CN102621133B - A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor - Google Patents
A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor Download PDFInfo
- Publication number
- CN102621133B CN102621133B CN201210111436.9A CN201210111436A CN102621133B CN 102621133 B CN102621133 B CN 102621133B CN 201210111436 A CN201210111436 A CN 201210111436A CN 102621133 B CN102621133 B CN 102621133B
- Authority
- CN
- China
- Prior art keywords
- diaminonaphthalene
- dna
- optically
- concentration
- hairpindna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor.The invention belongs to analytical chemistry detection and DNA biosensor technical field, relate to a kind of based on class peroxidase G-DNA catalysis hydrogen peroxide oxidation luminol generation chemiluminescence thus to 1,8-diaminonaphthalene detects.Concrete with the hairpin DNA containing G-DNA structure as raw material, hairpin DNA and 1, after 8-diaminonaphthalene effect, and formation has the G-DNA of class Catalyzed Synthesis By Peroxidase activity under K+ and hemin effect, producing chemiluminescent change by catalysis hydrogen peroxide oxidation luminol thus realize 1,8-diaminonaphthalene detects.This Opticas DNA Biology Sensors method is simple and convenient, and the detection cycle is short, and response time is fast, good stability and have the advantages such as highly sensitive.
Description
Technical field
The invention belongs to analytical chemistry and DNA biosensor technique field, relate to the 1 of a kind of optically-based DNA biosensor, the detection method of 8-diaminonaphthalene, can realize fast and effectively 1, the detection of 8-diaminonaphthalene.
Background technology
Aromatic amine is the environmental contaminants that a class is important, has been listed in one of environmental contaminants of preferential monitoring.Industrially aromatic amine purposes is widely, as important industrial chemicals and fine-chemical intermediate, it is commonly used for printing and dyeing, pharmacy, medicine, pesticide, plastics, rubber, weaving, the pottery art production process such as glazing and paint, especially printing and dyeing industry, waste water often contains the aromatic amine intermediate of high concentration, and some dyes the most also can discharge aromatic amine pollutant through complicated chemical reaction and microbial action, thus cause the pollution of environment.Additionally, DNA can be caused damage by the activation through internal enzyme after aromatic amine compound entrance human body, causing DNA mutation, thus induce the malignant diseases such as cancer (such as causing bladder cancer, carcinoma of ureter, renal carcinoma), the health hazard to the mankind is very big.
The analyzing detecting method of aromatic amine has a variety of, such as gas chromatography, high performance liquid chromatography, high performance capillary electrophoresis, gas chromatography-mass spectrography, LC/MS etc., these method energy Simultaneous Determination multiple aromatic amine pollutant, there is the features such as efficient and sensible, but have apparatus expensive, need professional and technical personnel to operate, the shortcoming such as sample treatment is loaded down with trivial details.Along with electrochemical techniques and the development of DNA biosensor technique, DNA biosensor is also used for as a kind of novel detection technique detecting aromatic amine pollutant.Wang etc. application native calf thymic DNA modify carbon paste electrode biosensor, it is achieved that to 2-amino naphthalenes, 1-amino anthracene, 2-amino anthracene, 9, the detection of the aromatic amine pollutant such as 10-diaminourea phenanthrene, 1-amino pyrrole.The silk screen graphite that Chiti etc. use n DNA and the DNA fragmentation containing 23 bases containing synthetic to modify prints electrode sensor, to aromatic amine 2-amino naphthalenes, 2-amino anthracene, 1, the compound such as 2-diamino-anthraquinone, acriflavinium chloride is detected.Polypyrrole-PVC sulfonate/indium oxide film electrode sensor that the application native calf thymic DNA such as Prabhakar is modified, is detected aromatic compound 2-amino anthracene by cyclic voltammetry.But, as molecular recognition main body, aromatic amine compound is detected the method being mostly to use DNA modification electrode sensor using DNA, although these DNA biosensor have higher susceptiveness to aromatic amine pollutant, but its weak point is that electrode preparation time is longer, and cost is of a relatively high.Research finds, G-DNA is a classCan To be formedThere is the DNA fragmentation of the catalysis activity of class peroxidase,This G-DNA class peroxidaseHydrogen peroxide oxidation luminol can be catalyzed and produce chemiluminescence, there is response time fast, specificity high.The catalysis activity of the application G-DNA class peroxidase such as Li is successfully realized heavy metal ion A g+And Pb2+Detection, Xiao etc. achieves the detection to target dna chain based on this mechanism, and the application little molecule such as thrombin and ATP such as Liu can induce the formation of G-DNA structure, is also successfully realized the detection to it.Up to the present, applicationG-DNA class peroxidaseThe detection of aromatic amine compounds be have not been reported by catalysis luminol chemiluminescence, compared with DNA modification solid electrode formula sensor, method, this method is without by DNA modification to electrode surface, the cycle being greatly shortened, reducing cost, the response speed of detection also significantly improves simultaneously.
In sum, set up, improve and the analysis methods of development aromatic amine pollutant are the hot research problems of analytical chemistry and Environmental Chemistry, be also one of the key link of comprehensive environmental improvement, there is important Research Significance.Develop the detection method of a kind of new highly sensitive, low cost to improving the most significant and preferable using value of existing detection technique means simultaneously.
Summary of the invention
It is an object of the invention to provide a kind of method quickly detecting 1,8-diaminonaphthalene of optically-based DNA biosensor.
Technical scheme is as follows:
The 1 of a kind of optically-based DNA biosensor, the detection method of 8-diaminonaphthalene, comprise the following steps:
1) by solid hairpinDNA pH=8.0,20mMTris-NaClO4Buffer solution dissolves and is diluted to finite concentration, and mixes by vortex oscillator, stands 6h at room temperature, standby；
2) appropriate above-mentioned steps 1 is taken) the hairpinDNA solution prepared is added in cryopreservation tube, and it is added thereto to certain density 1, and 8-diaminonaphthalene solution, place 30min；
3) to above-mentioned steps 2) system adds certain density K+And hemin solution, place 1h；
4) in above-mentioned step 3) system, certain density H is added2O2And luminol solution, carry out chemical luminescent detecting.
Preferably, above-mentioned steps 1) described in hairpinDNA double stranded section base logarithm be 9 right.
Preferably, above-mentioned steps 2) described in hairpinDNA concentration be 100nM.
Preferably, above-mentioned steps 3) described in K+Concentration is 10mM.
Preferably, above-mentioned steps 3) described in hemin concentration be 1 μM.
Preferably, above-mentioned steps 4) described in H2O2Concentration is 300 μMs.
Preferably, above-mentioned steps 4) described in luminol concentration be 50 μMs.
Preferably, above-mentioned steps 1-4) described in solution ph be 8.0.
Compared with prior art the art of this patent has the advantage that
HairpinDNA sequence of the present invention is the DNA sequence of synthetic, can be optimized DNA sequence；
The coupling base pair of hairpinDNA double-strand " stem " of the present invention part is 9 right, and to 1, the detection of 8-diaminonaphthalene has higher susceptiveness；
The optical dna biosensor technique of the present invention is to be measured in solution system, shorter for experimental period than solid electrode formula DNA biosensor, and reliability is high, and cost is relatively low；
The present invention uses chemoluminescence method to be measured, and has the features such as simple to operate, fast response time, strong interference immunity.
Accompanying drawing explanation
Accompanying drawing is the chemiluminescence spectra of different system of determination: Tris-NaClO4Buffer solution system (), containing G-DNA, luminol, H2O2、K+, the Tris-NaClO of hemin4Buffer solution system (), containing G-DNA, luminol, H2O2、K+, the Tris-NaClO of hemin and 1,8-diaminonaphthalene4Buffer solution system ().
Detailed description of the invention
The present invention is described in more detail by following embodiment, but described enforcement is not construed as limiting the invention.
Embodiment 1
1) with the 20mMTris-NaClO of pH=8.04Solid hairpinDNA is dissolved by buffer solution, mixes by vortex oscillator, and stands 6h at room temperature, forms hairpinDNA structure with this understanding；
2) appropriate above-mentioned steps 1 is taken) the hairpinDNA solution prepared is added in cryopreservation tube, and it is added thereto to certain density 1, and 8-diaminonaphthalene solution, place 30min, state then up in system and add certain density K+And hemin solution, place 1h, form the G-DNA structure with class peroxidase activity with this understanding；
Embodiment 2
Controlling mensuration system hairpinDNA concentration is 100nM, K+Concentration be 10mM, hemin concentration be 1 μM, H2O2Concentration is 300 μMs, and luminol concentration is 50 μMs, respectively with 20mMTris-NaClO4The variable concentrations 1 of (pH=8.0) buffer preparation, 8-diaminonaphthalene (6nmol/L, 30nmol/L, 150nmol/L, 300nmol/L and 600nmol/L) solution effects, measure system chemiluminescence intensity.The 1 of above-mentioned variable concentrations, 8-diaminonaphthalene solution carries out chemiluminescence experiment respectively, and chemiluminescence intensity is shown in Table 1.
Chemiluminescence intensity after table 1 and variable concentrations 1,8-diaminonaphthalene effect
| Concentration (nM) | 6 | 30 | 150 | 300 | 600 |
| Chemiluminescence intensity (a. u) | 105 | 122 | 223 | 347 | 589 |
Embodiment 3
With concentration for concentration in 50nMhairpinDNA replacement embodiment 2 as 100nMhairpinDNA, other conditions are with embodiment 2, and experiment shows, this Opticas DNA Biology Sensors is to 1, and 8-diaminonaphthalene also has response.Variable concentrations 1,8-diaminonaphthalene solution chemiluminescence intensity with this understanding is shown in Table 2.
Chemiluminescence intensity after table 2 and variable concentrations 1,8-diaminonaphthalene effect
| Concentration (nM) | 6 | 30 | 150 | 300 | 600 |
| Chemiluminescence intensity (a. u) | 85 | 96 | 153 | 217 | 364 |
Nucleic acid (hairpinDNA) sequence table
<110>Beijing Normal University
<120>detection method of the 1,8-diaminonaphthalene of a kind of optically-based DNA biosensor
<160>1
<170>PatentInversion3.3
<210>1
<211>26
<212>DNA
<213>synthetic
<220>
<221>gene
<222>(1)..(17)
<220>
<221>stem_loop
<222>(1)..(26)
<223>wherein " stem " part is containing 9 pairs of bases, and " loop " number of base number is 8
<400>1
gggtagggcgggttggggccctaccc26
Claims (6)
1. the 1 of an optically-based DNA biosensor, the detection method of 8-diaminonaphthalene, it is characterised in that comprise the following steps:
1) by solid hairpinDNA pH=8.0,20mMTris-NaClO4Buffer solution dissolves and is diluted to finite concentration, and mixes by vortex oscillator, stands 6h at room temperature, standby；
2) appropriate above-mentioned steps 1 is taken) the hairpinDNA solution prepared is added in cryopreservation tube, and it is added thereto to certain density 1, and 8-diaminonaphthalene solution, place 30min；
3) to above-mentioned steps 2) system adds certain density K+And hemin solution, place 1h；
4) in above-mentioned step 3) system, certain density H is added2O2And luminol solution, carry out chemical luminescent detecting.
The 1 of optically-based DNA biosensor the most as claimed in claim 1, the detection method of 8-diaminonaphthalene, it is characterised in that: the Tris-NaClO of preparation hairpinDNA solution4Buffer concentration is 20mM, pH=8.0.
The 1 of optically-based DNA biosensor the most as claimed in claim 1, the detection method of 8-diaminonaphthalene, it is characterised in that: hairpinDNA and 1, the 8-diaminonaphthalene response time is 30min, then with K+And the hemin solution effects time is 1h.
The 1 of optically-based DNA biosensor the most as claimed in claim 1, the detection method of 8-diaminonaphthalene, it is characterised in that: hairpinDNA concentration is 100nM, K+Concentration be 10mM, hemin concentration be 1 μM, H2O2Concentration is 300 μMs, and luminol concentration is 50 μMs.
The 1 of optically-based DNA biosensor the most as claimed in claim 1, the detection method of 8-diaminonaphthalene, it is characterised in that: the base of the double-strand " stem " of hairpinDNA part coupling is 9 right.
The 1 of optically-based DNA biosensor the most as claimed in claim 1 or 2, the detection method of 8-diaminonaphthalene, it is characterised in that: the hairpinDNA sequence used comprises the sequence fragment that can form G-DNA class peroxidase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210111436.9A CN102621133B (en) | 2012-04-17 | 2012-04-17 | A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210111436.9A CN102621133B (en) | 2012-04-17 | 2012-04-17 | A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102621133A CN102621133A (en) | 2012-08-01 |
| CN102621133B true CN102621133B (en) | 2016-08-03 |
Family
ID=46561177
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210111436.9A Expired - Fee Related CN102621133B (en) | 2012-04-17 | 2012-04-17 | A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102621133B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104062288B (en) * | 2014-07-09 | 2018-02-02 | 北京师范大学 | A kind of detection method of the naphthylamine compound based on chemoluminescence method |
| CN106841080B (en) * | 2017-04-01 | 2019-11-01 | 北京农业质量标准与检测技术研究中心 | Application of the DNA Mimetic Peroxidase in detection 1,8- diaminonaphthalene |
| CN116297758B (en) * | 2023-02-03 | 2024-03-19 | 中国科学院地理科学与资源研究所 | Electrochemical DNA sensor with high sensitivity identification and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009036689A (en) * | 2007-08-03 | 2009-02-19 | Jfe Steel Kk | METHOD FOR EASY ANALYSIS OF TRACE AMOUNT OF Se IN ENVIRONMENTAL WATER |
| CN101606057A (en) * | 2007-02-06 | 2009-12-16 | 凸版印刷株式会社 | Biomolecule detecting method and biomolecule detection chip |
| CN102021226A (en) * | 2009-09-11 | 2011-04-20 | 中国科学技术大学 | Luminol direct bonded nano gold nucleic acid analyzing probe and application thereof |
| CN102375021A (en) * | 2010-08-25 | 2012-03-14 | 中国科学院大连化学物理研究所 | Electrochemical method employing DNA as probe to detect environmental pollutant |
-
2012
- 2012-04-17 CN CN201210111436.9A patent/CN102621133B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101606057A (en) * | 2007-02-06 | 2009-12-16 | 凸版印刷株式会社 | Biomolecule detecting method and biomolecule detection chip |
| JP2009036689A (en) * | 2007-08-03 | 2009-02-19 | Jfe Steel Kk | METHOD FOR EASY ANALYSIS OF TRACE AMOUNT OF Se IN ENVIRONMENTAL WATER |
| CN102021226A (en) * | 2009-09-11 | 2011-04-20 | 中国科学技术大学 | Luminol direct bonded nano gold nucleic acid analyzing probe and application thereof |
| CN102375021A (en) * | 2010-08-25 | 2012-03-14 | 中国科学院大连化学物理研究所 | Electrochemical method employing DNA as probe to detect environmental pollutant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102621133A (en) | 2012-08-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Gold nanoparticle couples with entropy-driven toehold-mediated DNA strand displacement reaction on magnetic beads: toward ultrasensitive energy-transfer-based photoelectrochemical detection of miRNA-141 in real blood sample | |
| Miao et al. | Electrochemical detection of miRNA combining T7 exonuclease-assisted cascade signal amplification and DNA-templated copper nanoparticles | |
| CN103852505B (en) | The preparation method of Graphene-Porphyrin Modified Glassy Carbon Electrode and application thereof | |
| Li et al. | Highly efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of MicroRNA in cancer cells | |
| Chang et al. | Simultaneous photoelectrochemical detection of dual microRNAs by capturing CdS quantum dots and methylene blue based on target-initiated strand displaced amplification | |
| CN104062330B (en) | A kind of electrochemical luminescence biology sensor that detects fibrin ferment and preparation method thereof | |
| Zeng et al. | Fluorescence detection of adenosine triphosphate through an aptamer–molecular beacon multiple probe | |
| Yun et al. | Graphene oxide-based fluorescent “turn-on” strategy for Hg2+ detection by using catalytic hairpin assembly for amplification | |
| CN108003866B (en) | A kind of dithiothreitol (DTT) fluorescence probe and its preparation method and application | |
| CN110426428B (en) | Detection of N by Ti-MOF-based photoelectrochemical sensor1Method for producing (E) -methyladenine | |
| CN110146566A (en) | Modified electrode, combination product and its electroluminescent chemiluminescence biosensor and application | |
| CN102621133B (en) | A kind of detection method of the 1,8-diaminonaphthalene of optically-based DNA biosensor | |
| Li et al. | Electrochemiluminescence aptasensor based on cascading amplification of nicking endonuclease-assisted target recycling and rolling circle amplifications for mucin 1 detection | |
| CN102692435B (en) | A kind of assay method of 1, the 8-diaminonaphthalene based on electrochemical DNA biosensor | |
| He et al. | Ultrasensitive detection of microRNA-21 based on electrophoresis assisted cascade chemiluminescence signal amplification for the identification of cancer cells | |
| Yang et al. | A novel fluorescent detection for PDGF-BB based on dsDNA-templated copper nanoparticles | |
| Wei et al. | A novel multiplex signal amplification strategy based on microchip electrophoresis platform for the improved separation and detection of microRNAs | |
| Li et al. | Polymerase chain reaction-based ultrasensitive detection of HBV DNA via G-quadruplex selective iridium (III) complex luminescent probe | |
| Liu et al. | A novel potential-regulated ratiometric electrochemiluminescence sensing strategy based on poly (9, 9-di-n-octylfluorenyl-2, 7-diyl) polymer nanoparticles for microRNA detection | |
| Xiao et al. | A photocathode based on BiOI-Bi/CNTs for microRNA detection coupling with target recycling strand displacement amplification | |
| Liu et al. | Rapid and ultrasensitive detection of DNA and microRNA-21 using a zirconium porphyrin metal-organic framework-based switch fluorescence biosensor | |
| CN104062288B (en) | A kind of detection method of the naphthylamine compound based on chemoluminescence method | |
| Sun et al. | Ratiometric fluorescent biosensor based on self-assembled fluorescent gold nanoparticles and duplex-specific nuclease-assisted signal amplification for sensitive detection of exosomal miRNA | |
| Zhang et al. | When fluorescent sensing meets electrochemical amplifying: A powerful platform for gene detection with high sensitivity and specificity | |
| Yang et al. | Electrogenerated chemiluminescence biosensor for microRNA detection incorporating enzyme-free dual DNA cyclic amplification and Ru (bpy) 32+-functionalized metal-organic framework |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160803 Termination date: 20200417 |