CN102641499A - Construction and application of recombinant Peste des petits ruminants virus (PPRV) live vector vaccine for foot and mouth disease virus (FMDV) VP1 gene - Google Patents

Abstract

The invention relates to a recombinant Peste des petits ruminants virus (PPRV) live vector vaccine for expressing a foot and mouth disease virus (FMDV) VP1 gene. The invention also discloses a method for preparing the recombinant PPRV vaccine and application of the PPRV vaccine in preparation of a vaccine for preventing Peste des petits ruminants and/or foot and mouth diseases.

Description

Foot and mouth disease virus VP1 gene recombinaton PPR virus live vector vaccine makes up and uses

Technical field

The present invention relates to recombinant viral vaccine field, more specifically, the present invention relates to the reorganization PPR virus vaccine of a kind of expression foot and mouth disease virus VP1 gene (coding VP1 albumen).The invention also discloses the method and the application of this reorganization PPR virus vaccine in the vaccine of preparation prevention PPR and/or foot and mouth disease of the said reorganization PPR virus vaccine of preparation.

Background technology

PPR (Peste des petits ruminants; PPR) be by PPR virus (Peste des petits ruminants virus; PPRV) a kind of height contagious infection property disease [1] that causes (referring to the civilian list of references tabulation in back); Serious harm goat, sheep and wildly ruminate beast animals such as [2] for a short time, even once caused Babalus bubalis L. morbidity [3].

The fatality rate of PPRV is 70-80%, divides apoplexy due to endogenous wind at new OIE, classified as important economic animal disease, and epidemic situation must be circulated a notice of OIE.PPR for a long time always in Africa, the Middle East, the Central Asia, South Asia and south east asia harm Pakistan [4], Tajikistan [5] popular and that China western part borders on all had popular outburst in recent years.PPRV imported the western border area of China in 2007, caused local epidemic situation, to the livestock breeding industry formation serious threat of China.The number of animals raised of China goat and sheep is hundreds of millions of; But for the anti-control techniques of PPR with lack experience; STUDY ON PATHOGEN and technological reserve lack; Brought great difficulty and challenge for the prevention and control of the PPRV of China, press for us and firmly grasp researchs such as the research and development of PPRV vaccine, diagnostic techniques, monitoring, mechanism of causing a disease, wherein the vaccine research and development are most important things.

PPRV belongs to Paramyxoviridae (Paramyxoviridae) Morbillivirus (Morbillivirus) member, and (Rinderpest virus RPV) belongs to together, and genome evolution and antigenic Relationship are close, has common neutralizing antibody epi-position with rinderpest virus.PPRV is the negative strand RNA viruses of strand, by 15948 base compositions, non-segmented negative.Mainly contain 6 kinds of structural protein in the virion, i.e. nucleoprotein (N), phosphoprotein (P), stromatin (M), fusion rotein (F), hemagglutinin (H) and polymerase large protein (L).The F and the H albumen on virus envelope surface are the main immunogens that PPRV induces neutralizing antibody to form, and N albumen is not induced neutralizing antibody, but has good immunogenicity, is diagnostic major antigen [6-8].

The vaccine that uses the earliest to PPR is viral disease poison (Rinderpest Virus a little less than the Cattle plague; RPV); Though immunoprotection can be provided, can not produce the neutralizing antibody [9] of PPRV, the back is caused weak PPRV attenuated vaccine strain (Nigeria75/1) and is substituted through the Vero passage; The latter can produce the neutralizing antibody of higher PPRV, and strong immune protective efficiency is provided.

Gene recombinaton to the goat capripoxvirus genome of PPRV immunoprotection antigen (H and F albumen), then be built into PPRV reorganization goat capripoxvirus vaccine [10-13].With PPRV reorganization goat capripoxvirus immune goat; Enough strong malicious attacks [10-13] of immunoprotection opposing PPRV not only can be provided; But also can utilize PPRV N albumen as antigen, and divide immunoinfective and natural infection at an easy rate, do not influence the serology monitoring.This research department adopts the goat capripoxvirus vaccine strain of isolated in China, has been built into PPRV H and F gene recombinaton goat capripoxvirus vaccine respectively, and vaccine is prevented goatpox and two kinds of diseases of PPRV, for the prevention and control of the PPR of China provide a kind of important selection [12,13].But the PPRV recombinant poxvirus vaccine is owing to adopt intradermal injection and twice immune programme for children [12,13], and labor intensity is big, is the big shortcoming of one of which.

Foot and mouth disease (foot and mouth disease; FMD) be by foot and mouth disease virus (foot and mouth disease virus; FMDV) artiodactylous a kind of acute, hot, the height contact infectious diseases common to human beings and animals that cause, OIE (OIE) classifies it as must report disease.This disease route of transmission is many, and spread speed is fast, worldwide once repeatedly takes place popularly, has caused serious economy loss to various countries.

Foot and mouth disease virus (Foot and mouth disease virus; FMDV) belong to the member of Picornaviridae (Picornaviridae) Hostis (Aphthovirus); Total A, O, C, Asia 1, SAT1, SAT2 and SAT37 serotype; Can not produce cross protection between type and the type, and can't distinguish the serotype of FMDV on the clinical symptoms, this brings difficulty for vaccine immunity, diagnosis and prevention and control.The FMDV genome is the sub-thread positive chain RNA, and 8.5kb is arranged approximately.Genomic middle part is a big ORFs (ORF), the polyprotein of coding virus, and this polyprotein forms L leader protein, P1 plot structure albumen, P2 district and P3 district non-structural protein after cracking.The final maturation of FMDV P1 plot structure albumen is cracked into 4 kinds of structural protein VP1, VP2, VP3 and VP4, and these 4 kinds of structural protein have constituted the FMDV capsid, and its epitope (antigenic epitope) multidigit is determining the antigenicity of virus on capsid protein.

The research in P1 district is carried out immunology research to grasping FMDV biological characteristics and proliferation mechanism, Research on Diagnosis, and the new generation vaccine exploitation all has important function.The about 2208bp in P1 district, 85,218,220,213 the amino acid whose structural polypeptides of encoding successively form 1A (VP4), 1B (VP2), 1C (VP3) and 4 kinds of structural protein of 1D (VP1) successively.4 kinds of structural protein finally form pentamer unit and constitute viral capsid proteins.VP1 is the only most important structural protein that can produce neutralizing antibody in the foot and mouth disease virus, and it is exposed to the surface of virion with the form of projection, in immunity, is bringing into play main effect.

The reverse genetic manipulation technology of minus-stranded rna virus is increasingly mature; The new way of marker vaccine exploitation is provided; Like vesicular stomatitis virus (vesicular stomatitis virus; VSV) [14-16], Measles virus (measles virus) [17], rabies virus (rabies virus) [18], respiratory syncytial virus (respiratory syncytial virus, RSV) [19] and NDV (Newcastle disease virus, NDV) [20] etc.

Be the combination that the recombinant vaccine of carrier can be regarded as attenuated live vaccine and sub-unit protein vaccine with virus, it both can avoid subunit vaccine to need the adjuvant and the shortcoming of vaccinal injection repeatedly, can induce comprehensive and persistent immunoreation again.The viral vector that can be used as attenuated live vaccine has poxvirus, adenovirus, baculovirus, poliovirus and Pseudorabies virus etc.The carrier that has been used at present the FMD vaccine research mainly contains poxvirus [21], adenovirus [22], Pseudorabies virus [23,24] and rinderpest virus [25] etc.Do not use the report of PPRV but have as carrier.Because PPRV and FMDV are the huge deadly infectious diseases of harm to goat and sheep; Can prevent two kinds of diseases simultaneously if can develop recombinant virus; Will more help the prevention and control of two kinds of diseases so, and practice thrift the prevention and control cost, have huge social benefit and economic benefit.

Summary of the invention

To above-mentioned research background; The PPRV reverse genetic manipulation technology platform (patent applied for that the inventor is setting up; One Chinese patent application number: 201010559545.8) on the basis, the proteic PPRV recombinant virus of external rescue reorganization FMDV VP1, and study its immune efficacy.

Therefore, an object of the present invention is to provide a kind of reorganization PPR virus vaccine of expressing foot and mouth disease virus VP1 gene, the aminoacid sequence of wherein said foot and mouth disease virus VP1 gene code is shown in SEQ ID No.1.

In one embodiment, the nucleotide sequence of said foot and mouth disease virus VP1 gene is shown in SEQ ID No.2.

In another embodiment, the PPR virus vaccine that is used to express foot and mouth disease virus VP1 gene is PPRV Nigeria75/1 (PPRV/N75/1).

In another embodiment, said foot and mouth disease virus VP1 gene be positioned at said PPR virus vaccine coding phosphor albumen (P) gene and the coding stromatin (M) gene between.

In another embodiment, described reorganization PPR virus vaccine its be rPPRV/101VP1.

A further object of the invention provides the application of reorganization PPR virus vaccine according to the present invention in the vaccine of preparation prevention PPR and/or foot and mouth disease (preferred Aisa 1 type).

A further object of the invention provides the method for a kind of production according to reorganization PPR virus vaccine of the present invention, and this method comprises:

(1) structure is transcribed plasmid, and this transcribes the genome full length cDNA sequence that plasmid comprises the PPR virus vaccine that wherein inserts foot and mouth disease virus VP1 gene;

(2) make up one or more helper plasmids of transcribing, said helper plasmid can be expressed nucleoprotein (N), phosphoprotein (P) and the polymerase large protein (L) of said PPR virus respectively;

(3) with said plasmid and the host cell of transcribing helper plasmid cotransfection PPR virus vaccine copy permission of transcribing; Host cell after the cultivation transfection, the host cell of preferred said PPR virus vaccine copy permission is bhk cell or Vero cell; With

(4) rescue reorganization PPR virus from the cell suspension of transfectional cell.

In one embodiment, the said plasmid of transcribing is pCI-PPRV/101VP1.

In another embodiment, the said helper plasmid of transcribing is respectively plasmid pCI-N, pCI-P and pCI-L.

A further object of the invention provides prepared according to the methods of the invention reorganization PPR virus vaccine, is preferably rPPRV/101VP1.

The present invention is with respect to the innovative point of prior art:

The reorganization PPRV (rPPRV/101VP1) of expression FMDV (the Aisa 1 type) VP1 that the present invention makes up compares with traditional foot-and-mouth disease vaccine has many creativeness and superiority.

The foot and mouth disease of the existing use of China (FMD) inactivated vaccine is one type of vaccine that foot and mouth disease virus (FMDV) antigen with deactivation is the basis; Promptly representing strain through the foot and mouth disease hypotype of current popular is the vaccine seed culture of viruses; Behind a large amount of enrichment cultures; Use suitable inactivator inactivation treatment, and add oily adjuvant formulated vaccine.Inactivated vaccine plays an important role to the prevention and control of the present foot and mouth disease of China, still is widely used, but also has many problems.At first, what inactivated vaccine used is virulent strain, has very big bio-safety harm aborning, in inactivation process, has the halfway situation of deactivation, and the poison that in use can loose then causes the popular of disease on the contrary; And rPPRV/101VP1 does not have the biological safety problem fully, and its carrier is an attenuated vaccine, in the use of decades, confirms the safety of this attenuated vaccine, does not need deactivation, can not have the situation of the poison that looses in the use.Secondly, during inactivated vaccine uses, can cause distinguish nature wild virus infection and vaccine immunity, cause to carry out necessary serology monitoring; And rPPRV/101VP1 is owing to only expressed the VP1 gene; Other structural protein that therefore can use FMDV are as detecting antigen; Can distinguish natural wild virus infection and the vaccine immunity of FMDV, greatly facilitate the serology monitoring, help realizing FMDV elimination plan in the world.The 3rd, inactivated vaccine is because the antigen amount is big, and composition is more complicated; And added adjuvant, and animal there is big toxicity, therefore can cause side effect such as anaphylaxis; Influence immune effect on the contrary, present production technology is carried out concentrated and purified to antigen, but this has increased production cost again greatly; And rPPRV/101VP1 is an attenuated vaccine, does not need adjuvant, and composition is simple, almost have no side effect, and production cost is lower, and production technology is simple, generally need not purification.The 4th, inactivated vaccine is owing to added adjuvant, instability under the long term storage condition; And the rPPRV/101VP1 attenuated vaccine is highly stable after lyophilizing, is beneficial to storage and transport.The 5th, inactivated vaccine can only keep about 6 months short-term immunity with can not stimulate cellullar immunologic response efficiently, and since inactivated vaccine after deactivation, antigenicity changes, different with native state, this has also influenced its immunogenicity; And the rPPRV/101VP1 attenuated vaccine be owing to can duplicate in animal body, therefore can the irritation cell immunity, can keep long duration of immunity, and its expression is natural VP1 albumen, and immunogenicity does not have change basically.To sum up, the rPPRV/101VP1 attenuated vaccine of this structure is compared with traditional vaccine in many aspects has very strong novelty and superiority, has stronger use value, has a good application prospect.

Description of drawings

Fig. 1. insert the structure sketch map of the PPR virus genome cDNA of FMDV VP1.The reorganization PPRV genome cDNA clone construction strategy that contains the VP1 gene: the sequence C TT that wherein capitalizes overstriking is a trinucleotide between gene; " runic lower case " sequence is the kozak sequence, and " underlined capitalization " sequence is a Not I restriction enzyme site, and " tilted capital letter sequence " is Pme I restriction enzyme site;

Fig. 2. indirect immunofluorescence and Western blot detect rPPRV/101VP1 and express FMDV VP1 albumen wtPPRV/N75/1 and rPPRV/101VP1 difference vero cells infection.(I) be one anti-with the hyper-immune serum [28] of mouse-anti PPRV totivirus hyper-immune serum [12] and FMDV VP1 prokaryotic expression protein immune rabbit preparation respectively; The mouse-anti rabbit igg of the rabbit anti-mouse igg of plain (TRITC) labelling of red fluorescence and plain (FITC) labelling of green fluorescence is two anti-, carries out the immunofluorescence detection.Establish the blank of uninfecting virus Vero cell simultaneously.(II) treat that Vero cell CPE reaches 60%～80% o'clock harvesting; Hyper-immune serum [28] with the preparation of FMDVVP1 prokaryotic expression protein immune rabbit is that a goat anti-rabbit igg anti-, horseradish peroxidase-labeled is that the two anti-Western blot that carry out test respectively, establishes the blank of uninfecting virus Vero cell simultaneously;

Fig. 3 .wtPPRV/N75/1 and the rPPRV/101VP1 growth kinetics curve on the Vero cell;

The FMDV neutralizing antibody detects after the goat immunity of Fig. 4 .rPPRV/101VP1.WtPPRV/N75/1 (361,28,32, No. 35 sheep), rPPRV/101VP1 (18,20,22,25,26, No. 29 sheep) are pressed 6 * 10 ⁶TCID ₅₀/ dosage immune goat only, the immunity back is the cervical region blood sampling in the time of the 14th, 21,28 and 40 day, and separation of serum carries out the FMDV neutralizing antibody and measures.With GraphPad Prism software both are carried out 2way ANOVA and analyze, result difference is (P＜0.01) significantly;

Temperature check behind Fig. 5 .FMDV challenge test.With GraphPad Prism software the body temperature of immune group and matched group is carried out 2way ANOVA and analyze, both differences are significantly (P＞0.05) not;

Clinical symptoms scoring behind Fig. 6 .FMDV challenge test.Adopt the t check immune group and matched group to be analyzed both significant differences (P＜0.01);

Fig. 7 .pCI-PPRV plasmid sequence (specifically making up) (from 5 ' hold 3 ' end) referring to one Chinese patent application No.201010559545.8 description embodiment 1; Wherein 1096-1153 is the HamRz sequence; 1154-17101 is the PPRV/N75/1 genome sequence, and 17102-17192 is the HdvRz sequence;

Fig. 8. the sketch map of plasmid pCI-PPRV and plasmid pCI-PPRV/101EGFP (specifically making up) referring to one Chinese patent application No.201010559545.8 description embodiment 1.Plasmid pCI-PPRV/101EGFP inserts following sequence (from 5 ' hold 3 ' end) and obtains between 4558 and the 4559nt in plasmid pCI-PPRV sequence:

aggagcaagggcaactgagcttcacagacaaggcggccgcgccgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaagtttaaaccacatcctataatcaacatctcatactcggttgaaaacatcctctcaatcaggctattacaaaaaactt

Wherein: 1-32 be genetic transcription signal homing sequence (gene-start, GS); 33-40 is Not I site; 41-49 is the Kozak sequence; 50-769 is the EGFP sequence; 770-777 is Pme I site; 778-843 be genetic transcription signal terminating sequence (gene-end, GE); 844-846 is a gene trinucleotide at interval;

Fig. 9 .pCI-PPRV/101VP1 plasmid sequence.This plasmid is to insert following sequence (from 5 ' hold 3 ' end) (SEQ IDNo.3) between 4558 and the 4559nt in plasmid pCI-PPRV sequence and obtain:

AGGAGCAAGGGCAACTGAGCTTCACAGACAAGGCGGCCGCGCCGCCACCATGactaccaccactggcgagtccgcggacccagtcaccaccacggttgagaactacggaggagagacccagacggcccgacggcttcacactgatgtcgccttcgttctcgacaggttcgtgaaactcacccagcccaagagcacccaaacccttgatctcatgcagatcccctcacacacactggtcggggcgcttctccggtctgcgacgtactacttctcagacctggaggttgcgctcgtccacacaggaccggtcacgtgggtgcccaatggtgcgcctaagaccgccttgaacaaccacaccaacccgactgcctaccagaagcagcctatcacccgcttggcactcccctacaccgctccccaccgtgtgctgtcaacagtgtacaacgggaagacaacgtacggagaagaatcctcgcggcgtggtgatcttgccgccctcgcacgcagagtgagcaaccggctgcccacttccttcaactacggcgctgtgaaggccgacaccatcacggagctgttgatccgcatgaagcgtgcggaaacatactgccccaggcccttgctggctcttgacaccacacaagaccgccgtaaacaggagatcattgcacctgagaaacagTAAGTTTAAACCACATCCTATAATCAACATCTCATACTCGGTTGAAAACATCCTCTCAATCAGGCTATTACAAAAAACTT

Wherein: 1-32 is GS; 33-40 is Not I site; 41-49 is the Kozak sequence; 50-682 is the VP1 gene order; 683-690 is Pme I site; 691-756 is the GE sequence; 757-759 is a gene trinucleotide at interval.

Figure 10 .pCI-N plasmid sequence (from 5 ' hold 3 ' end), wherein 1069-1077 is the kozak sequence; 1078-2655 is the PPRVN protein gene sequence;

Figure 11 .pCI-P plasmid sequence (from 5 ' hold 3 ' end), wherein 1092-1100 is the kozak sequence; 1101-2630 is the PPRVP protein gene sequence; With

Figure 12 .pCI-L plasmid sequence (from 5 ' hold 3 ' end), wherein 1093-1101 is the kozak sequence; 1102-7653 is the PPRVL protein gene sequence.

PCI-N, pCI-P and pCI-L plasmid sequence also can be referring to the Figure of description 9-11 of one Chinese patent application No.201010559545.8.

The specific embodiment

Hereinafter is described the reference implementation example in detail the present invention, and said embodiment only is intended as illustrative explanation the present invention, rather than intention restriction scope of the present invention.Scope of the present invention is specifically limited accompanying Claim.

Embodiment 1 expresses the structure of the reorganization PPR virus vaccine of foot and mouth disease virus VP1 gene

1 materials and methods

1.1 material

PPRV Nigeria75/1 (PPRV/N75/1) vaccine strain is available from China Veterinary Drugs Supervisory Inst., and foot and mouth disease virulent strain (Asia-1/JSL/GSZY/06 strain) is available from biological pharmaceutical factory, the Zhongmu Industry Co.,Ltd Baoshan; BHK-21 cell (ATCC No.CCL-10) and Vero cell (ATCC No.CCL-81) are preserved by Harbin Veterinary Medicine Inst., China Academy of Agriculture Amphixenosis research department, and culture fluid is the DMEM that contains 10% hyclone; Plasmid pCI is available from Promega; Plasmid pBluescript and pIRES-EGFP are available from Clontech; PrimeSTAR HS archaeal dna polymerase, T4DNA connection do not reach other restricted enzyme all available from TaKaRa company; RNA extracts reagent Trizol, Mus source reverse transcription (MLV), hyclone, DMEM and calcium phosphate transfection test kit (Calcium phosphate Transfection Kit) available from Invitrogen; Albumen dyes marker in advance available from MBI company; Mouse-anti PPRV totivirus hyper-immune serum is by Harbin Veterinary Medicine Inst., China Academy of Agriculture Amphixenosis research department preparation [12]; The anti-Mus two goat-anti rabbits two anti-, horseradish peroxidase-labeled of the rabbit of plain (TRITC) labelling of red fluorescence are anti-available from Sigma company; The fluorescence inverted microscope is available from Zeiss company; The malicious valency of foot and mouth disease virulent strain (Asia-1/JSL/GSZY/06 strain) (goat ID 50, median infective dose, GID ₅₀) on goat, measure.

1.2 express the structure of the reorganization PPRV genome full length cDNA clone of FMDV VP1

According to the synthetic VP1 gene of the VP1 sequence (GenBank accession No.GU931682) of FMDV Aisa 1 vaccine strain; (" _ " is Not I restriction enzyme site at 5 ' end calling sequence

simultaneously;

is the kozak sequence;

is start codon), (

is termination codon at 3 ' end calling sequence

; " _ " is 3 codons of extra adding, guarantees that full cDNA infection clones sequence length can be divided exactly by 6;

is Pme I restriction enzyme site).

Referring to Fig. 1; With among the pCI-PPRV/101EGFP of the VP1 fragment cloning of Not I and Pme I double digestion to same double digestion (construction method of this plasmid one Chinese patent application that reference has been submitted to sketch map number 201010559545.8 description embodiment 1); Obtain plasmid pCI-PPRV/101VP1; Wherein the sequence length sequence between HamRz and the HdvRz meets " 6 base principle " [26,27].

1.3 the rescue and the amplification of virus

The BHK-21 cell inoculation is in 35mm six orifice plates; When waiting to grow to 50%～80% monolayer; Adopt calcium phosphate transfection reagent (Invitrogen) with infective cloned plasmids (pCI-PPRV/101VP1) and helper plasmid pCI-N, pCI-P and pCI-L (construction method of these plasmids one Chinese patent application that reference has been submitted to sketch map number 201010559545.8 description embodiment 1) respectively with the amount cotransfection BHK-21 cell of 5 μ g, 2.5 μ g, 1.25 μ g and 1.25 μ g, 5%CO ₂, 37 ℃ of cultivations, concrete operations are undertaken by the test kit description.After the transfection 8～12 hours, discard transfection mixture, the PBS solution shock cell 2.5min with containing 10%DMSO adds complete DMEM culture fluid and continues at 5%CO ₂, 37 ℃ of cultivations; After 3 days cell is scraped off, after twice of the cell suspension freeze thawing, get the monolayer Vero cell that 300 μ L are inoculated in grow overnight, density about 70%, sense makes to add after 1 hour the DMEM that contains 5% hyclone, 5%CO ₂, 37 ℃ cultivated 6-10 days, microscopically observation of cell pathological changes (cytopathic effect, CPE) or fluorescence; When waiting CPE to occur, the harvesting suspension is stored in-70 ℃ as kind of a poison.Rescue and obtain the recombinant virus called after rPPRV/101VP1 that expresses VP1.

1.4 detecting, indirect immunofluorescence rescues the virus that obtains

The Vero cell inoculation when waiting to grow to 70%～80% monolayer, (is parent's wild type PPRV, PPRV/N75/1) and rPPRV/101VP1 by MOI 0.1 inoculation wtPPRV/N75/1 respectively in 24 orifice plates; After 4 days, PBS washed cell 2 times, 3% paraformaldehyde room temperature is 30min fixedly.Be one anti-with the mouse-anti PPRV totivirus hyper-immune serum [12] of 1: 50 times of dilution with the hyper-immune serum [28] of the FMDV VP1 prokaryotic expression protein immune rabbit preparation of 1: 200 times of dilution respectively, effect 30min.The mouse-anti rabbit igg that PBST washing back adds rabbit anti-mouse igg and 1: 64 times of plain (FITC) labelling of dilution green fluorescence of 1: 200 times of plain (TRITC) labelling of dilution red fluorescence is two anti-; Effect 30min, PBST washing back is with fluorescence inverted microscope (Zeiss) observed result.

1.5Western blot detects rPPRV/101VP1 and expresses FMDV VP1 albumen

The Vero cell inoculation when waiting to grow to 70%～80% monolayer, is pressed MOI 0.1 inoculation wtPPRV/N75/1 and rPPRV/101VP1 respectively in 6 orifice plates; Treat that CPE reaches 60%～80% o'clock harvesting, cell sample is used for Western blot to be analyzed, and is one anti-with the hyper-immune serum [28] of FMDV VP1 prokaryotic expression protein immune rabbit preparation respectively, is two anti-with the goat anti-rabbit igg of horseradish peroxidase-labeled.

2 results

2.1 indirect immunofluorescence and Western blot detect expression of recombinant virus VP1 albumen

Referring to Fig. 2; Indirect immunofluorescence is the result show, under the green fluorescence pattern, (detects the expression of VP1 with the anti-VP1 multi-resistance of rabbit), and wtPPRV/N75/1 shows the negative (Fig. 2 of green fluorescence signal; (I) E); And rPPRV/101VP1 shows green fluorescence signal positive (Fig. 2, (I) D), rPPRV/101VP1 successful expression FMDV VP1; Under the red fluorescence pattern, (detect PPRV with mouse-anti PPRV totivirus totivirus hyper-immune serum), wtPPRV/N75/1 (Fig. 2, (I) B) and rPPRV/101VP1 (Fig. 2, (I) A) all show positive red fluorescence signal.While blank redfree and green fluorescence signal.The result shows, through the reverse genetic manipulation technology, utilizes PPRV/N75/1 vaccine strain genome cDNA clone, successfully rescues to obtain to have infective wild type PPRV vaccine strain rPPRV/101VP1.Simultaneously, Western blot result (Fig. 2, (II)) shows, the rPPRV/101VP1 successful expression FMDV VP1 albumen [29] of about 30KDa, and wtPPRV/N75/1 does not express this albumen, blank does not have positive band yet.Above result shows that rPPRV/101VP1 can correctly express FMDV VP1 albumen.

Embodiment 2 recombinant viruses and the parental virus strain growth kinetics characteristic on the Vero cell relatively

With wtPPRV/N75/1 and rPPRV/101VP1 respectively by MOI be 0.01 be inoculated in grow overnight, density is about 70%～80% monolayer Vero cell, after 1h is made in 37 ℃ of senses, adds the DMEM complete culture solution that contains 2% hyclone, in 5%CO ₂, 37 ℃ of cultivations.Respectively at infecting 3,4,5,6, the 7 and 8 days results virus in back, after the freeze thawing 2 times, virus is done 10 times of gradient dilutions, on the Vero cell in 96 orifice plates titration TCID ₅₀(50tissue infection dose) infects the back and under the fluorescence inverted microscope, observed CPE or fluorescence on the 14th day, calculates viral malicious valency (TCID ₅₀), estimate the growth kinetics characteristics of each virus on the Vero cell.

WtPPRV/N75/1 and the rPPRV/101VP1 kinetics growth curve on the Vero cell is as shown in Figure 3, and the kinetics growth curve of two strain virus is similar, and the insertion that shows exogenous gene does not have influence basically for the growth of virus.

Test of embodiment 3 animal immunes and challenge test

1. method

1.1 animal immune test

Choose the healthy goat of 10 foot and mouth disease virus negative antibodies (the virus neutralization tests antibody titer was less than 1: 4) and PPRV negative antibody (the virus neutralization tests antibody titer was less than 1: 5), wherein 6 in both sides musculi colli immunity inoculation 2ml/ capitulum suspension (6 * 10 ⁶TCID ₅₀/ only) inoculation back take temperature every day (every used thermometer can not intersect uses) was to immune back 10 days, and the clinical symptoms of observing whole duration of immunity sheep body.Other 4 immune wtPPRV/N75/1 (6 * 10 ⁶TCID ₅₀/ only), contrast as the FMDV counteracting toxic substances.The immunity back is the cervical region blood sampling in the time of the 14th, 21,28 and 40 day, and separation of serum is used for PPRV and the FMDV neutralizing antibody is measured, after all samples is gathered, and-20 ℃ of preservations.PPRV and FMDV NAT detection method are carried out (World Organisation for Animal Health.Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 2004) by the O.I.E. recommend method.If value for antibody was tired less than 1: 5 and is designated as 2.5.

1.2 animal challenge test

After immunity, the 40th day the time, use foot and mouth disease virulent strain (Asia-1/JSL/GSZY/06 strain) to attack, dividing 2 the above-mentioned foot and mouth disease virulent strain of inoculation 0.2ml liquid at Yangshe's Intradermal (is 100GID ₅₀/ only), inoculation back 1～10 day, take temperature every day (every used thermometer can not intersect uses) and observation clinical symptoms (according to the clinical symptoms evaluation of scoring).

Clinical symptoms score standard is (final result is pressed the 10th day symptom evaluation) as follows:

0 minute---any blister or ulcer symptom do not appear;

1 minute---only blister or ulcer symptom appear in inoculation position;

2 minutes---the blister or the ulcer symptom of a focus appears in one of lingual surface, asoscope or lip beyond the inoculation position;

3 minutes---one of lingual surface, asoscope or lip two or above focus occur or have a hoof blister or ulcer symptom to occur;

4 minutes---one of lingual surface, asoscope or lip locate to occur focus simultaneously a hoof focus appears, or two hoof and occur blister or ulcer symptom more than two hoof.

2. result

WtPPRV/N75/1, rPPRV/101VP1 are pressed 6 * 10 ⁶TCID ₅₀/ dosage immune goat only, 1～10 day body temperature in immunity back is normal, does not have obvious clinical symptoms, back 40 days of immunity, the PPRV NAT of immune group and matched group is all greater than 10 (data not shown); The antibody titer of FMDV is as shown in Figure 4; The FMDV virucidin of rPPRV/101VP1 immune group (18,20,22,25,26, No. 29 sheep) tire immunity after back 40 days all greater than 10; And the FMDV virucidin of wtPPRV/N75/1 matched group (361,28,32, No. 35 sheep) tires after after the immunity 14～40 days all less than 10; With GraphPad Prism software immune group and matched group are carried out the 2wayANOVA analysis; Both inductive FMDV neutralizing antibody level error heteropoles are (P＜0.01) significantly, shows that the rPPRV/101VP1 immune goat is induced to have produced sufficient neutralizing antibody.

1～10 day measurement of bldy temperature result is as shown in Figure 5 behind the counteracting toxic substances, and behind the counteracting toxic substances, body temperature raises to some extent, reduces to normal level after 6 days.With GraphPad Prism software immune group and matched group are carried out 2way ANOVA analysis, difference is remarkable (P＞0.05) not.

Behind the counteracting toxic substances the 10th day, immune group goat sheep had only 22, No. 26 blister or ulcer to occur at inoculation position, and ulcer all appears in all sheep of matched group in the lingual surface injection site, and wherein ulcer has also appearred in the lingual surface of 28,32, No. 35 sheep in non-injection site; In addition, ulcer on hoof, occurs 361 and No. 32, ulcer on gums, occurs No. 28; Appraisal result is seen Fig. 6; Adopt the t check that immune group and matched group are analyzed, both significant differences (P＜0.01) show that the rPPRV/101VP1 immune goat has produced sufficient protection and renderd a service.

On the basis of the anti-reverse genetic manipulation technology platform of the PPRV that this research is set up in front, worldwide successfully make up first and the external reorganization PPRV (rPPRV/101VP1) that saves out expression FMDV (Aisa 1 type) VP1.Identify that through immunofluorescence and western blot this recombinant virus can successful expression VP1 albumen.This recombinant virus immune goat can be induced significant FMDV neutralizing antibody, and the counteracting toxic substances protection to FMDV (Aisa 1 type) virulent strain can be provided.Utilize the reverse genetic technology, the NDV recombinant virus of the expression bird flu virus HA gene of structure has become the important a member [30] in the Chinese bird flu prevention and control vaccine system.Therefore the rPPRV/101VP1 of this research rescue can be used as vaccine, thereby provides PPRV and two kinds of immunoprotections that sheep is had the disease of significant damage of FMDV, will have remarkable economic efficiency and social benefit.

List of references

1.Gibbs，E.P.，et?al.，Classification?of?peste?des?petits?ruminants?virus?as?the?fourth?member?of?the?genus?Morbillivirus.Intervirology，1979.11(5)：p.268-74.

2.Furley，C.W.，W.P.Taylor，and?T.U.Obi，An?outbreak?of?peste?des?petits?ruminants?in?a?zoological?collection.Vet?Rec，1987.121(19)：p.443-7.

3.Govindarajan，R.，et?al.，Isolation?of?pestes?des?petits?ruminants?virus?from?an?outbreak?in?Indian?buffalo(Bubalus?bubalis).Vet?Rec，1997.141(22)：p.573-4.

4.Abubakar，M.，et?al.，Peste?des?Petits?Ruminants?Outbreak?in?Small?Ruminants?of?Northern?Areas?of?Pakistan.Research?Journal?of?Veterinary?Sciences，2008.1(1)：p.56-61.

5.Kwiatek，O.，et?al.，Peste?des?petits?ruminants(PPR)outbreak?in?Tajikistan.J?Comp?Pathol，2007.136(2-3)：p.111-9.

6.Libeau，G.，et?al.，Rapid?differential?diagnosis?of?rinderpest?and?peste?des?petits?ruminants?using?an?immunocapture?ELISA.Vet?Rec，1994.134(12)：p.300-4.

7.Libeau，G.，et?al.，Development?of?a?competitive?ELISA?for?detecting?antibodies?to?the?peste?des?petits?ruminants?virus?using?a?recombinant?nucleoprotein.Res?Vet?Sci，1995.58(1)：p.50-5.

8.Singh，R.P.，et?al.，A?sandwich-ELISA?for?the?diagnosis?of?Peste?des?petits?ruminants?(PPR)infection?in?small?ruminants?using?anti-nucleocapsid?protein?monoclonal?antibody.Arch?Virol，2004.149(11)：p.2155-70.

9.Taylor，W.P.，Protection?of?goats?against?peste-des-petits-ruminants?with?attenuated?rinderpest?virus.Res?Vet?Sci，1979.27(3)：p.321-4.

10.Berhe，G.，et?al.，Development?of?a?dual?recombinant?vaccine?to?protect?small?ruminants?against?peste-des-petits-ruminants?virus?and?capripoxvirus?infections.J?Virol，2003.77(2)：p.1571-7.

11.Diallo，A.，et?al.，Goat?immune?response?to?capripox?vaccine?expressing?the?hemagglutinin?protein?of?peste?des?petits?ruminants.Ann?N?Y?Acad?Sci，2002.969：p.88-91.

12. Albert Chan Wai-yip, et al. expresses the research of the proteic reorganization goat capripoxvirus of PPR H vaccine. biological engineering journal, 2009.25 (4): p.496-502.

13. bent woods is luxuriant, et al. expresses the research of the proteic reorganization goat capripoxvirus of PPR virus F vaccine. Chinese Preventive Veterinary Medicine newspaper, 2009.31 (6): p.415-420.

14.Schnell，M.J.，et?al.，Foreign?glycoproteins?expressed?from?recombinant?vesicular?stomatitis?viruses?are?incorporated?efficiently?into?virus?particles.Proc?Natl?Acad?Sci?U?S?A，1996.93(21)：p.11359-65.

15.Kretzschmar，E.，et?al.，High-efficiency?incorporation?of?functional?influenza?virus?glycoproteins?into?recombinant?vesicular?stomatitis?viruses.J?Virol，1997.71(8)：p.5982-9.

16.Roberts，A.，et?al.，Vaccination?with?a?recombinant?vesicular?stomatitis?virus?expressing?an?influenza?virus?hemagglutinin?provides?complete?protection?from?influenza?virus?challenge.J?Virol，1998.72(6)：p.4704-11.

17.Spielhofer，P.，et?al.，Chimeric?measles?viruses?with?a?foreign?envelope.J?Virol，1998.72(3)：p.2150-9.

18.Schnell，M.J.，T.Mebatsion，and?K.K.Conzelmann，Infectious?rabies?viruses?from?cloned?cDNA.EMBO?J，1994.13(18)：p.4195-203.

19.Radecke，F.，et?al.，Rescue?of?measles?viruses?from?cloned?DNA.EMBO?J，1995.14(23)：p.5773-84.

20.Peeters，B.P.，et?al.，Rescue?of?Newcastle?disease?virus?from?cloned?cDNA：evidence?that?cleavability?of?the?fusion?protein?is?a?major?determinant?for?virulence.J?Virol，1999.73(6)：p.5001-9.

21. Zheng Min, et al., the experimental study of foot and mouth disease virus recombinant Borrel virus live vector vaccine and dna vaccination immune cattle. journal of animal science and veterinary medicine, 2006.37 (2): p.158-62.

22. Lu Ceng Jun, foot-and-mouth disease virus gene recombinant adenovirus live vector vaccine research .2005, Beijing: graduate school of the Chinese Academy of Agricultural Sciences.

23.Li，X.，et?al.，Induction?of?protective?immunity?in?swine?by?immunization?with?live?attenuated?recombinant?pseudorabies?virus?expressing?the?capsid?precursor?encoding?regions?of?foot-and-mouth?disease?virus.Vaccine，2008.26(22)：p.2714-22.

24.Yao，Q.，et?al.，Comparison?of?immune?responses?to?different?foot-and-mouth?disease?genetieally?engineered?vaccines?in?guinea?pigs.J?Virol?Methods，2008.147(1)：p.143-50.

25.Baron，M.D.，et?al.，Expression?in?cattle?of?epitopes?of?a?heterologous?virus?using?a?recombinant?rinderpest?virus.J?Gen?Virol，1999.80(Pt?8)：p.2031-9.

26.Kolakofsky，D.，et?al.，Paramyxovirus?RNA?synthesis?and?the?requirement?for?hexamer?genome?length：the?rule?of?six?revisited.J?Virol，1998.72(2)：p.891-9.

27.Neumann，G.，M.A.Whitt，and?Y.Kawaoka，A?decade?after?the?generation?of?a?negative-sense?RNA?virus?from?cloned?cDNA-what?have?we?learned?J?Gen?Virol，2002.83(Pt?11)：p.2635-62.

28.ZHU，Y.-m.，et?al.，Expression?of?VP1?gene?of?foot-and-mouth?disease?virus?serotype?Asia?1?and?antiserum?preparation?CHINESE?JOURNAL?OF?PREVENTIVE?VETERINARY?MEDICINE，2010.32(4)：p.285-288

29.Li，Y.，et?al.，High?expression?of?foot-and-mouth?disease?virus?structural?protein?VP1in?tobacco?chloroplasts.Plant?Cell?Rep，2006.25(4)：p.329-33.

30.Ge，J.，et?al.，Newcastle?disease?virus-based?live?attenuated?vaccine?completely?protects?chickens?and?mice?from?lethal?challenge?of?homologous?and?heterologous?H5N1?avian?influenza?viruses.J?Virol，2007.81(1)：p.150-8.

Claims (10)

1. reorganization PPR virus vaccine of expressing foot and mouth disease virus VP1 gene, preferred said foot and mouth disease virus is Aisa 1 type, the aminoacid sequence of more preferably said foot and mouth disease virus VP1 gene code is shown in SEQ ID No.1.

2. reorganization PPR virus vaccine according to claim 1, the nucleotide sequence of wherein said foot and mouth disease virus VP1 gene is shown in SEQ ID No.2.

3. reorganization PPR virus vaccine according to claim 1, the PPR virus vaccine that wherein is used to express foot and mouth disease virus VP1 gene is PPRV Nigeria75/1 (PPRV/N75/1).

4. according to any one described reorganization PPR virus vaccine among the claim 1-3, wherein said foot and mouth disease virus VP1 gene is positioned between the gene of gene and coding stromatin (M) of coding phosphor albumen (P) of said PPR virus vaccine.

5. reorganization PPR virus vaccine according to claim 4, it is rPPRV/101VP1.

6. according to the application of any one described reorganization PPR virus vaccine among the claim 1-5 in the vaccine of preparation prevention PPR and/or foot and mouth disease.

7. method of producing according to any one described reorganization PPR virus vaccine among the claim 1-5, this method comprises:

(1) structure is transcribed plasmid, and this transcribes the genome full length cDNA sequence that plasmid comprises the PPR virus vaccine that wherein inserts foot and mouth disease virus VP1 gene;

(2) make up one or more helper plasmids of transcribing, said helper plasmid can be expressed nucleoprotein (N), phosphoprotein (P) and the polymerase large protein (L) of said PPR virus respectively;

(3) with said plasmid and the host cell of transcribing helper plasmid cotransfection PPR virus vaccine copy permission of transcribing; Host cell after the cultivation transfection, the host cell of preferred said PPR virus vaccine copy permission is bhk cell or Vero cell; With

(4) rescue reorganization PPR virus from the cell suspension of transfectional cell.

8. method according to claim 7, the wherein said plasmid of transcribing is pCI-PPRV/101VP1.

9. according to claim 7 or 8 described methods, the wherein said helper plasmid of transcribing is respectively plasmid pCI-N, pCI-P and pCI-L.

10. according to the reorganization PPR virus vaccine of the method preparation of any one among the claim 7-9, be preferably rPPRV/101VP1.

Images