CN102643329A - Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning - Google Patents
Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning Download PDFInfo
- Publication number
- CN102643329A CN102643329A CN2011100426053A CN201110042605A CN102643329A CN 102643329 A CN102643329 A CN 102643329A CN 2011100426053 A CN2011100426053 A CN 2011100426053A CN 201110042605 A CN201110042605 A CN 201110042605A CN 102643329 A CN102643329 A CN 102643329A
- Authority
- CN
- China
- Prior art keywords
- ricin
- chain
- seq
- antibody
- monoclonal antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention belongs to the field of biotechnologies and specifically discloses functional epitopes YYYS and EXITH of ricin, wherein X can be any amino acid. The invention further discloses amino acid sequences of monoclonal antibodies 6C2 and 13G6 which are respectively specifically bounded with the functional epitopes YYYS and EXITH, as well as nucleotide sequences encoding the antibodies. The invention further discloses a use of the antibodies in the preparation of medicaments for preventing or treating ricin poisoning.
Description
Technical field
The invention belongs to biological technical field, more specifically, the invention discloses a kind of proteic functional epitope, with this epitope specificity bonded monoclonal antibody and in the purposes of preparation prevention or treatment Ricin poisoning medicine.
Background technology
Ricin (Ricin) is a kind of ribosome inactivating protein matter from the seed extraction of euphorbia plant castor-oil plant, is one of the most malicious toxin of nature, and the Ceng Zuowei biological warfare agent causes bio-terrorism, is classified as the category-B biological warfare agent.The possible mode of utilizing Ricin to carry out the attack of terrorism comprises: discharge Ricin aerosol or spraying liquid in the thick place of crowd: former with Ricin contaminated food and water; With syringe Ricin liquid is thrust human body etc.This toxin all can cause the people through respiratory tract suction, digestive tube absorption and intramuscular injection and poison.Suck after 4～8h makes airway epithelial necrosis, congested, oedema, cause interstitial pneumonia and wet lung.Make digestive tube, liver, spleen and nephrorrhagia, necrosis after the absorption, local injection then makes tissue necrosis get involved with relevant lymphoglandula, mainly dies from wet lung and ARDS.
Ricin is formed by connecting through disulfide linkage A, two polypeptied chains of B.Its toxic action mechanism mainly is the synthetic of arrestin matter.After toxin gets into human body, navigate to cell surface, promote that lps molecule gets into cell with the indent mode through the terminal combination that contains the acceptor of semi-lactosi of B chain identification; Form the cell capsula interna, whole subsequently lps molecule gets into tenuigenin from the cell capsula interna, and cracking in golgi body or lysosome; The A chain that dissociates, the A chain sees through film and gets into endochylema, brings into play the activity of its N-Glycosylase; Catalysis 28S rRNA sloughs a VITAMIN B4 at 4324; Make rrna 60S (protokaryon) or 80S (eucaryon) subunit inactivation, thereby synthesizing of arrestin matter causes necrocytosis.
Mechanism of action according to Ricin; Can be from antibody and small molecules antagonist aspect blocking-up Ricin performance its toxic action (Rainey GJ, Young JA (2004) Antitoxins:novel strategies to target agents of bioterrorism.Nat Rev Microbiol 2:721-726).The antibody of bibliographical information antiricin B chain can combining through blocking-up Ricin and cell surface galactosylated acceptor; Thereby the blocking-up Ricin gets into cell (Guo JW; Shen BF, Feng JN et al (2005) A novel neutralizing monoclonal antibody against cell-binding polypeptide of ricin.Hybridoma 24:263-266); The antibody of antiricin A chain can through with the avtive spot specific combination of N-Glycosylase; The activity of the RNA enzyme of blocking-up ricin A chain; Prevent its enzymolysis RNA; And then stop it to bring into play cytotoxic effect; So can be used as toxinicide (Lemley PV, Amanatides P, Wright DC (1994) Identification and characterization of a monoclonal antibody that neutralizes ricin toxicity in vitro and in vivo.Hybridoma 13:417-421 after good Ricin poisons; Massimo Maddaloni; Corrie Cooke; Royce Wilkinson; Audrey V.Stout, Leta Eng and Seth H.Pincus.Immunological Characteristics Associated with the Protective Efficacy of Antibodies to Ricin.2004; J Immunol; 172; 6221-6228).Up to the present, the epi-position of mentioning in the document discerned of the active Ricin antibody of neutralization that has all is on A chain or the B chain in the corresponding avtive spot.The epi-position that the disclosed antiricin A of the present invention chain monoclonal antibody is discerned all is in beyond the avtive spot of A chain, but all has in vivo and in vitro in the Ricin and provide protection.
Summary of the invention
One of the object of the invention is the new functional epitope EXITH that discloses Ricin, and wherein X can be arbitrary amino acid.
Another object of the present invention is another the new functional epitope YYYS that discloses Ricin.
The invention also discloses monoclonal antibody with above-mentioned first functional epitope specificity bonded antiricin A chain.
The invention also discloses monoclonal antibody with above-mentioned second functional epitope specificity bonded antiricin A chain.
More specifically; The invention discloses the monoclonal antibody 6C2 with above-mentioned first functional epitope specificity bonded antiricin A chain, the Nucleotide of its heavy chain, variable region of light chain and aminoacid sequence are respectively SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, SEQ ID NO:4; And be respectively SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, SEQ ID NO:8 with heavy chain, variable region of light chain Nucleotide and the aminoacid sequence of the monoclonal antibody 13G6 of above-mentioned second functional epitope specificity bonded antiricin A chain; CH is mouse IgG1, and constant region of light chain is mouse k chain, and their nucleotide sequence is respectively SEQ ID NO:9, SEQ ID NO:10.
Another object of the present invention is the application of monoclonal antibody in preparation prevention or treatment Ricin poisoning medicine that discloses above-mentioned antiricin.
Particularly; Applicant of the present invention at first utilizes molecular biotechnology clone ricin A chain gene; The ricin A catenin that utilized prokaryotic expression, and prepared the monoclonal antibody of a series of specific anti ricin A chains through the method for cytogamy-hybridoma, be the best especially wherein with antibody 6C2; Secondly be 13G6 antibody, also this two strains monoclonal antibody gene carried out the clone and measured its sequence.Applicant of the present invention utilizes African green monkey kidney cell strain Vero to carry out a series of experiments, verifies the toxic restraining effect of mouse-anti Ricin monoclonal antibody 6C2 pair cell disclosed by the invention.The cytotoxicity experiment result shows that antiricin antibody 6C2 and 13G6 all can effectively block the cell killing power of Ricin to Vero cell; Accordingly; Monoclonal antibody 2D6 as contrast does not then have above-mentioned effect, thereby has explained that above-mentioned antiricin A chain antibody 6C2 disclosed by the invention and 13G6 can effectively suppress the CDCC of Ricin.
Applicant of the present invention utilizes the Ricin abdominal injection in the mouse body, to set up the animal model that the infection of mouse Ricin is poisoned, and has verified that on this model antiricin A chain monoclonal antibody 6C2 and 13G6 also have effective prevention detoxifying function in vivo.In addition, utilize this model applicant of the present invention to verify that also 6C2 has efficacious therapy Ricin toxication in vivo.Applicant of the present invention also utilizes display technique of bacteriophage to identify the functional epitope of the Ricin of antibody 6C2 and 13G6 effect, and functional epitope is respectively EXITH and YYYS, has further set forth the action target spot of Ricin molecule.More specifically; Applicant of the present invention infers the different new functional epitopes that ricin A chain through elutriation, phage clones ELISA evaluation order-checking and the sequential analysis of monoclonal antibody epitope; Further, these functional epi-positions are identified through external zymetology experiment through rite-directed mutagenesis prokaryotic expression mutant protein.
Ricin antibody disclosed by the invention Ricin performance capable of blocking RNA enzymic activity prevents its enzymolysis RNA, and then stops its performance cytotoxic effect, so can be used as the toxinicide after good Ricin poisons.
Description of drawings
Fig. 1 ricin A chain enzyme is cut the restriction enzyme digestion and electrophoresis figure of link behind the PGEX-4T-2, and wherein the 1-6 swimming lane is that the enzyme of 6 different connection transformed clones is cut the result, and swimming lane 7 contrasts for empty carrier, and M is dna molecular amount marker;
Fig. 2 ricin A chain protokaryon abduction delivering SDS-PAGE figure, wherein the 1-5 swimming lane is 5 different clones' abduction delivering result, M is protein molecular weight marker;
Fig. 3 ricin A chain purifying SDA-PAGE figure, wherein RTA-GST is the fusion rotein of ricin A chain and GST, RTA is that enzyme cuts except that the pure ricin A chain behind the GST;
Fig. 4 monoclonal antibody 6C2 and 13G6 and RTA specificity binding curve;
Fig. 5 Vero cell is measured the Ricin sensitivity curves;
Fig. 6 antibody protection Vero cell is avoided the experiment of Ricin toxin attacks;
The external protein synthesis of Fig. 7 antibody suppresses the protection experiment;
Fig. 8 antibody endogenous protective prevention experiment;
Fig. 9 antibody endogenous protective treatment experiment;
Figure 10 antibody competition ELISA test detects the experiment of antibody identification meter position difference;
Figure 11 epi-position elutriation ELISA result;
Figure 12 epi-position comparison result;
Figure 13 Insight II software shows epi-position and report avtive spot;
Figure 14 BIAcore detects antibody blocking and combines activity experiment with substrate;
Figure 15 HPLC detects appearance detection curve on the Adenine standard substance;
Figure 16 HPLC detects antibody blocking Ricin depurination activity experiment;
Embodiment
Further the present invention will be described below in conjunction with embodiment, experimental example, and these embodiment, experimental example should not be construed as limitation of the present invention.Embodiment does not comprise the detailed description to traditional method; Be used for the method for carrier construction and plasmid like those, the gene of proteins encoded is inserted into the method for such carrier and plasmid or plasmid is introduced the method for host cell and classical cytogamy is screened with monoclonal antibody and the method for purifying etc.Such method is well-known for the personnel that have ordinary skill in this area, and in many publications, all describes to some extent, comprises Sambrook; J.; Fritsch, E.F.and Maniais, T. (1989) Molecular Cloning:A Laboratory Manual; 2nd edition, Cold spring Harbor Laboratory Press.
Former, the auxiliary material of not indicating the source in the embodiment of the invention or the experimental example are commercially available.
Synthetic and the clone of the full gene of embodiment 1. ricin A chains
With reference to Ricin data and the sequence that GENEBANK provides, full gene is synthetic, and sequence is following:
GGATTCGACGACGACGACAAGATCTTCCCGAAACAGTACCCGATCATCAACTTCACCACCGCTGGTGC
TACCGTTCAGTCCTACACCAACTTCATCCGTGCTGTTCGTGGTCGTCTGACCACCGGTGCTGACGTTC
GTCACGAAATCCCGGTTCTGCCGAACCGTGTTGGTCTGCCGATCAACCAGCGTTTCATCCTGGTTGAA
CTGTCCAACCACGCTGAACTGTCCGTTACCCTGGCTCTGGACGTTACCAACGCTTACGTTGTTGGTTA
CCGTGCTGGTAACTCCGCTTACTTCTTCCACCCGGACAACCAGGAAGACGCTGAAGCTATCACCCACC
TGTTCACCGACGTTCAGAACCGTTACACCTTCGCTTTCGGTGGTAACTACGACCGTCTGGAACAGCTG
GCTGGTTCCCTGCGTGAAAACATCGAACTGGGTAACGGTCCGCTGGAAGAAGCTATCTCCGCTCTGTA
CTACTACTCCACCGGTGGTACCCAGCTGCCGACCCTGGCTCGTTCCTTCATCGTTTGCATCCAGATGA
TCTCCGAAGCTGCTCGTTTCCAGTACATCGAAGGTGAAATGCGTACCCGTATCCGTTACAACCGTCGT
TCCGCTCCGGACCCGTCCGTTATCACCTTGGAAAACTCCTGGGGTCGTCTGTCCACCGCTATCCAGGA
ATCCAACCAGGGTGCTTTCGCTAGCCCGATCCAGCTGCAGCGTCGTAACGGTTCCAAATTCTCCGTTT
ACGACGTTTCCATCCTGATCCCGATCATCGCTCTGATGGTTTACCGTTGCGCTCCGCCGCCGAGCAGC
CAGTTCTAAGAATTC, there are BamHI and Hind III restriction enzyme site in two ends.Behind this double digestion, connect with PGEM-4T-2 (Promega company, the U.S.), behind the transformed into escherichia coli TG1, screening obtains that the pulsating positive colony of insertion is arranged.Determined dna sequence confirms that the result sees Fig. 1.
The prokaryotic expression purifying of embodiment 2. ricin A chains
The PGEM-4T-2 plasmid that contains the ricin A chain gene segment that the sequence of embodiment 1 gained is correct transforms BL21DE3 bacterium (Promega company; The U.S.) after; The single clone of picking goes out ricin A chain-GST (glutathione S-transferase) fusion rotein through the IPTG abduction delivering.Select to collect the expression supernatant behind a large amount of abduction deliverings of high expression level mono-clonal, through anti-GST chromatography column purifying, SDS-PAGE confirms to obtain the pure protein of ricin A chain-GST.Cut the label except that GST through enzyme, purifying through the SDS-PAGE electrophoresis, obtains pure ricin A chain after removing GST.The result sees Fig. 2,3.
The screening and the preparation of embodiment 3. mouse-anti ricin A chain monoclonal antibodies
After 100ug ricin A chain and the emulsification of equal-volume complete Freund's adjuvant; Abdominal injection BALB/C mice (Shanghai west pul one must triumphant laboratory animal ltd) immunization, per two week the back booster immunizations once, dosage is all immune with for the first time; The back changes incomplete Freund's adjuvant into twice and carries out emulsification; After being total to immune 3 times, choose the low higher mouse of antiricin A chain antibody in the serum, separate its spleen lymphocyte; Utilize classical PEG fusion method, mouse spleen lymphocyte and NS-1 cell are carried out cytogamy.Encapsulate 96 orifice plates with the 1ug/ml ricin A chain, but adopt hybridoma monoclonal cell strain-6C2,2D6 and the 13G6 of ELISA method repeated screening acquisition stably express antiricin A chain antibody.A large amount of amplification monoclonal cell strain 6C2,2D6 and 13G6, abdominal injection BALB/C mice 5*106/ only begins to collect mouse ascites about 10 days, utilize Protein A post, the monoclonal antibody of affinitive layer purification antiricin A chain.The ELISA test-results shows that above-mentioned antibody all can combine with the Ricin specificity.The result sees Fig. 4.
Collect 6C2 and 13G65 * 10
6～1 * 10
7Hybridoma, with its total RNA of TRIzol (Invitrogen Cat.No.15596-026) extracting, according to mouse antibodies constant region sequence, the design primer is following:
HGSP1：5’-GATACTGTGATCTGTTTG-3’
HGSP2：5’-TCGCAGATGAGTCTGGAC-3’
HGSP3：5’-ATGAACACACTCACATTG-3’
LGSP1：5’-GAGGTTATGACTTTCATAGTCAGC-3’
LGSP2：5’-AACACTGTCCAGGACACCATCTCG-3’
LGSP3：5’-TCTGGGATAGAAGTTGTTCATGAG-3’
Adopt Invitrogen 5 ' RACE kit (Cat.No.18374-058), respectively with HGSP1, LGSP1 is a primer, the synthetic first chain cDNA; Under TdT (Invitrogen, the U.S.) and dCTP (Invitrogen, the U.S.) effect, add poly C tail for the first chain cDNA, 3 ' end; With HGSP2, HGSP3, LGSP2, LGSP3 are 5 ' primer respectively, obtain the PCR product of VH, VL through nest-type PRC; The PCR product is packed in the pGEM-T carrier (Promega, the U.S.); Picking clone extracting plasmid, restriction enzyme is identified and is obtained positive colony, confirms its sequence through checking order.The Nucleotide of 6C2 variable region of heavy chain and aminoacid sequence are respectively SEQ ID NO:1, SEQ ID NO:2;
6C2 variable region of light chain Nucleotide and aminoacid sequence are respectively SEQ ID NO:3, SEQ ID NO:4; The Nucleotide of 13G6 variable region of heavy chain and aminoacid sequence are respectively SEQ ID NO:5, SEQ ID NO:6;
13G6 variable region of light chain Nucleotide and aminoacid sequence are respectively SEQ ID NO:7, SEQ ID NO:8; CH is mouse IgG1, and constant region of light chain is mouse k chain, and the nucleotide sequence of its heavy chain and light chain is respectively SEQ ID NO:9, SEQ ID NO:10.
Embodiment 5.6C2,2D6 and 13G6 monoclonal antibody in the Ricin and the protection activity experiment
Experimental example 1 external Vero cytoprotective experiment
Utilize Vero cell infection Ricin holotoxin to detect the monoclonal antibody provide protection.Specifically, detect Vero cell infection Ricin holotoxin dosage susceptibility earlier.Counting Vero cell (ATCC, the U.S.) is spread 96 orifice plates, 5000/hole, adds the Ricin (Sigma, the U.S.) of various dose every other day.Detect the cell proliferation situation with mtt assay after about 48 hours, promptly add (5mg/ml) 20ul/ hole of MTT (tetrazolium bromide), inhale gently after 4 hours and remove supernatant, add DMSO 200ul/ hole, 37 degree utilized ELIASA value of reading (OD492) after 15 minutes.According to curve, select finally to attack the toxic agent amount.The result sees Fig. 5.When Ricin dosage was increased to 6.4ng/ml by 0.0008ng/ml, Vero cell proliferation trend reduced along with the increase of Ricin dosage gradually, presents typical S type curve.We select for use minimum effective dose 0.64ng/ml to attack the toxic agent amount as follow-up cell.
Subsequently, carry out antibody protection cell experiment.Specifically, counting Vero cell bed board, cell count is the same.Add Ricin dosage 0.64ng/ml and different antibodies dosage (be respectively 10ug/ml, 10 doubling dilutions progressively are until 0.01ng/ml) every other day respectively.Experiment flow is the same behind about 48h.Experimental result is seen Fig. 6.6C2 and 13G6 antibody all promptly have better protecting property at 0.1ug/ml, and 1ug/ml and above concentration all protect cell to avoid the Ricin toxin attacks fully.
Experimental example 2 external protein synthesis inhibition tests
Utilize external rabbit reticulocyte lysate experiment to detect the protein synthesis inhibition ability that antiricin A chain monoclonal antibody 6C2,2D6 and 13G6 suppress Ricin respectively.Specifically; The 6C2 antibody of various dose or 13G6 antibody and 1ug Ricin join in the rabbit reticulocyte lysate premixed liquid after 37 degree are hatched 1 hour in advance; 30 degree continue to hatch adding Luciferase substrate detection liquid after 90 minutes, utilize luminoscope (Promega) to carry out the synthetic detection of fluorescence.The result sees Fig. 7.Results suggest is along with the improve of antibody dosage, and the protein synthesis amount progressively increases, and means that Ricin arrestin matter synthesis capability progressively descends, and prompting 6C2,2D6 and 13G6 antibody is external to have the excellent protection activity.
The experiment of experimental example 3 antibody endogenous protectives
Set up Balb/c mouse infection Ricin poisoning model, with the endogenous protective of detection antiricin A chain monoclonal antibody 6C2,2D6 and 13G6 active.Specifically, 6～8 ages in week, female Balb/c mouse peritoneal gave 1ug/ Ricin as positive control, and mouse death rate is observed in various dose antibody and the injection of 1ug Ricin preincubate pneumoretroperitoneum.The result sees Fig. 8.When antibody dosage was 2.5ug/, 6C2,2D6 and 13G6 antibody all can protect the mouse Ricin to poison.When antibody dosage is reduced to 0.5ug/, except that all the other the antibody group mouse death rates of 6C2 group mouse all with only to inject the Ricin group similar, even 6C2 antibody selects for use 0.5ug/ also can protect mouse to avoid the generation of Ricin poisoning lethality.
Further detect the protection window phase determination experiment that the 6C2 monoclonal antibody is poisoned to Ricin.Specifically, 1ug/ Ricin of mouse elder generation's abdominal injection selects different time points abdominal injection 6C2 respectively, as 1 hour, 2 hours, 4 hours and 8 hours.Observe the dead mouse situation and add up mortality ratio.The result sees Fig. 9.Along with the timed interval prolongation of infecting mouse injection of antibodies, to protect to render a service gradually and reduce, the mouse infection Ricin gives the 6C2 Antybody therapy after 2 hours can alleviate the deadly situation of Ricin poisoning fully, and does not see have obvious protection to render a service after reaching in 4 hours.
Experimental example 4 antibody competition ELISA detect both antibody recognition site differences
Utilize the competitive ELISA method to detect 6C2,2D6 and 13G6 antibody recognition ricin A chain site difference.Specifically, utilize protein HRP labelling kit (Pierce company) that 6C2 is carried out the HRP mark, subsequently the ricin A chain among the embodiment 2 is carried out wrapper sheet, 50ng/ hole, the sealing of 10% skim-milk.6C2 antibody hatched with RTA wrapper sheet hole in advance add various dose 13G6 antibody and control antibodies behind the 1h, continue to hatch 1 hour after, washing adds chromogenic substrate, uses H at last
2SO
4Termination reaction is surveyed A450 and A630 value.Otherwise 13G6 mark HRP, y and 6C2 and the 2D6 detection that is at war with in like manner.The result sees Figure 10.Along with the progressively increase of 13G6 antibody dosage, the colour developing value does not have considerable change, and vice versa.And 2D6 and both reactions of all not competing, the ricin A chain epi-position that prompting 6C2 and 13G6 antibody are discerned is different, also is different from 2D6.Though both external protections are active the same, activity in vivo 6C2 is superior to 13G6, and it is active to have influence on the enzyme performance owing to the site that 6C2 discerned.
The identification experiment of embodiment 6.6C2 and 13G6 monoclonal antibody epitope
Experimental example 1 adopts random peptide library immunity elutriator, and whole process is carried out on 96 orifice plates.6C2/13G6 monoclonal antibody 100ug/ml, the 100ul/ hole encapsulates for 4 ℃ spends the night, and 10% skim-milk (TBST dilution) sealing is spent the night, 1 * TBST (Tween-20 0.1%) washing 6 times; Phage random peptide library (available from NEB, Ph.D.-12
TMPhage Display Peptide Library Kit) 4 * 10
10Pfu+100ul normal mouse serum, room temperature jog 1 hour.1 * TBST (Tween-20 0.1%), 1 * TBST (Tween-200.3%), 1 * TBST (Tween-20 0.5%) wash respectively 5 times; With Glycine-ClPH 2.2 wash-outs that contain 1mg/ml BSA, room temperature jog 15 minutes, 15ul Tris-Cl PH 9.1 neutralizations.10ul is used to survey titre, all the other amplifications.Amplified production precipitates through PEG/NaCl, surveys titre, carries out second simultaneously and takes turns elutriation, and identical process carries out the third round elutriation.The result sees Figure 11.
Experimental example 2 order-checking and sequential analyses
Single stranded DNA extracts test kit (Shanghai JaRa company) preparation masterplate, the order-checking of-96 primers, and Chromas reads sequence, and 34 positive colonies have 3 independent sequences; AlignX analyzes, and the result sees Figure 12, can find out, the possible epitope of 6C2 is: EXITH, and the possible epitope of 13G6 is YYYS, the possible epitope of 2D6 is IPXLPXRV (X is an arbitrary amino acid).Utilize Insight II software, show that the antigen recognition epi-position of 6C2 is positioned at the side away from the report avtive spot, the antigen recognition epi-position of 13G6 is positioned at known avtive spot, and the identification epi-position of 2D6 then is positioned near the known avtive spot.The result sees Figure 13.
Embodiment 7.BIAcore detects 6C2 and the experiment of 13G6 antibody mechanism of action
Utilize BIAcore mensuration 6C2 and 13G6 to influence ricin A chain function phases difference.Specifically, with ribosome-RNA(rRNA) bag chip, the purified ricin A chain (RTA) of sample inventive embodiments 2 in the elder generation produces binding curve as contrast.Subsequently, preincubate 6C2 or 13G6 antibody and RTA, last appearance, observing binding curve has no change.The result sees Figure 14.Separately sample introduction RTA has one significantly to combine dissociation curve, typical binding curve then do not occur behind 13G6 and the RTA preincubate, explains that 13G6 has influence on combining of RTA and ribosome-RNA(rRNA); Then occur behind 6C2 and the RTA preincubate and go up the same combination dissociation curve of appearance RTA separately, explain that thus 6C2 does not have influence on RTA and combines actively with substrate, possibly influence RTA through other approach and bring into play activity.2D6 is similar with 6C2, does not have influence on RTA and combines with substrate.
Utilize HPLC to detect antibody and suppress RTA depurination activity.Specifically, 35pmol RTA and 130pmol6C2 or 13G6 antibody 37 degree water-bath preincubates are spent water-baths 30 minutes with 25pmol depurination substrate ribosome-RNA(rRNA) 30 after 1 hour again, after 1M HCl termination reaction, add 1M NaOH and regulate PH.Go up subsequently HPLC, detect the 280nm absorbancy and change.As standard substance, is X-coordinate with the standard substance applied sample amount with commercialization Adenine (Sigma), and the HPLC 280nm mAU*min of place value is done typical curve for ordinate zou.The result sees Figure 15,16.The typical curve that Figure 15 does for standard substance, visible increase along with standard substance dosage, detected value increases, and both are good linear relationship.Figure 16 is an experimental group, and visible RTA can make substrate rrna depurination and then cause protein synthesis obstacle (embodiment 5-experimental example 2), and no matter adding 6C2 still is the depurination activity that 13G6 all can suppress RTA.This result and then prompting, epi-position that 6C2 discerns possibly be the new functional epitope of not reporting.
Claims (9)
1. the functional epitope EXITH of a Ricin, wherein X can be arbitrary amino acid.
2. the functional epitope YYYS of a Ricin.
3. the monoclonal antibody of an antiricin A chain combines with the described functional epitope specificity of claim 1.
4. the monoclonal antibody of an antiricin A chain combines with the described functional epitope specificity of claim 2.
5. the monoclonal antibody of the described antiricin A of claim 3 chain; Be 6C2, its weight chain variable region amino acid sequence is SEQ ID NO:2, and the light chain variable region amino acid sequence is SEQ ID NO:4; CH is mouse IgG1, and constant region of light chain is a mouse k chain.
6. the monoclonal antibody of the described antiricin A of claim 4 chain; Be 13G6, its weight chain variable region amino acid sequence is SEQ ID NO:6, and the light chain variable region amino acid sequence is SEQ ID NO:8; CH is mouse IgG1, and constant region of light chain is a mouse k chain.
7. the nucleotide sequence of the monoclonal antibody 6C2 of coding claim 5 described antiricin A chain; Wherein the nucleotides sequence of encoding heavy chain variable region is classified SEQ ID NO:1 as; The nucleotides sequence of encoded light chain variable region is classified SEQ ID NO:3 as; The nucleotides sequence of encoding heavy chain constant region is classified SEQ ID NO:9 as, and the nucleotides sequence of coding constant region of light chain is classified SEQ ID NO:10 as.
8. the nucleotide sequence of the monoclonal antibody 13G6 of coding claim 6 described antiricin A chain; Wherein the nucleotides sequence of encoding heavy chain variable region is classified SEQ ID NO:5 as; The nucleotides sequence of encoded light chain variable region is classified SEQ ID NO:7 as; The nucleotides sequence of encoding heavy chain constant region is classified SEQ ID NO:9 as, and the nucleotides sequence of coding constant region of light chain is classified SEQ ID NO:10 as.
9. the purposes in the Ricin poisoning medicine is prevented or treated to the monoclonal antibody of the arbitrary described antiricin A chain of claim 3～6 in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100426053A CN102643329A (en) | 2011-02-22 | 2011-02-22 | Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100426053A CN102643329A (en) | 2011-02-22 | 2011-02-22 | Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102643329A true CN102643329A (en) | 2012-08-22 |
Family
ID=46656434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100426053A Pending CN102643329A (en) | 2011-02-22 | 2011-02-22 | Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102643329A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114560933A (en) * | 2022-01-25 | 2022-05-31 | 北京弘进久安生物科技有限公司 | Monoclonal antibody specifically binding to ricin and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010006601A1 (en) * | 2008-06-30 | 2010-01-21 | Dako Denmark A/S | Pax 5 monoclonal antibody |
-
2011
- 2011-02-22 CN CN2011100426053A patent/CN102643329A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010006601A1 (en) * | 2008-06-30 | 2010-01-21 | Dako Denmark A/S | Pax 5 monoclonal antibody |
Non-Patent Citations (2)
| Title |
|---|
| JIANXING DAI ET AL: "Identification of a Novel Functional Domain of Ricin Responsible for Its Potent Toxicity", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》, vol. 286, no. 14, 8 February 2011 (2011-02-08), pages 12166 - 12171 * |
| LORI M. NEAL ET AL: "A Monoclonal Immunoglobulin G Antibody Directed against an Immunodominant Linear Epitope on the Ricin A Chain Confers Systemic and Mucosal Immunity to Ricin", 《INFECTION AND IMMUNITY》, vol. 78, no. 1, 26 October 2009 (2009-10-26), pages 552 - 561 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114560933A (en) * | 2022-01-25 | 2022-05-31 | 北京弘进久安生物科技有限公司 | Monoclonal antibody specifically binding to ricin and application thereof |
| CN114560933B (en) * | 2022-01-25 | 2023-01-31 | 北京弘进久安生物科技有限公司 | Monoclonal antibody specifically binding to ricin and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vitenshtein et al. | NK cell recognition of Candida glabrata through binding of NKp46 and NCR1 to fungal ligands Epa1, Epa6, and Epa7 | |
| US10766950B2 (en) | Methods, compositions and kits for treating a subject using a recombinant neutralizing binding protein | |
| CN106459187A (en) | Compositions and methods for phagocyte delivery of anti-staphylococcal agents | |
| US20140294826A1 (en) | Methods and compositions with a recombinant neutralizing binding protein for treating toxin exposure | |
| US20220251226A1 (en) | Anti-bcma single domain antibodies and application thereof | |
| Wang et al. | Screening for a single-chain variable-fragment antibody that can effectively neutralize the cytotoxicity of the Vibrio parahaemolyticus thermolabile hemolysin | |
| US8173774B2 (en) | Polypeptides and use thereof | |
| CN109384844A (en) | A kind of anti-Staphylococcus aureus α hemolysin monoclonal antibody and application | |
| EP3972996A1 (en) | Antibodies against disease causing agents of poultry and uses thereof | |
| CN116693673A (en) | Broad-spectrum nano antibody for resisting SARS and SARS-CoV-2, multivalent nano antibody and application thereof | |
| CN102643329A (en) | Functional epitopes of ricin, monoclonal antibodies specifically bound with functional epitopes and use thereof in preparation of medicaments for preventing or treating ricin poisoning | |
| US8507655B2 (en) | Antibody against anthrax toxins | |
| CN112812189B (en) | Nano antibody for resisting glycosyltransferase A subunit and application thereof | |
| US11891433B2 (en) | Camelidae single-domain antibodies against Yersinia pestis and methods of use | |
| US20220226430A1 (en) | Protein inhibitors of clostridium difficile toxin b | |
| Park et al. | Screening for peptides binding on Phytophthora capsici extracts by phage display | |
| US9562080B2 (en) | Lyme disease vaccine, genetic construct, recombinant protein, method for designing genetic construct, method for producing vaccine, method for producing recombinant proteins, use of recombinant proteins in the production of lyme disease vaccine | |
| CN103319593B (en) | Anti StxII monoclonal antibody | |
| CN103509086B (en) | The functional epitope of botulinum toxin, the monoclonal antibody and its application specifically bound with it | |
| Yang et al. | Isolation, expression and characterization of two single-chain variable fragment antibodies against an endo-polygalacturonase secreted by Sclerotinia sclerotiorum | |
| CN102741281A (en) | Monoclonal antibodies against the pbp2-a protein and homologous sequences for the treatment of infections by and immunodiagnostics of bacteria of the firmicutes phylum | |
| CN108699551A (en) | Polypeptide libraries | |
| CN102391364B (en) | New antibacterial peptides as well as preparation method and application of the same | |
| McCluskey | Shiga-like Toxin 1: Molecular Mechanism of Toxicity and Discovery of Inhibitors | |
| CN102391365B (en) | A group of new antibiotic peptides, preparation method thereof and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120822 |