown in the white arrow) of expection size has been arrived in the amplification of the terminal Auele Specific Primer of A:Ac5 ' and 5 ' the distolateral wing sequence specific primers.The product (shown in the white arrow) of expection size has been arrived in the amplification of the terminal Auele Specific Primer of B:Ac3 ' and 3 ' the distolateral wing sequence specific primers.The product of the expection 2019bp size that do not increase of the C:Ac2655f and 5 ' the distolateral wing sequence specific primers.The product of the expection 2915bp size that do not increase of the D:Ac2670r and 3 ' the distolateral wing sequence specific primers.The amplification of the E:Ac3753f and 3 ' the distolateral wing sequence specific primers is to the product of expection 921bp size.The product of the 4031bp size of the not amplification expection of the F:Ac3777r and 5 ' the distolateral wing sequence specific primers, but the band of the 1510bp size that increased.It is the Ds transposon that above-mentioned 6 results are illustrated in the transposon that identifies among the Ac83.
Embodiment
Below in conjunction with the practical implementation example, further set forth the present invention.Should be understood that these instances only to be used to the present invention is described and be not used in the restriction scope of the present invention.Primer related in the following instance is applicable to separating and evaluation of any Ac and Ds flanking sequence with method.The experimental technique of unreceipted concrete experiment condition in the following example; Usually according to normal condition, like molecular cloning (Molecular Cloning:A Laboratory Manual, 3rd ed.) or molecular biology of plants-laboratory manual (Plant Molecular Biology-A Laboratory Manual; Melody S. Clark compiles; Springer-verlag Berlin Heidelberg, 1997) condition described in, or the condition of advising according to manufacturer.
Embodiment one: the acquisition and the application of the terminal Auele Specific Primer of Ac
The present invention to be being the note among the GU595147 according to sequence number among the Genebank, the sequence of the Ac transposon that intercepting goes out wherein to be comprised, design primer.Can be used for having with the terminal primer of Ac of joint combination of primers amplification Ac/Ds 5 ' terminal flanking sequence:
| The primer title | Sequence |
| Ac22r | TTTTCCCATCCTACTTTCATCC |
| Ac53r | CGGTTATACGATAACGGTCGGT |
| Ac86r | GTTCGAAATCGATCGGGA |
| Ac169r | TCGGGAAACTAGCTCTACCG |
| Ac215r | ACGAAACGGGATCATCCC |
| Ac281r | TCAGTGGTTATGGATGGGAGT |
| Ac317r | CAGCGTTCGCTAGGTATTTCTTA |
Can be used for having with the terminal primer of Ac of joint combination of primers amplification Ac/Ds 3 ' terminal flanking sequence:
| The primer title | Sequence |
| Ac4131f | CCAGATGTGAGCAAGTGATTATG |
| Ac4217f | TAGCCAAGAGCCCAAGACTTATCAC |
| Ac4411f | ACCCGACCGGATCGTATCGG |
| Ac4442f | CGTATTTATCCCGTTCGTT |
| Ac4490f | CCGTCCCGCAAGTTAAATATG |
| Ac4528f | GGTATTTTACCGACCGTTACC |
| Ac4547f | CCGACCGTTTTCATCCCT |
In order to obtain the flanking sequence of heritable Ac/Ds, get two parts of independently DNA samples for a swivel base system, every duplicate samples is that the DNA balanced mix of 10-15 strain plant forms.Utilize restriction enzyme (like EcoRV, PvuII, PstI, KpnI etc.) enzyme to cut 500ng DNA sample in the 15ul system.
For the sample of the flat end that obtains (like EcoRV; PvuII etc.); Getting the 50ng enzyme cuts product connects the genomewalking kit of Clontech company in the 10ul system flat end fitting (2 annealing obtains with joint by joint 1; FS final spice concentration is 50uM), get the template of the connection product of 10 times of 1ul dilutions as follow-up pcr amplification; (like PstI, the enzyme of KpnI) getting 10 times of 1ul dilutions is cut the template (Ji and Braam, 2010) of product as follow-up pcr amplification for the sample that produces 3 ' overhang.For the sample of different restriction enzyme treatment, adopt the terminal Auele Specific Primer of corresponding first round joint primer and first round Ac to increase.For Ac5 ' end, the terminal Auele Specific Primer of Ac that generally increases as the first round with Ac317r or Ac281r, for Ac3 ' end, the terminal Auele Specific Primer of Ac that generally increases as the first round with Ac4131f or Ac4217f.After 100 times of first round PCR product dilutions, get 1ul as second take turns PCR primer.For Ac5 ' end; Choose than Ac317r or Ac281r more near the terminal primer of Ac as second take turns amplification the terminal Auele Specific Primer of Ac; For Ac3 ' end, choose than Ac4131f or Ac4217f more near the terminal primer of Ac as second take turns amplification the terminal Auele Specific Primer of Ac.Sepharose with 3% detects second and takes turns the PCR product.
Be used for flat terminal enzyme and cut joint sequence and the joint primer (drawing specification sheets) that product adds joint from the genomewalking of Clontech company kit
| The sequence title | | Purposes |
| Joint | ||
| 1 | GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT | The preparation |
| Joint | ||
| 2 | 5’-PO 4-ACCAGCCC-NH 2-3’ | The preparation joint |
| Joint primer 1 (AP1) | GTAATACGACTCACTATAGGGC | First round joint primer |
| Joint primer 2 (AP2) | ACTATAGGGCACGCGTGGT | Second takes turns the joint primer |
3 ' the protruding terminus enzyme that is used to increase cut product the joint primer (drawing) of Ac/Ds flanking sequence from Ji and Braam, 2010
| Joint primer title | Sequence | The primer purposes |
| AdKpnI | GTAATACGACTCACTATAGGGCGTACC | First round joint primer |
| AdPstI | GTAATACGACTCACTATAGGGCTGCAG | First round joint primer |
| AdSacI | GTAATACGACTCACTATAGGGCAGCTC | First round joint primer |
| AP | GTAATACGACTCACTATAGGGC | Second takes turns the joint primer |
Ji?Jiabing,?Braam?Janet?(2010)?Restriction?site?extension?PCR:?A?novel?method?for?high-throughput?characterization?of?tagged?DNA?fragments?and?genome?walking.?PLoS?one.?5:?e10577.
What cut generation for enzyme is that the pcr amplification condition of flat terminal dna fragmentation is:
First round PCR reaction conditions:
94 ° of preparatory sex change of C 3 minutes, 20 circulations of 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) (94 ° of C 30 seconds, 57 ° of C 20 seconds, 72 ° of C 1 minute) were excessively extended 72 ° of C 8 minutes.
Second takes turns the PCR reaction conditions:
94 ° of preparatory sex change of C 3 minutes, 30 circulations of 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) (94 ° of C 30 seconds, 57 ° of C 20 seconds, 72 ° of C 1 minute) were excessively extended 72 ° of C 8 minutes.
What cut generation for enzyme is that the pcr amplification condition of the dna fragmentation of 3 ' overhang is:
First round PCR reaction conditions:
94 ° of preparatory sex change of C 3 minutes, 94 ° of C 30 seconds, 45 ° of C 20 seconds, 72 ° of 5 seconds of C; 20 circulations of 11 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) (94 ° of C 30 seconds; 62 ° of C 20 seconds, 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
Second takes turns the PCR reaction conditions:
94 ° of preparatory sex change of C 3 minutes, 25 circulations of 13 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) (94 ° of C 30 seconds, 60 ° of C 20 seconds, 72 ° of C 1 minute) were excessively extended 72 ° of C 8 minutes.
Handle corn gene group DNA with reference to the method among the RSE-PCR of the genomewalking kit of Clontech company and Ji and Braam.Utilize nested PCR method amplification with the joint primer with the terminal Auele Specific Primer of Ac, can obtain the specific band of certain Ac/Ds swivel base system, reclaim this specific band, be built into T carrier and order-checking.Utilize the sequences Design primer that obtains, and combine with corresponding swivel base system and Ac donor with the terminal Auele Specific Primer of corresponding Ac to be that template increases with report system, the Ac/Ds flanking sequence is confirmed.
For the band that only in two parts of independent sample that a certain swivel base is, occurs; And the band of disappearance is used as the specific band that this swivel base is in Ac donor and report are; Comprised in this band candidate's Ac/Ds in this swivel base system flanking sequence (Fig. 1, Fig. 2).Through checking order behind gel recovery and the TA clone.Utilize the sequences Design primer that obtains; And combines with the terminal Auele Specific Primer of corresponding Ac with corresponding swivel base system and Ac donor with report that being is that template increases; If the band of the expection size that can only in swivel base system, can increase can confirm that so the sequence that obtains is the flanking sequence (Fig. 3) of a certain side of Ac/Ds.In order further to confirm the integrity of Ac/Ds; According to the comparison result of flanking sequence in corn B73 genome sequence, confirm the insertion site of Ac/Ds, then according to the sequences Design primer of the opposite side of Ac/Ds; And the terminal primer amplified of the Ac that combines correspondence; If the band of the expection size that only in swivel base system, increased has then confirmed to have identified the Ac/Ds that swivel base system is contained, clear and definite its on position (Fig. 3).
Embodiment two: the primer of distinguishing Ac or Ds flanking sequence obtains and method
Be used as the reporter gene of apt1-m1::Ac and two Ac donors of su1::Ac among the present invention respectively with bz-m2 (DI) and two Ds elements of r1::m3.Two Ds elements of bz-m2 (DI) and r1::m3 all are the products of Ac internal sequence disappearance.The full length sequence of Ac is 4565bp; Ds element among the bz-m2 (DI) has lacked a section of the common 1310bp from the 1265th bp to 2575 bp of Ac element, and the Ds element among the r1::m3 has lacked a section of the common 2521bp from the 1051st bp to 3571 bp of Ac element.
The present invention is being the note among the GU595147 according to sequence number among the Genebank; The sequence of the Ac transposon that intercepting goes out wherein to be comprised; And, designed the inner Auele Specific Primer of Ac of the primer that is used to distinguish Ac or Ds flanking sequence according to bz-m2 (DI) and two Ds elements of r1::m3 situation with respect to the sequence deletion of complete Ac element.
Be used to identify that the flanking sequence of acquisition is the inner Auele Specific Primer of the Ac flanking sequence or the Ac of Ds flanking sequence
| The primer title | Sequence | The length (bp) that distance A c3 ' is terminal |
| Ac2655f | CTAAAGCCGAGGAGTGGAAGA | 1911 |
| Ac3753f | CATGGCTGGCATTAACAGA | 813 |
| The primer title | Sequence | The length (bp) that distance A c5 ' is terminal |
| Ac2670r | CACTCCTCGGCTTTAGGACA | 2670 |
| Ac3777r | CAAAAATCTGTTAATGCCAGC | 3777 |
For the swivel base incident that comes from apt1-m1::Ac and bz-m2 (DI) system, we can use primer Ac2670r and Ac2655f to cooperate the primer amplification of corresponding flanking sequence.According to the big I of product judge flanking sequence whether be Ac flanking sequence (table 1, Fig. 3).
Table 1, apt1-m1::Ac transposon system are used to distinguish Ac or Ds flanking sequence primer and expection product
| ? | Ac2655f+3 ' flanking sequence Auele Specific Primer | Ac2670r+5 ' flanking sequence Auele Specific Primer |
| The Ac flanking sequence | 1911 bp+3 ' flanking sequence length | 2670 bp+5 ' flanking sequence length |
| The Ds flanking sequence | 1911 bp+3 ' flanking sequence length | 1361 bp+5 ' flanking sequence length |
For the swivel base incident that comes from su1::Ac and r1::m3 system, we can need use Ac2670r and Ac2655f with primer, and Ac3753f and Ac3777r cooperate the primer amplification of corresponding flanking sequence.According to the big I of product judge flanking sequence whether be Ac flanking sequence (table 2, Fig. 4, Fig. 5).
Table 1, su1::Ac transposon system are used to distinguish Ac or Ds flanking sequence primer and expection product
| ? | Ac3753f+3 ' flanking sequence Auele Specific Primer | Ac3777r+5 ' flanking sequence Auele Specific Primer |
| The Ac flanking sequence | 813 bp+3 ' flanking sequence length | 3777 bp+5 ' flanking sequence length |
| The Ds flanking sequence | 813 bp+3 ' flanking sequence length | 1257 bp+5 ' flanking sequence length |
| ? | Ac2655f+3 ' flanking sequence Auele Specific Primer | Ac2670r+5 ' flanking sequence Auele Specific Primer |
| The Ac flanking sequence | 1911 bp+3 ' flanking sequence length | 2670 bp+5 ' flanking sequence length |
The present invention has utilized two different Ac/Ds transposon systems to create new swivel base incident, and wherein two Ds elements of bz-m2 (DI) and r1::m3 are used separately as the reporter gene of apt1-m1::Ac and two Ac donors of su1::Ac.Two Ds elements of bz-m2 (DI) and r1::m3 all are the products of Ac internal sequence disappearance.If therefore expect that certain flanking sequence is the flanking sequence of Ac; Combine will the increase product of accord with expectation size of the Auele Specific Primer of flanking sequence with the inner specific primer of Ac; Can prove that so this sequence is the flanking sequence of Ac really; And if amplified production is littler than what expect, and meets the size of Ds with respect to the disappearance of Ac, can prove that so this sequence is the flanking sequence of Ds.
Sequence table
< 110>Shanghai University
< 120>be used to separate and identify the Auele Specific Primer and the application thereof of the Ac factor of Ac/Ds transposon flanking sequence
<160> 18
<210> 1
<211> 22
<212> DNA
< 213>artificial sequence
<400> 1
<210> 2
<211> 22
<212> DNA
< 213>artificial sequence
<400> 2
<210> 3
<211> 18
<212> DNA
< 213>artificial sequence
<400> 3
<210> 4
<211> 20
<212> DNA
< 213>artificial sequence
<400> 4
<210> 5
<211> 18
<212> DNA
< 213>artificial sequence
<400> 5
<210> 6
<211> 21
<212> DNA
< 213>artificial sequence
<400> 6
<210>?7
<211> 23
<212> DNA
< 213>artificial sequence
<400> 7
<210> 8
<211> 23
<212> DNA
< 213>artificial sequence
<400> 8
<210> 9
<211> 25
<212> DNA
< 213>artificial sequence
<400> 9
TAGCCAAGAGCCCAAGACTTATCAC 25
<210> 10
<211> 20
<212> DNA
< 213>artificial sequence
<400> 10
<210> 11
<211> 19
<212> DNA
< 213>artificial sequence
<400> 11
<210> 12
<211> 21
<212> DNA
< 213>artificial sequence
<400> 12
<210> 13
<211> 21
<212> DNA
< 213>artificial sequence
<400> 13
<210> 14
<211> 18
<212> DNA
< 213>artificial sequence
<400> 14
<210> 15
<211> 21
<212> DNA
< 213>artificial sequence
<400> 15
<210> 16
<211> 22
<212> DNA
< 213>artificial sequence
<400> 16
<210> 17
<211> 20
<212> DNA
< 213>artificial sequence
<400> 17
<210> 18
<211> 21
<212> DNA
< 213>artificial sequence
<400> 18
<210> 19
<211> 48
<212> DNA
< 213>artificial sequence
<400> 19
GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT 48
<210> 20
<211> 8
<212> DNA
< 213>artificial sequence
<400> 20
5’-PO
4-ACCAGCCC-NH
2-3’ 8
<210> 21
<211> 22
<212> DNA
< 213>artificial sequence
<400> 21
<210> 22
<211> 19
<212> DNA
< 213>artificial sequence
<400> 22
<210> 23
<211> 27
<212> DNA
< 213>artificial sequence
<400> 23
GTAATACGACTCACTATAGGGCGTACC 27
<210> 24
<211> 27
<212> DNA
< 213>artificial sequence
<400> 24
GTAATACGACTCACTATAGGGCTGCAG 27
<210> 25
<211> 27
<212> DNA
< 213>artificial sequence
<400> 25
GTAATACGACTCACTATAGGGCAGCTC 27
<210> 26
<211> 22
<212> DNA
< 213>artificial sequence
<400> 26
Claims (10)
1. Auele Specific Primer that is used to separate Ac/Ds transposon flanking sequence is characterized in that this primer is:
A. the terminal Auele Specific Primer of Ac that is used to separate Ac/Ds 5 ' the distolateral wing sequence is the base sequence shown in SEQ ID NO:1～SEQ ID NO:7;
B. the terminal Auele Specific Primer of Ac that is used to separate Ac/Ds 3 ' the distolateral wing sequence is the base sequence shown in SEQ ID NO:8～SEQ ID NO:14.
2. a method of separating Ac/Ds transposon flanking sequence adopts Auele Specific Primer according to claim 1, it is characterized in that the concrete steps of this method are:
A. after getting the DNA balanced mix of 10～15 strain plant, carry out digestion with restriction enzyme, obtain enzyme and cut product;
B. cut product for step a gained enzyme, flat in this way end products then behind the flat end fitting of connection, selects a kind of corresponding special primers and joint primer to carry out first round pcr amplification, obtains amplified production;
C. with the pcr amplification product of step b gained after diluting as template, take turns Auele Specific Primer and joint primer with second again and carry out second and take turns pcr amplification, obtain Ac/Ds transposon flanking sequence;
D. cut product for step a gained enzyme, 3 ' protruding terminus product then selects a kind of corresponding special primers and RSE joint primer to carry out first round pcr amplification in this way, obtains amplified production;
E. with the pcr amplification product of steps d gained after diluting as template, second take turns Auele Specific Primer and RSE joint primer and carry out second and take turns pcr amplification again, obtain Ac/Ds transposon flanking sequence.
3. method according to claim 2 is characterized in that enzyme that step a obtains cuts product for flat terminal, and the joint sequence of its jointing be by joint 1 and joint 2 annealing acquisitions; The sequence of described joint 1 is the base sequence shown in the SEQ ID NO:19; The sequence of described joint 2 is the base sequence shown in the SEQ ID NO:20; The joint primer of described first round pcr amplification is the base sequence shown in the SEQ ID NO:21;
Described second take turns pcr amplification the joint primer be the base sequence shown in the SEQ ID NO:22.
4. method according to claim 2 is characterized in that among the described step b, and the pcr amplification condition of flat terminal enzyme being cut product is: 94 ° of preparatory sex change of C 3 minutes; 13 circulations (94 ° of C 30 seconds;-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) 20 circulations (94 ° of C 30 seconds, 57 ° of C 20 seconds; 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
5. method according to claim 2 is characterized in that among the described step c, to the pcr amplification condition of first round amplified production is: 94 ° of preparatory sex change of C 3 minutes; 13 circulations (94 ° of C 30 seconds;-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) 30 circulations (94 ° of C 30 seconds, 57 ° of C 20 seconds; 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
6. method according to claim 2; It is characterized in that it is that the enzyme of 3 ' overhang is cut product that enzyme that described step a obtains is cut product, the joint primer of its first round pcr amplification is the base sequence shown in SEQ ID NO:23, SEQ ID NO:24 or the SEQ ID NO:25; Its second take turns pcr amplification the joint primer be the base sequence shown in the SEQ ID NO:26.
7. method according to claim 2 is characterized in that it is that the enzyme of 3 ' overhang is cut product that enzyme that described step a obtains is cut product, and its first round pcr amplification condition is: 94 ° of preparatory sex change of C 3 minutes; 94 ° of C 30 seconds, 45 ° of C 20 seconds, 72 ° of 5 seconds of C; 20 circulations of 11 circulations (94 ° of C 30 seconds ,-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) (94 ° of C 30 seconds; 62 ° of C 20 seconds, 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
8. method according to claim 2 is characterized in that it is that the enzyme of 3 ' overhang is cut product that enzyme that described step a obtains is cut product, and it second is taken turns the pcr amplification condition and be: 94 ° of preparatory sex change of C 3 minutes; 13 circulations (94 ° of C 30 seconds;-1 ° of C/ of 72 ° of C 20 seconds second, 72 ° of C 1 minute) 25 circulations (94 ° of C 30 seconds, 60 ° of C 20 seconds; 72 ° of C 1 minute), excessively extended 72 ° of C 8 minutes.
9. one kind is used to identify the Auele Specific Primer of distinguishing Ac and Ds flanking sequence, it is characterized in that this primer is: the base sequence shown in SEQ ID NO:15～SEQ ID NO:18.
10. identify the method for distinguishing Ac and Ds flanking sequence for one kind, adopt above-mentioned Auele Specific Primer, it is characterized in that the concrete steps of this method are:
A. for the swivel base incident that comes from apt1-m1::Ac and bz-m2 (DI) system, we can use primer SEQ ID NO:17 and SEQ ID NO:15 and the primer amplification that cooperates corresponding flanking sequence;
Judge according to the big I of product whether flanking sequence is the flanking sequence of Ac;
Promptly obtain the segment of 2670bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac;
Obtain the segment of 1361bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ds;
B. for the swivel base incident that comes from su1::Ac and r1::m3 system; We need use primer SEQ ID NO:15～SEQ ID NO:18 to cooperate the primer amplification of corresponding flanking sequence, judge according to the big I of product whether flanking sequence is the flanking sequence of Ac;
Promptly obtain the segment of 2670bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:17; And SEQ ID NO:15 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 1911bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac; Obtain the segment of 3777bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:18; And SEQ ID NO:16 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 813bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ac; Obtain the segment of 1257bp+5 ' flanking sequence length as increasing with 5 ' corresponding flanking sequence Auele Specific Primer with SEQ ID NO:18; And SEQ ID NO:16 increases with 3 ' corresponding flanking sequence Auele Specific Primer and obtains the segment of 813bp+3 ' flanking sequence length, explains that then this flanking sequence is the flanking sequence of Ds;
Above-mentioned step a, among the b, the pcr amplification condition is: 94 ° of preparatory sex change of C 3 minutes, 30 circulations (94 ° of C 30 seconds, 57 ° of C 20 seconds, 72 ° of C 4 minutes) were excessively extended 72 ° of C 8 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101629806A CN102649959A (en) | 2012-05-24 | 2012-05-24 | Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101629806A CN102649959A (en) | 2012-05-24 | 2012-05-24 | Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102649959A true CN102649959A (en) | 2012-08-29 |
Family
ID=46692086
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101629806A Pending CN102649959A (en) | 2012-05-24 | 2012-05-24 | Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102649959A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757013A (en) * | 2014-01-08 | 2014-04-30 | 上海大学 | Specific sub sequence for separating Ac/Ds flanking sequence and separation method thereof |
| CN103757014A (en) * | 2014-01-08 | 2014-04-30 | 上海大学 | Specific primers for enriching AC/Ds flanking sequences and enrichment method thereof |
| CN112210620A (en) * | 2020-10-22 | 2021-01-12 | 中国农业科学院作物科学研究所 | AcDs whole genome site efficient detection primer and method based on NGS sequencing |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999053083A1 (en) * | 1998-04-16 | 1999-10-21 | Cold Spring Harbor Laboratory | Seed specific polycomb group gene and methods of use for same |
| WO2001055299A2 (en) * | 2000-01-27 | 2001-08-02 | Yeda Research And Development Co. Ltd. | Isolated polynucleotide encoding a novel phosphate transporter in plants and a method of modulating phosphate uptake in plants |
| WO2001059121A1 (en) * | 2000-02-11 | 2001-08-16 | Institute Of Molecular Agrobiology | Dehiscence gene and methods for regulating dehiscence |
| AU2002235918A1 (en) * | 2001-02-27 | 2003-03-06 | Icon Genetics Gmbh | Recombinant viral switches for the control of gene expression in plants |
| US6984774B1 (en) * | 1997-12-10 | 2006-01-10 | Iowa State University Research Foundation, Inc. | Method and materials to induce recombination in plants |
| CN1816624A (en) * | 2003-07-04 | 2006-08-09 | 独立行政法人科学技术振兴机构 | Rice transposon gene |
| WO2006124001A1 (en) * | 2005-05-17 | 2006-11-23 | Temasek Life Sciences Laboratory Limited | Transposition of maize ac/ds elements in vertebrates |
| WO2007103382A2 (en) * | 2006-03-07 | 2007-09-13 | J.R. Simplot Company | Plant-specific genetic elements and transfer cassettes for plant transformation |
| US7498481B2 (en) * | 2001-06-11 | 2009-03-03 | Biogemma | Method for obtaining a monocotyledon plant containing a gene of interest free of foreign ancillary sequence |
| CN101760462A (en) * | 2008-12-19 | 2010-06-30 | 李祥 | Clone of plant disease resistance genes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10109354A1 (en) * | 2001-02-27 | 2002-09-05 | Icon Genetics Ag | Recombinant viral switch systems |
-
2012
- 2012-05-24 CN CN2012101629806A patent/CN102649959A/en active Pending
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6984774B1 (en) * | 1997-12-10 | 2006-01-10 | Iowa State University Research Foundation, Inc. | Method and materials to induce recombination in plants |
| WO1999053083A1 (en) * | 1998-04-16 | 1999-10-21 | Cold Spring Harbor Laboratory | Seed specific polycomb group gene and methods of use for same |
| WO2001055299A2 (en) * | 2000-01-27 | 2001-08-02 | Yeda Research And Development Co. Ltd. | Isolated polynucleotide encoding a novel phosphate transporter in plants and a method of modulating phosphate uptake in plants |
| WO2001059121A1 (en) * | 2000-02-11 | 2001-08-16 | Institute Of Molecular Agrobiology | Dehiscence gene and methods for regulating dehiscence |
| AU2002235918A1 (en) * | 2001-02-27 | 2003-03-06 | Icon Genetics Gmbh | Recombinant viral switches for the control of gene expression in plants |
| US7498481B2 (en) * | 2001-06-11 | 2009-03-03 | Biogemma | Method for obtaining a monocotyledon plant containing a gene of interest free of foreign ancillary sequence |
| CN1816624A (en) * | 2003-07-04 | 2006-08-09 | 独立行政法人科学技术振兴机构 | Rice transposon gene |
| WO2006124001A1 (en) * | 2005-05-17 | 2006-11-23 | Temasek Life Sciences Laboratory Limited | Transposition of maize ac/ds elements in vertebrates |
| WO2007103382A2 (en) * | 2006-03-07 | 2007-09-13 | J.R. Simplot Company | Plant-specific genetic elements and transfer cassettes for plant transformation |
| CN101760462A (en) * | 2008-12-19 | 2010-06-30 | 李祥 | Clone of plant disease resistance genes |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757013A (en) * | 2014-01-08 | 2014-04-30 | 上海大学 | Specific sub sequence for separating Ac/Ds flanking sequence and separation method thereof |
| CN103757014A (en) * | 2014-01-08 | 2014-04-30 | 上海大学 | Specific primers for enriching AC/Ds flanking sequences and enrichment method thereof |
| CN103757014B (en) * | 2014-01-08 | 2016-05-25 | 上海大学 | Auele Specific Primer and enrichment method thereof for enrichment Ac/Ds flanking sequence |
| CN112210620A (en) * | 2020-10-22 | 2021-01-12 | 中国农业科学院作物科学研究所 | AcDs whole genome site efficient detection primer and method based on NGS sequencing |
| CN112210620B (en) * | 2020-10-22 | 2022-06-07 | 中国农业科学院作物科学研究所 | AcDs whole genome site efficient detection primer and method based on NGS sequencing |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108018316A (en) | A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish | |
| US11898270B2 (en) | Pig genome-wide specific sgRNA library, preparation method therefor and application thereof | |
| CN102634506B (en) | Method for applying adhesive tail end joints to flanking sequence separation | |
| Gao et al. | A highly conserved, small LTR retrotransposon that preferentially targets genes in grass genomes | |
| CN108048486A (en) | A kind of method of gene knockout selection and breeding fhl1b Gene Deletion zebra fish | |
| CN103119162A (en) | Method for producing circular DNA formed from single-molecule DNA | |
| CN103757014A (en) | Specific primers for enriching AC/Ds flanking sequences and enrichment method thereof | |
| CN102649959A (en) | Specific primer used for separating and identifying activator/dissociator (Ac/Ds) transposons flanking sequences | |
| CN103276068B (en) | Marking primer and method for identifying channa argus and channa maculate as well as F1-generation channa argus*channa maculate and channa maculate*channa argus hybridized by channa argus and channa maculate | |
| CN106498088A (en) | Based on CAPs molecular markers and its application that SNP site identifies rough fruit Herba Amaranthi tricoloriss | |
| CN101935670A (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| CN104531675A (en) | Method for in-vitro synthesis and activity detection on gRNA | |
| CN110684736A (en) | Chicken Shp-2 gene knockout cell line based on CRISPR-Cas9 editing technology and construction method thereof | |
| CN111996261B (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN104099423B (en) | For the molecular labeling of cutter long-tailed anchovy different ecological type population identification | |
| CN101020905A (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Rf1 and its application | |
| CN103757013A (en) | Specific sub sequence for separating Ac/Ds flanking sequence and separation method thereof | |
| CN110714053B (en) | Preparation method of 100bp DNA molecular weight standard substance, primer group and application thereof | |
| CN101760538A (en) | Plant chromosome micro-dissection and micro-cloning technology | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN101974786B (en) | Method for constructing eukaryote cDNA library and special primers thereof | |
| CN112143830A (en) | Molecular marker of rice sword leaf width regulation gene NAL1 and application thereof | |
| CN104975108A (en) | Specific molecular marker primer for Psathyrostachys huashanica Ns genome and application method thereof | |
| CN116286904B (en) | Bovine-derived CRISPR/boCas13a gene editing system, method and application | |
| CN101921746A (en) | Template p111 for preparing 100bp DNA ladder based on PCR technology, and preparation system thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120829 |