CN102643757B - 6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof - Google Patents
6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof Download PDFInfo
- Publication number
- CN102643757B CN102643757B CN 201110451447 CN201110451447A CN102643757B CN 102643757 B CN102643757 B CN 102643757B CN 201110451447 CN201110451447 CN 201110451447 CN 201110451447 A CN201110451447 A CN 201110451447A CN 102643757 B CN102643757 B CN 102643757B
- Authority
- CN
- China
- Prior art keywords
- butyl ester
- cyano group
- carbonyl
- hecanoic acid
- pichia guilliermondii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides a Pichia guilliermondii X25 which is enriched and screened from soil, has high diastereoselectivity and is a carbonyl reductase active microbial new strain, and application of the Pichia guilliermondii X25 in preparation of 6-cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester by biological asymmetric reduction (R)-6-cyano-5-hydroxyl-3-carbonyl hexanoic acid tert-butylester. The strain is preserved in China Center for Type Culture Collection (CCTCC), the address is Wuhan university, Wuhan, China, the post code is 430072, the CCTCC No. is M 2011386, and the preservation date is November11th,2011. The optical pure 6-cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by using carbonyl reductase generated by the Pichia guilliermondii X25 to convert (R)-6-cyano-5-hydroxyl-3-carbonyl hexanoic acid tert-butyl ester is high in stereoselectivity, mild in reaction condition and environment-friendly.
Description
(1) technical field
The present invention relates to the bacterial strain that a strain has R-carbonyl reduction enzymic activity---Pichia guilliermondii bacterium (Pichia guilliermondii) X25, and biological catalysis prepare optical purity 6-cyano group-(3R, 5R)-application in the dihydroxyl hecanoic acid t-butyl ester.
(2) background technology
Chiral drug is significant in the control of numerous disease, and its study on the synthesis is subjected to the great attention of academia, enterprise and government.Have the chiral alcohol synthetic crucial chirality building block of many chiral drugs especially of specific function group, and application is very widely being arranged aspect the fine chemistry industries such as pharmacy, agricultural chemicals, spices.
Cardiovascular disorder becomes one of most threatening disease of the mankind, and its M ﹠ M all surpasses malignant neoplastic and leaps to the first.According to World Health Organization's statistics, the whole world has more than 3,000 ten thousand people to die from cardiovascular and cerebrovascular diseases every year.China is annual to surpass 3,000,000 because of cardiovascular and cerebrovascular diseases and complication death.The active treatment hyperlipidemia is the key of prevention cardiovascular and cerebrovascular diseases, and the blood lipid-lowering medicine exploitation has become emphasis and the focus of global drug research.Statins is present main blood lipid-lowering medicine, it has remarkable restraining effect to the rate-limiting enzyme in the cholesterol biosynthetic process-3-hydroxy-3-methyl coenzyme A (HMG-CoA) reductase enzyme, reduce the cell free cholesterol levels, feedback raises the cell surface low density lipoprotein receptor and expresses, the removing of the residual grain of C-VLDL and low-density lipoprotein in the promotion blood circulation, the level of total cholesterol and low-density lipoprotein effectively prevents the generation of atherosclerosis and coronary heart disease in the final reduction serum.
Global development and in existing more than ten kind of the statins that grinds.He comprises Simvastatin, Pravastatin, lovastatin by the spit of fland medicine first-generation, is the similar fungal metabolite of a class formation.His spit of fland of the s-generation comprises the racemize fluvastatin of chemosynthesis.His spit of fland of the third generation is his spit of fland medicine of the optical purity that synthesizes, as atorvastatin, Rosuvastatin and pitavastatin.Lipid-lowering statins accounts for the 85% above share in lipid lowerers market, the world, and still has room for promotion.
Chirality β, δ-dihydroxyl caproic acid (ester) structure is pharmacophoric group, the chirality building block of synthetic his spit of fland medicine, also is emphasis and the difficult point of synthetic his spit of fland medicine.The final quality of statins depends on the optical purity of the corresponding isomer of chiral side chain, each traditional Chinese medicines prison department require ee value greater than 99.5%, de value greater than 99%.6-cyano group-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester is the synthetic chirality building block of statins, synthesis technique comprises chemical asymmetric synthesis and biological asymmetric synthesis.6-cyano group-(3R, 5R)-there are many defectives in dihydroxyl hecanoic acid t-butyl ester chemical synthesis process, synthetic triethyl-boron and-85 ℃ of deep cooling conditions that need to use severe toxicity, and non-mapping is induced insufficient, product 6-cyano group-(3R, 5R)-and dihydroxyl hecanoic acid t-butyl ester de value is low, and the boride waste treatment that this reaction forms need be through the loaded down with trivial details cancellation of methyl alcohol repeatedly, vacuum distilling etc.Compare with chemical process, biological synthesis process has the following advantages: (1) solid, zone and chemo-selective height, and this mainly is because enzyme is identified the specificity of the strictness of substrate, product; And when using chemical synthesis process, have only when the group on carbonyl both sides is widely different, to obtain higher stereoselectivity; (2) security and Environmental compatibility are good, biocatalysis safety and reaction conditions gentleness, usually with the aqueous solution as reaction system, environmental friendliness.
Have carbonyl reductase (alcoholdehydrogenase) living microorganism and extensively be present in occurring in nature, also meta-rule, product are configured as the S configuration but their asymmetric reduction carbonyl is often followed Prelog; Microorganism with anti--Prelog stereoselectivity carbonyl reduction enzymic activity is very rare at occurring in nature.Up to now, asymmetric reduction (the R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester that has of bibliographical information prepares 6-cyano group-(3R, 5R)-microbial strains of dihydroxyl hecanoic acid t-butyl ester activity has Saccharomyces cerevisiae, Pichia angusta NCYC 495, Pichia angusta NCYC R320, Pichia angusta NCYC R322, Pichia haplophila CBS 2028, Beauveria bassiana, Pichia pastoris, Pichia membranefaciens, Pichia angusta, Candida humicola, Candida solani, Candida diddensiae, Candida friedrichii, Kluyveromyces drosophilarum, Debaromyces hansenii.At present, do not see that Pichia guilliermondii has the report of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester cis-selectivity carbonyl reduction enzymic activity.
(3) summary of the invention
The present invention seeks to overcome existing 6-cyano group-(3R, 5R)-deficiency of dihydroxyl hecanoic acid t-butyl ester production technology, provide a kind of enrichment from soil, screening to have highly-solid selectively carbonyl reductase living microorganism bacterial classification---Pichia guilliermondii bacterium (Pichia guilliermondii) X25, and biological asymmetric reduction (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester prepare 6-cyano group-(3R, 5R)-application in the dihydroxyl hecanoic acid t-butyl ester.
The technical solution used in the present invention is:
One strain has instead-bacterial strain---Pichia guilliermondii bacterium (Pichia guilliermondii) X25 of Prelog cis-selectivity R-carbonyl reduction enzymic activity, be preserved in Chinese typical culture collection center, address: China, Wuhan, Wuhan University, postcode: 430072, deposit number is CCTCC No:M2011386, preservation date is on November 11st, 2011.Through identifying that this bacterial strain belongs to the guilliermondii kind of Pichia (Pichia), strain number is X25.
The bacterial strain colonial morphology: bacterium colony is creamy white, neat in edge, and circle, opaque, smooth surface, protuberance (the cellscan electromicroscopic photograph is seen Fig. 1).
Cellular form: cell is ovum circle or melon seeds shape, about 1.4 ~ 2.5 μ m of size * 1.4 ~ 5.0 μ m.
Physiological and biochemical property: utilize Biolog microorganism automatic identifying system to measure the metabolism situation of 25 pairs of 65 kinds of carbon sources of strain X, analyze the metabolism fingerprint through the Biolog readout instrument, strain X 25 can be utilized 42 kinds of carbon sources more by force, can not utilize or utilize ability weak (seeing table 1 for details) to other 23 kinds of carbon sources.
Table 1: utilizing the Biolog microorganism to identify automatically is to analyze strain X 25 utilization of carbon source results
Annotate :+, the positive;-, feminine gender; B, the boundary line.
18S rDNA sequential analysis: be template with the total DNA of strain X 25 cells that extracts, utilize primer: the 16S rDNA gene of pITS1:5' – TCCGTAGGTGAACCTGCGG – 3' and pITS4:5 '-TCCTCCGCTTATTGATATGC – 3' amplification strain X 25, will be through the fragment cloning of pcr amplification behind the T carrier, the recombinant plasmid of the 18S rDNA fragment that contains acquisition behind the extracting plasmid, confirm that through order-checking this fragment physical length is 606bp, specific as follows: agataggttg ggccagaggt ttaacaaaac acaatttaat tatttttaca gttagtcaaattttgaatta atcttcaaaa ctttcaacaa cggatctctt ggttctcgca tcgatgaagaa cgcagcgaa atgcgataag taatatgaat tgcagatttt cgtgaatcat cgaatctttg aacgcacatt gcgccctctg gtattccaga gggcatgcct gtttgagcgt catttctctctcaaaccccc gggtttggta ttgagtgata ctcttagtcg gactaggcgt ttgcttgaaa agtattggca tgggtagtac tggatagtgc tgtcgacctc tcaatgtatt aggtttatcc aactcgttga atggtgtggc gggatatttc tggtattgtt ggcccggcct tacaacaacc aaacaagttt gacctcaaat caggtaggaa tacccgctga acttaagcat atcaataagc ggagga.
The gene order and the GenBank data that obtain are carried out similarity analysis, strain X 25 and Pichia guilliermondi(FJ969194.1) homology reaches 100%(homology, 100%/607bps, based on 18S rDNA).Therefore, determine that strain X 25 belongs to the guilliermondii kind that Pichia belongs to, Chinese is Pichia guilliermondii.
Comprehensive The above results, this bacterial strain belong to through molecular genetics identifies that strain X 25 is defined as the Pichia guilliermondii bacterium, and Latin is called Pichia guilliermondii.
The microorganism strains that the present invention relates to is to obtain by following program screening:
1) 1.0 liters of enrichment mediums that contain (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester of preparation, the enrichment medium final concentration is composed as follows: glucose 25.0 ~ 50.0g/L, soybean sprout 50.0 ~ 100.0g/L, 11.4 ~ 22.8g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, solvent is water, the medium pH nature.Contain in (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester enrichment medium being collected in to be seeded to after soil sample in all parts of the country is disperseed according to a certain percentage with physiological saline, under 30 ℃, 150rpm condition, the shaking table shaking culture is after nutrient solution becomes muddiness, according to 2%(v/v) inoculum size is transferred in the fresh aseptic culture medium, continue under 30 ℃, 150rpm condition shaking table shaking culture 3 ~ 4 days.So repeat 3 circulations.
2) test tube slant and the solid plate of preparation some amount, the solid medium final concentration is composed as follows: glucose 25.0 ~ 50.0g/L, soybean sprout 50.0～100.0g/L, 15.0 ~ 20.0g/L agar, solvent are water, the medium pH nature was sterilized 20 minutes for 121 ℃.With last enrichment culture liquid stepwise dilution, be applied on the plate culture medium 30 ℃ and be cultured to and form observable single bacterium colony, picking list bacterium colony is forwarded to aseptic inclined-plane, cultivates 2 days for 30 ℃, the inclined-plane places 4 ℃ of refrigerator preservations.
3) 1.0 liters of liquid fermentation mediums of preparation, the fermention medium final concentration is composed as follows: glucose 5.0 ~ 25.0g/L, yeast extract paste 5.0 ~ 25.0g/L, (NH
4)
2HPO
40.5 ~ 2.5g/L, KH
2PO
40.5 ~ 2.5g/L, NaCl 0.5 ~ 1.0g/L, pH6.0 sterilized 20 minutes for 121 ℃.The single bacterium colony that is deposited on the test tube slant is inoculated in the fermention medium that contains inductor one by one, cultivated 48 ~ 72 hours for 30 ℃, pipette 5 ~ 20mL fermented liquid respectively, centrifugal, collect thalline and wash thalline 3 times with stroke-physiological saline solution, washed thalline is scattered in 10.0mL, the pH7.0 phosphoric acid buffer (50.0mM), fully disperse the back to add (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester of 10 ~ 100 μ L, 25 ~ 35 ℃ transform 1 ~ 4 hour, and conversion fluid adopts the carbonyl reduction enzymic activity of the every strain bacterial classification of liquid-phase chromatographic analysis behind centrifugal, micro-filtration.In the 73 strain bacterial classifications that separation obtains, X25 has instead-Prelog cis-selectivity carbonyl reduction enzymic activity.
Described have anti--Prelog cis-selectivity carbonyl reduction enzymic activity, can be used for microorganism catalysis prepare optical purity 6-cyano group-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester.
The invention still further relates to described Pichia guilliermondii bacterium X25 microorganism catalysis prepare 6-cyano group-(3R, 5R)-application in the dihydroxyl hecanoic acid t-butyl ester.Reaction principle is shown below:
Concrete, described being applied as: be that substrate, Pichia guilliermondii bacterium X25 are that catalyzer, phosphate buffered saline buffer are in the reaction system of solvent through the enzyme somatic cells that contains that fermentation obtains with (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, under 25 ~ 35 ℃, carry out conversion reaction, the described 6-cyano group of acquisition in reaction solution-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester.In the reaction system, the substrate addition is 1 ~ 200g/L, and containing enzyme somatic cells addition is 0.1 ~ 50g/L DCW/L(dry mycelium amount).
This contains the enzyme somatic cells and can be obtained by the routine fermentation, just need substrate (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester as inductor, be applicable to that in routine inductor gets final product in the liquid fermentation medium of Pichia guilliermondii bacterium, the addition of inductor can be controlled in 0.5 ~ 5.0g/L scope.Under 25 ~ 30 ℃ of conditions, cultivated 24 ~ 60 hours, acquisition has the fermented liquid of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester carbonyl reduction activity, fermented liquid is through centrifugal, washing back collection thalline, biotinylated biomolecule catalyzer Pichia guilliermondii bacterium X25's contain the enzyme somatic cells for follow-up bio-transformation provides, the work of fermentating liquid volume enzyme reaches 34.56U/L, product 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester de value reaches more than 99.0%.
Concrete, the described enzyme somatic cells that contains can be prepared by following method: Pichia guilliermondii bacterium X25 is seeded in the fermention medium 28 ~ 30 ℃ and cultivated 36 ~ 48 hours, obtains fermented liquid and obtains the described enzyme somatic cells that contains through separation; Described fermention medium final concentration is composed as follows: glucose 10 ~ 40g/L, yeast extract paste 10 ~ 30g/L, glucose 25.0 ~ 50.0g/L, Na
2HPO
41.0 ~ 5.0g/L, NaCl 0.1 ~ 1g/L, CuCl
210 ~ 30mg/L, (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester 0.5 ~ 5.0g/L, solvent is water, pH5 ~ 9.
For improving transformation efficiency, can add glucose, ethanol, methyl alcohol, glycerine, Virahol, sucrose, fructose, n-propyl alcohol in the reaction system as cosubstrate, the cosubstrate addition is 1 ~ 300g/L damping fluid.
Described being applied as: Pichia guilliermondii bacterium X25 is distributed in the phosphate buffered saline buffer with 0.1 ~ 20.0g DCW/L addition through the enzyme somatic cells that contains that fermentation obtains, add glucose 10 ~ 100g/L, add (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester 10 ~ 100g/L, after fully mixing, be preheated to 15 ~ 45 ℃, 15 ~ 45 ℃ were reacted 0.5 ~ 32 hour, obtain containing product 6-cyano group-(3R, 5R)-conversion fluid of dihydroxyl hecanoic acid t-butyl ester; Conversion fluid is through equal-volume ethyl acetate, n-butyl acetate extraction, the extraction liquid vacuum distillation recovered solvent, vacuum concentration, obtain described optical purity 6-cyano group-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester.
(R)-6-cyano group among the present invention-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester and 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester and epimer 6-cyano group thereof-(3S, 5R)-quantitative analysis of dihydroxyl hecanoic acid t-butyl ester and conformational analysis adopt high performance liquid chromatography, gas chromatography respectively.High performance liquid chromatography quantitative analysis condition: Yi Lite Hypersil ODS2C18 post (5 μ m 4.6mm * 250mm), 210nm, acetonitrile: water=25:75 (v/v); Under this analysis condition, substrate (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, product 6-cyano group-(3R, 5R)-retention time of dihydroxyl hecanoic acid t-butyl ester was respectively 11.3 minutes, 8.3 minutes.Gas-chromatography conformational analysis condition: the HP-5 gas chromatographic column, post oven temperature, degree was kept 5 minutes for 180 ℃, was warming up to 250 ℃ with 5 ℃/minute of heat-up rates then, kept 250 ℃ of detector temperatures, 230 ℃ of injector temperatures 5 minutes; Under this analysis condition, 6-cyano group-(3R, 5R)-retention time of dihydroxyl hecanoic acid t-butyl ester is 6.685 minutes.
Beneficial effect of the present invention is mainly reflected in: microorganism novel bacterial-Pichia guilliermondii bacterium (Pichia guilliermondii) X25 that provides a strain to have cis-selectivity carbonyl reduction enzymic activity, carbonyl reduction enzymatic conversion (the R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester that utilizes this bacterium to produce prepares optical purity 6-cyano group-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester, the stereoselectivity height, the reaction conditions gentleness, environmental friendliness.
(4) description of drawings
Fig. 1 is bacterial strain colonial morphology photo and cellscan electromicroscopic photograph;
Fig. 2 is that (R)-6-cyano group in the fermented liquid-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester concentration is to the influence of the work of carbonyl reductase volume enzyme and cis-selectivity;
Fig. 3 is that culture temperature is to the influence of the work of Pichia guilliermondii X25 carbonyl reductase volume enzyme and cis-selectivity;
Fig. 4 is that the initial pH value of fermention medium is to the influence of the work of Pichia guilliermondii X25 carbonyl reductase volume enzyme and cis-selectivity.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: screening has catalysis (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester reducing activity microorganism strains
Gather soil sample in all parts of the country, get the 1.0g soil sample and be distributed in 10.0mL, 0.85% normal saline solution, fully mixing; Get the 2.0mL bacterial suspension inoculation to 28mL contain 100mM (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester enrichment medium (preparation: 50.0g glucose, soybean sprout 100.0g boiled 30 minutes, add 22.8g (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, add water and complement to 1.0L, the pH nature); Under 28 ℃, 150rpm condition, the shaking table shaking culture is after nutrient solution becomes muddiness; According to 2%(v/v) inoculum size is transferred in the fresh aseptic enrichment medium (form the same), continues under 30 ℃, 150rpm condition, and shaking table shaking culture 4 days obtains the 2nd batch of enrichment culture thing.
To the 2nd batch of enrichment culture thing stepwise dilution, be applied on the solid plate, 30 ℃ are cultured to the tangible single bacterium colony of formation, the single bacterium colony that forms on the flat board is transferred to the (preparation: 50.0g glucose of sterile test tube inclined-plane, soybean sprout 100.0g boiled 30 minutes, agar 20.0g water complements to 1.0L, the medium pH nature; Sterilized 20 minutes the cooling bevel for 121 ℃), to cultivate 2 days for 30 ℃, the inclined-plane places 4 ℃ of refrigerators to preserve.
To being kept at the bacterial classification enforcement vigor detection one by one on the test tube slant.Picking one transfering loop thalline is inoculated in the no bacteria fermentation culture medium that contains 3g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester in the preservation inclined-plane of each bacterial classification, other component prescription of fermention medium is as follows: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl 1.0g/L, solvent are water, pH6.0.Cultivated 2 days under 30 ℃, 150rpm condition, collect fermented liquid.Respectively pipette the 20.0mL fermented liquid, centrifugal 8 minutes of 12000rpm abandons supernatant, collects thalline, thalline washs 3 times with physiological saline, use 10.0ml phosphoric acid buffer (50.0mM, pH7.0) that washed cell is dispersed in again and transform in the bottle, add 100 μ L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, place 30 ℃ of shaking baths, reacted 4 hours, get the 1.0mL conversion fluid, centrifugal 6 minutes of 12000rpm, supernatant liquor adopt 0.45 μ m micro-filtrate membrane filtration.The filtrate of the clarification that obtains carries out that liquid-phase chromatographic analysis 6-cyano group-(3R 5R)-dihydroxyl hecanoic acid t-butyl ester concentration, calculates the carbonyl reduction enzymic activity of each strain bacterial classification.In the screening bacterial strain, Pichia guilliermondii X25(is CCTCC No:M2011386) vigor is the strongest.
Carbonyl reductase is lived and is defined: under the reaction conditions of appointment, per minute catalysis (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester generate 1 micromole 6-cyano group-(3R, 5R)-the required enzyme amount of dihydroxyl hecanoic acid t-butyl ester is defined as 1 carbonyl reduction enzyme activity unit.
Embodiment 2: (R)-6-cyano group in the fermention medium-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester concentration is to the influence of the work of Pichia guilliermondii X25 carbonyl reductase volume enzyme and cis-selectivity
The Pichia guilliermondii X25 bacterial classification picking one transfering loop thalline that will be kept on the test tube slant is inoculated in the no bacteria fermentation culture medium that contains 0g/L, 0.5g/L, 1.0g/L, 2.0g/L, 3.0g/L, 4.0g/L, 5.0g/L, 7.0g/L, 8.0g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, other component prescription of fermention medium is as follows: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl 1.0g/L, solvent are water, pH6.0.28 ℃, cultivated 2 days under the 150rpm condition, collect fermented liquid.
Respectively pipette the 20mL fermented liquid, centrifugal 8 minutes of 12000rpm abandons supernatant, collects thalline, thalline washs 3 times with physiological saline, use 10.0mL, pH7.0 phosphoric acid buffer (50mM) that washed cell is dispersed in again and transform in the bottle, add 0.07mg (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, place 30 ℃ of shaking baths, reaction 4h, get the 1.0mL conversion fluid, centrifugal 6 minutes of 12000rpm, supernatant liquor adopt 0.45 μ m micro-filtrate membrane filtration.The filtrate of the clarification that obtains carries out that liquid-phase chromatographic analysis 6-cyano group-(3R 5R)-dihydroxyl hecanoic acid t-butyl ester concentration, calculates the carbonyl reduction enzyme activity under each condition, the results are shown in Fig. 2.The result shows that under 4g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester condition, enzyme work reaches 28.84U/L, de value 86.4%.
Embodiment 3: culture temperature is to the influence of and cis-selectivity alive to Pichia guilliermondii X25 carbonyl reductase volume enzyme
The Pichia guilliermondii X25 bacterial classification picking one transfering loop thalline that will be kept on the test tube slant is inoculated in the aseptic culture medium that contains 4.0g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, here the effect of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester performance inductor, other component prescription of fermention medium is as follows: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl 1.0g/L, solvent are water, pH7.0 is respectively 18 ℃, 21 ℃, 24 ℃, 28 ℃, 32 ℃, 34 ℃, 37 ℃ in temperature, cultivates 2 days under the 150rpm condition, collects fermented liquid.
Respectively pipette the 20mL fermented liquid, centrifugal 8 minutes of 12000rpm abandons supernatant, collects thalline, thalline washs 3 times with physiological saline, use 10.0mL, pH7.0 phosphoric acid buffer (50mM) that washed cell is dispersed in again and transform in the bottle, add 0.07mg (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, place 30 ℃ of shaking baths, reacted 4 hours, get the 1.0mL conversion fluid, centrifugal 6 minutes of 12000rpm, supernatant liquor adopt 0.45 μ m micro-filtrate membrane filtration.The filtrate of the clarification that obtains carries out that liquid-phase chromatographic analysis 6-cyano group-(3R 5R)-dihydroxyl hecanoic acid t-butyl ester concentration, calculates the carbonyl reduction enzyme activity under each condition, the results are shown in Fig. 3.The result shows that under 28 ℃ of conditions, the work of volume enzyme reaches 21.79U/L, de value 84.8%.
Embodiment 4: the initial pH value of fermention medium is to the influence of the work of Pichia guilliermondii X25 carbonyl reductase volume enzyme and cis-selectivity
The Pichia guilliermondii X25 bacterial classification picking one transfering loop thalline that will be kept on the test tube slant is inoculated in the aseptic culture medium that contains 4.0g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, here the effect of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester performance inductor, other component prescription of fermention medium is as follows: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl 1.0g/L, solvent are water, 28 ℃ of temperature, the initial pH value 3.0 of fermented liquid, 4.0,5.0,6.0,7.0,8.0,9.0 was cultivated 2 days under the 150rpm condition, collected fermented liquid.
Respectively pipette the 20mL fermented liquid, centrifugal 8 minutes of 12000rpm abandons supernatant, collects thalline, thalline washs 3 times with physiological saline, use 10.0mL, pH7.0 phosphoric acid buffer (50mM) that washed cell is dispersed in again and transform in the bottle, add 0.07mg (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, place 30 ℃ of shaking baths, reacted 4 hours, get the 1.0mL conversion fluid, centrifugal 6 minutes of 12000rpm, supernatant liquor adopt 0.45 μ m micro-filtrate membrane filtration.The filtrate of the clarification that obtains carries out that liquid-phase chromatographic analysis 6-cyano group-(3R 5R)-dihydroxyl hecanoic acid t-butyl ester concentration, calculates the carbonyl reduction enzyme activity under each condition, the results are shown in Fig. 4.The result shows that under the pH7.0 condition, the work of volume enzyme reaches 28.18U/L, de value 84.7%.
Embodiment 4: biological catalyst Pichia guilliermondii X25 cell preparation
The novel carbonyl reductase that obtains from seed selection of the present invention produces picking one ring thalline on the test tube slant of bacterial classification Pichia guilliermondii X25, be seeded to (the preparation: 50.0g glucose of 50.0mL aseptic seed substratum, soybean sprout 100.0g boiled 30 minutes, filter, water complements to 1.0L, the medium pH nature.121 ℃ of substratum sterilization 20 minutes) in, the shaking culture base is 24 hours under 30 ℃, 150rpm condition, obtains seed liquor.1.0mL seed liquor is seeded to the (preparation: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH of the aseptic fermentation culture of 50.0mL
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl 1.0g/L, 4g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, solvent is water, pH6.0), and 28 ℃, cultivated 2 days under the 150rpm condition, collect fermented liquid.Behind centrifugal 8 minutes of the fermented liquid 12000rpm, abandon supernatant and collect thalline, thalline washs 3 times with 0.85% physiological saline, collect and obtain 11.0g Pichia guilliermondii X25 thalline, this thalline has instead-Prelog cis-selectivity carbonyl reduction enzymic activity (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester.
Embodiment 5: invert point is to the influence of Catalytic processes
The biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare.Transformation system is selected 10.0mL pH7.0 phosphoric acid buffer (50.0mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, 10g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 20g/L glucose, transform 4 hours down at 20 ℃, 24 ℃, 28 ℃, 30 ℃, 35 ℃, 40 ℃ respectively, conversion fluid adopts the carbonyl reduction enzymic activity of each bacterial classification of liquid-phase chromatographic analysis behind centrifugal, micro-filtration, analyze different invert points to the influence of catalytic process enzyme activity.
The result discloses, and Pichia guilliermondii X25 catalytic efficiency is the highest in the time of 30 ℃, and the work of volume enzyme reaches 30.23U/L, de value 85.9%.(R)-6-cyano group under other invert point condition-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester asymmetric reduction data are as follows: in the time of 20 ℃, and Pichia guilliermondii X25 carbonyl reductase volume enzyme 2.83U/L alive, de value 85.1%; In the time of 24 ℃, carbonyl reductase volume enzyme 9.05U/L alive, de value 84.8%; In the time of 28 ℃, carbonyl reductase volume enzyme 29.72U/L alive, de value 85.3%; In the time of 35 ℃, carbonyl reductase volume enzyme 25.34U/L alive, de value 82.1%; In the time of 40 ℃, carbonyl reductase volume enzyme 14.71U/L alive, de value 82.7%.
Embodiment 6: cosubstrate is to the influence of Catalytic processes
The biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare.Transformation system is selected 10.0mL, pH7.0 phosphoric acid buffer (50mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, (R)-6-cyano group of 10g/L-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, add 20g/L glucose, ethanol, methyl alcohol, glycerine, Virahol, sucrose, fructose, n-propyl alcohol respectively as cosubstrate, transform 15 minutes down at 30 ℃, conversion fluid adopts the carbonyl reduction enzymic activity of each strain bacterial classification of liquid-phase chromatographic analysis behind centrifugal, micro-filtration, analyze different cosubstrates to the influence of catalytic process enzyme activity.The result discloses, and the 20g/L glucolase is lived the highest, reaches 31.41U/L, de value 99.3%.
Other cosubstrate exists as follows to the influence of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester asymmetric reduction efficient: during 20g/L ethanol, and Pichia guilliermondii X25 carbonyl reductase volume enzyme 0.74U/L alive, de value 93.6%; During 20g/L methyl alcohol, Pichia guilliermondii X25 carbonyl reductase volume enzyme 0.83U/L alive, de value 93.2%; During 20g/L glycerine, carbonyl reductase volume enzyme 28.25U/L alive, de value 95.7%; During the 20g/L Virahol, carbonyl reductase volume enzyme 29.72U/L alive, de value 98.7%; During 20g/L sucrose, carbonyl reductase volume enzyme 30.92U/L alive, de value 99.0%; During 20g/L fructose, carbonyl reductase volume enzyme 30.54U/L alive, de value 98.7%; During the 20g/L n-propyl alcohol, carbonyl reductase volume enzyme 1.02U/L alive, de value 94.3%.
Embodiment 7: (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester asymmetric reduction technology under the low concentration of substrate condition
6-cyano group-(3R, 5R)-the synthetic biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare of dihydroxyl hecanoic acid t-butyl ester.Transformation system is selected 10.0mL, pH7.0 phosphoric acid buffer (50.0mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, 10g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 10g/L glucose, 30 ℃ transform 30 minutes.Detect through HPLC, substrate conversion efficiency 3.4%, 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester de value〉99.9%.
6-cyano group-(3R, 5R)-the synthetic biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare of dihydroxyl hecanoic acid t-butyl ester.Transformation system is selected 10.0mL, pH7.0 phosphoric acid buffer (50mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, 10g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 10g/L glucose, 28 ℃ transform 6 hours.Detect through HPLC, substrate conversion efficiency 24.3%, 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester de value 99.1%.
Embodiment 8: (R)-6-cyano group under the high concentration of substrate condition-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester asymmetric reduction technology
6-cyano group-(3R, 5R)-the synthetic biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare of dihydroxyl hecanoic acid t-butyl ester.Transformation system is selected 10.0mL, pH7.0 phosphoric acid buffer (50mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, 100g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 100g/L glucose, 30 ℃ transform 12 hours.Detect through HPLC, substrate conversion efficiency 6.7%, 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester de value 90.3%.
6-cyano group-(3R, 5R)-the synthetic biological catalyst Pichia guilliermondii X25 somatic cells of selecting for use the present invention to prepare of dihydroxyl hecanoic acid t-butyl ester.Transformation system is selected 10.0mL, pH7.0 phosphoric acid buffer (50mM), Pichia guilliermondii X25 final concentration of cells is 13.0g DCW/L, 100g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 100g/L glucose, 30 ℃ transform 1d.Detect through HPLC, substrate conversion efficiency 8.4%, 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester de value 90.1%.
SEQUENCE LISTING
＜110〉Zhejiang Polytechnical University
＜120〉biocatalysis prepare 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester and bacterial strain
<130>
<160> 3
<170> PatentIn version 3.4
<210> 1
<211> 486
<212> DNA
<213> Pichia guilliermondii
<400> 1
agataggttg ggccagaggt ttaacaaaac acaatttaat tatttttaca gttagtcaaa 60
ttttgaatta atcttcaaaa ctttcaacaa cggatctctt ggttctcgca tcgatgaaga 120
acgcagcgaa atgcgataag taatatgaat tgcagatttt cgtgaatcat cgaatctttg 180
aacgcacatt gcgccctctg gtattccaga gggcatgcct gtttgagcgt catttctctc 240
tcaaaccccc gggtttggta ttgagtgata ctcttagtcg gactaggcgt ttgcttgaaa 300
agtattggca tgggtagtac tggatagtgc tgtcgacctc tcaatgtatt aggtttatcc 360
aactcgttga atggtgtggc gggatatttc tggtattgtt ggcccggcct tacaacaacc 420
aaacaagttt gacctcaaat caggtaggaa tacccgctga acttaagcat atcaataagc 480
ggagga 486
<210> 2
<211> 19
<212> DNA
<213> Unknown
<220>
＜223〉artificial sequence
<400> 2
tccgtaggtg aacctgcgg 19
<210> 3
<211> 20
<212> DNA
<213> Unknown
<220>
＜223〉artificial sequence
<400> 3
Claims (6)
1. a strain has the bacterial strain of R-carbonyl reduction enzymic activity---Pichia guilliermondii bacterium (Pichia guilliermondii) X25, be preserved in Chinese typical culture collection center, address: China, Wuhan, Wuhan University, postcode: 430072, deposit number is CCTCC No:M2011386, preservation date is on November 11st, 2011.
(2) as claimed in claim 1, wherein the yeast Pichia guilliermondii X25, characterized in that the strain of the 18S rDNA nucleotide sequence is as follows：agataggttg ggccagaggt ttaacaaaac acaatttaat tatttttaca gttagtcaaattttgaatta atcttcaaaa ctttcaacaa cggatctctt ggttctcgca tcgatgaagaa cgcagcgaa atgcgataag taatatgaat tgcagatttt cgtgaatcat cgaatctttg aacgcacatt gcgccctctg gtattccaga gggcatgcct gtttgagcgt catttctctctcaaaccccc gggtttggta ttgagtgata ctcttagtcg gactaggcgt ttgcttgaaa agtattggca tgggtagtac tggatagtgc tgtcgacctc tcaatgtatt aggtttatcc aactcgttga atggtgtggc gggatatttc tggtattgtt ggcccggcct tacaacaacc aaacaagttt gacctcaaat caggtaggaa tacccgctga acttaagcat atcaataagc ggagga.
Pichia guilliermondii bacterium X25 as claimed in claim 1 microorganism cis-selectivity catalytic preparation 6-cyano group-(3R, 5R)-application in the dihydroxyl hecanoic acid t-butyl ester.
4. application as claimed in claim 3, it is characterized in that described being applied as: be that the phosphate buffered saline buffer of catalyzer, pH7.0 is in the reaction system of solvent at the enzyme somatic cells that contains that to be substrate, Pichia guilliermondii bacterium X25 with (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester obtain through fermentation, under 25～35 ℃, carry out conversion reaction, the described 6-cyano group of acquisition in reaction solution-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester.
5. application as claimed in claim 4, it is characterized in that the described enzyme somatic cells that contains is prepared by following method: Pichia guilliermondii bacterium X25 is seeded in the fermention medium under 28 ℃, 150rpm condition and cultivated 48 hours, obtains fermented liquid and obtains the described enzyme somatic cells that contains through separation; Described fermention medium final concentration is composed as follows: yeast extract paste 25.0g/L, glucose 25.0g/L, (NH
4)
2HPO
42.5g/L, KH
2PO
42.5g/L, MgSO
430mg/L, NaCl1.0g/L, 4g/L (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, solvent is water, pH6.0.
6. application as claimed in claim 4, it is characterized in that described being applied as: Pichia guilliermondii bacterium X25 is distributed in the phosphate buffered saline buffer with 0.1～20.0g DCW/L addition through the enzyme somatic cells that contains that fermentation obtains, add glucose 10～100g/L, add (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester 10～100g/L, after fully mixing, be preheated to 25～35 ℃, 25～35 ℃ were reacted 0.5～32 hour, obtain containing product 6-cyano group-(3R, 5R)-conversion fluid of dihydroxyl hecanoic acid t-butyl ester; Conversion fluid is through equal-volume ethyl acetate, n-butyl acetate extraction, the extraction liquid vacuum distillation recovered solvent, vacuum concentration, obtain described 6-cyano group-(3R, 5R)-the dihydroxyl hecanoic acid t-butyl ester.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110451447 CN102643757B (en) | 2011-12-29 | 2011-12-29 | 6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110451447 CN102643757B (en) | 2011-12-29 | 2011-12-29 | 6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102643757A CN102643757A (en) | 2012-08-22 |
| CN102643757B true CN102643757B (en) | 2013-09-11 |
Family
ID=46656835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110451447 Active CN102643757B (en) | 2011-12-29 | 2011-12-29 | 6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102643757B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103014080B (en) * | 2012-12-19 | 2015-02-18 | 苏州汉酶生物技术有限公司 | Biological preparation method of 6-cyano-(3R, 5R)-dihydroxyhexanoate |
| CN103122320B (en) * | 2013-01-22 | 2014-07-02 | 浙江工业大学 | Tert-butyl 6-cyano-(3R,5R)-dihydroxyhexanoate prepared by biological catalysis and strain |
| CN103146591B (en) * | 2013-01-30 | 2014-08-27 | 浙江工业大学 | Biological reduction for preparing statin side chain 6-cyanogroup-(3R, 5R)- dyhydroxyl caproic acid tert-butyl ester and bacterial strain |
| CN104342460B (en) * | 2013-08-09 | 2018-03-16 | 南京朗恩生物科技有限公司 | A kind of method that statin side chain intermediate is prepared using whole-cell catalytic |
| CN104372041B (en) * | 2013-08-12 | 2018-03-16 | 南京朗恩生物科技有限公司 | A kind of method that whole-cell catalytic prepares the 3-hydroxyethyl butyrate of (S) 4 chlorine 3 |
| CN104498510A (en) * | 2014-11-13 | 2015-04-08 | 浙江工业大学 | Aldehyde ketoreductase bacterial strain, aldehyde ketoreductase gene, vector, engineering bacteria and application thereof |
| CN104630241A (en) * | 2015-01-05 | 2015-05-20 | 浙江工业大学 | Aldehyde ketone production reductase strain, gene, enzyme, vector, engineering bacteria and application |
| CN104651243B (en) * | 2015-02-03 | 2018-02-16 | 温州大学 | Pichia membranaefaciens and its application in chiral synthesis (R) 1,3 butanediol |
| CN106520580B (en) | 2016-09-05 | 2019-08-20 | 华南理工大学 | One saccharomycete and its application in catalysis 2,5- dihydroxymethyl furans synthesis |
| CN112159768B (en) * | 2020-09-27 | 2022-03-08 | 浙江工业大学 | Pichia guilliermondii and application thereof in biological deodorization |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1162422C (en) * | 1998-08-05 | 2004-08-18 | 钟渊化学工业株式会社 | Process for prepn. of optically active 2-(16-(hydroxymethyl)-1,3-dioxan-4-yl) acetic acid derivatives |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19857302C2 (en) * | 1998-12-14 | 2000-10-26 | Forschungszentrum Juelich Gmbh | Process for the enantioselective reduction of 3,5-dioxocarboxylic acids, their salts and esters |
-
2011
- 2011-12-29 CN CN 201110451447 patent/CN102643757B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1162422C (en) * | 1998-08-05 | 2004-08-18 | 钟渊化学工业株式会社 | Process for prepn. of optically active 2-(16-(hydroxymethyl)-1,3-dioxan-4-yl) acetic acid derivatives |
Non-Patent Citations (4)
| Title |
|---|
| Arto Liljeblad et al..Biocatalysis in the Preparation of the Statin Side Chain.《Current Organic Synthesis》.2009,全文. |
| Biocatalysis in the Preparation of the Statin Side Chain;Arto Liljeblad et al.;《Current Organic Synthesis》;20091231;全文 * |
| Biotransformation in Organic Synthesis: Applications of Yeast Reduction in the Synthesis of 3,5=Dihydroxy Esters of High Optical Purity;Markus Christen and David H. G. Crout;《J. CHEM. SOC., CHEM. COMMUN.》;19981231;全文 * |
| Markus Christen and David H. G. Crout.Biotransformation in Organic Synthesis: Applications of Yeast Reduction in the Synthesis of 3,5=Dihydroxy Esters of High Optical Purity.《J. CHEM. SOC., CHEM. COMMUN.》.1998,全文. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102643757A (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643757B (en) | 6- cyano-(3R, 5R)-dyhydroxyl hexanoic acid tert-butyl ester prepared by biological catalysis, and bacterial strain thereof | |
| CN102217656B (en) | Application of alternaria alternata metabolite to controlling Botrytis cirerea | |
| CN105624200B (en) | A kind of recoverying and utilizing method of Hirsutella sinensis ferment filtrate | |
| CN104893989A (en) | Rhizopus microsporus root-shaped variant ZJPH1308 and application thereof in preparation of sitagliptin intermediate | |
| CN102204570A (en) | Application of alternaria alternate metabolic products in cucumber rhizoctonia solani prevention and control | |
| Hesham et al. | Optimization of citric acid production by immobilized cells of novel yeast isolates | |
| CN102807956B (en) | Ceriporia lacerata strain and application thereof | |
| CN102204571B (en) | Application of Alternaria alternata metabolic product in controlling watermelon fusarium oxysporum | |
| CN103667070A (en) | Plant endophytic fungi of huperzia serrata and application thereof in preparing huperzine A | |
| CN101265451A (en) | Endogenetic fungus for Huperzia Serrata (Thunb.)Trev | |
| CN1403581A (en) | Microbe fermenting process of producing perfume phenylethanol | |
| CN100999750B (en) | Process of synthesizing gastrodiacin by microorganism cell biological transferring parhydroxy benzyl methylol | |
| CN102168036A (en) | Preparation of R-4-chloro-3-hydroxybutyrate and S-3-hydroxy-butyrolactone by microbial transformation and strain | |
| CN102220247B (en) | Glycyrrhiza endophytic fungi for producing glycyrrhetic acid | |
| Haider | Citric acid production from carob pod extract by Aspergillus niger | |
| CN103045504A (en) | Microorganism catalysis prepared (2S,3R)-2-benzoyl aminomethyl-3-hydroxybutyric acid ester and bacterial strain | |
| CN103589665B (en) | Celebrating sheng, a reed pipe wind instrument rhodococcus and the application in preparation (S)-4-chloro-3-hydroxyl ethyl butyrate thereof | |
| CN103122320B (en) | Tert-butyl 6-cyano-(3R,5R)-dihydroxyhexanoate prepared by biological catalysis and strain | |
| CN103146591B (en) | Biological reduction for preparing statin side chain 6-cyanogroup-(3R, 5R)- dyhydroxyl caproic acid tert-butyl ester and bacterial strain | |
| CN106086090B (en) | A kind of method that two-step microbial conversion method prepares R-MA | |
| CN1333068C (en) | Biological catalytic preparation of (S)-4-chlorine-3-hydroxy-butanoic acid ester and bacterium therewith | |
| CN104140933B (en) | Aspergillus terreus ZRV2011F5 and application thereof | |
| CN103773724A (en) | Rhodococcus erythropolis XS1012 and application thereof in preparation of chiral alcohol | |
| CN103074239B (en) | Candida sorboxylosa and application thereof in preparation of (S)-4-chloro-3-hydroxybutanoate | |
| CN102210329B (en) | Application of Aspergillus restrictus 28-generation product on preventing and curing cucumber Rhizoctonia solani |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |