CN102618477A - Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism - Google Patents

Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism Download PDF

Info

Publication number
CN102618477A
CN102618477A CN2012101022051A CN201210102205A CN102618477A CN 102618477 A CN102618477 A CN 102618477A CN 2012101022051 A CN2012101022051 A CN 2012101022051A CN 201210102205 A CN201210102205 A CN 201210102205A CN 102618477 A CN102618477 A CN 102618477A
Authority
CN
China
Prior art keywords
gene
fermentation
succinic acid
escherichia coli
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN2012101022051A
Other languages
Chinese (zh)
Inventor
姜岷
刘嵘明
梁丽亚
马江锋
陈可泉
韦萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN2012101022051A priority Critical patent/CN102618477A/en
Publication of CN102618477A publication Critical patent/CN102618477A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01031—Phosphoenolpyruvate carboxylase (4.1.1.31)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of bioengineering, and relates to a construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism and a method for producing succinic acid by fermentation. The invention reforms ATP biosynthesis path of colibacillus by molecular biology means, over-expresses the activity of enzyme related to the path, effectively improves the total amount of ATP in colibacillus cells, enables the recombinant colibacillus to grow by utilizing xylose metabolism, and greatly improves the synthesis efficiency of succinic acid.

Description

Utilize the construction process of xylose metabolism succinic acid-producing bacillus coli gene engineering bacteria
Technical field
The invention belongs to technical field of bioengineering, relate to the construction process that utilizes xylose metabolism succinic acid-producing bacillus coli gene engineering bacteria.
Background technology
Succinic Acid (succinic acid) claim succsinic acid again; Be widely used in industries such as medicine, agricultural chemicals, dyestuff, spices, paint, food and plastics; As C4 hardware and software platform compound; Can be used for synthesizing 1, organic chemicals and poly butylene succinate (PBS) type Biodegradable materials such as 4-butyleneglycol, THF, gamma-butyrolactone are thought one of biorefinery product of following 12 kinds of most worthies by USDOE.
The working method of Succinic Acid mainly comprises chemical synthesis and microbe fermentation method; Utilize microbe fermentation method to transform renewable resources (glucose, wood sugar etc.),, pollute little because raw material sources are extensive and cheap; Environmental friendliness, and can absorb fixation of C O during the fermentation 2, can effectively alleviate Greenhouse effect, opened up the new way that the greenhouse gases carbonic acid gas utilizes, become the focus of research this year.The production bacterial strain of Succinic Acid mainly concentrates on Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, reorganization Corynebacterium glutamicum and reorganization E.coliObtained higher production concentration though utilize wild strain to produce Succinic Acid, the culturing process culture medium cost is higher, and byproducts build-up such as formic acid, acetate are more, hindered its process of industrialization. E.coliBecause clear, easy to operate, the easy-regulating of genetic background, substratum require simple and the advantage such as rapid of growing, and are widely used in research in recent years to obtain the outstanding bacterial strain of succinic acid-producing.
E.coliThough wild strain is produced Succinic Acid and has been obtained higher production concentration; But the culturing process culture medium cost is higher; Therefore and byproducts build-up such as formic acid, acetate is more, can knock out or inactivation serum lactic dehydrogenase (LDH) gene wherein and the generation of pyruvate formate-lyase (PFL) gene activity with the minimizing by product.But, owing to knocked out the PFL gene, cause bacterial strain can not produce acetate, thereby the ATP that follows acetate to generate is reduced, finally cause recombination bacillus coli can not utilize the xylose metabolism growth, and produce Succinic Acid.
Corn cob is a waste more common in the agriculture prodn; Because its composition contains a large amount of Mierocrystalline celluloses; Therefore its hydrolyzed solution is concerning microbial fermentation; Be a kind of green carbon source of good sustainable use, but its hydrolyzed solution contains the high density wood sugar, so intestinal bacteria NZN111 can not utilize corn cob hydrolyzed solution fermentation production of succinic acid.Jiang Min etc. press solid-liquid ratio with corn cob, and 1: 5 (mass volume ratio) prepared corn cob feed liquid, material particular diameter 250～380 μ m, H 2SO 4Consumption 3% (volume(tric)fraction), 126 ℃ of hydrolysis temperatures, reaction times 215 h utilizes charcoal absorption and Ca (OH) 2Modes such as neutralization are carried out the detoxification desalting treatment to corn cob polycomponent liquid glucose, and the total reducing sugar mass concentration is 50 g/L, and wherein wood sugar accounts for more than 80%.
Rice straw is one type of important renewable biomass resource.At present, except the utilization in the paper-making industry industrial aspect, the overwhelming majority goes out of use, serious waste resource and polluted environment.Its staple is Mierocrystalline cellulose, semicellulose and xylogen; Therefore its hydrolyzed solution is concerning microbial fermentation; It is a kind of green carbon source of good sustainable use; But its hydrolyzed solution contains the high density wood sugar, therefore can not utilize the coli strain of wood sugar can not utilize rice straw hydrolyzed solution fermentation production of succinic acid, and rice straw 1 h is handled for 121 ℃ through dilute sulphuric acid in the inscription on pottery Yihe River etc.; Handle stalk 1 h with the NaOH of 20 g/L in 121 ℃ again, the two total mass concentration of glucose and wood sugar all reaches about 50 g/L.
When being cane sugar manufacture, presses bagasse the staple of being left after the sugar; Therefore its hydrolyzed solution is concerning microbial fermentation; Be a kind of green carbon source of good sustainable use, but its hydrolyzed solution contains the high density wood sugar, therefore can not utilize the coli strain of wood sugar can not utilize rice straw hydrolyzed solution fermentation production of succinic acid; Contain approximately 50% Mierocrystalline cellulose through pulverize and alkali/oxidation style pre-treatment can to obtain the total reducing sugar quality be 50 g/L, wherein wood sugar accounts for more than 80%.
Generate oxaloacetic acid at the intestinal bacteria PEP through phosphoric acid enol pyruvic acid carboxylase, in this process, do not have the generation of ATP, but Bacillus subtilisIn, PEP generates oxaloacetic acid through PEP carboxylation kinases, and the generation of ATP is arranged in this process, and overexpression in intestinal bacteria such as Millard E. coli ppcWith Pck, discover overexpression PpcCan make the primary product of succsinic acid, and output improves 3.5 times than starting strain as mixed acid fermentation, and overexpression PckTo not influence of fermentation result, but PpcIn the defective bacterial strain, PckOverexpression can improve the output of succsinic acid.
Summary of the invention
Technical purpose of the present invention has been to provide a kind of construction process based on the improved coli strain of ATP biosynthesis system; The construction process that reaches bacterial strain is simple and convenient; The strain fermentation method simple possible that structure obtains is easy to industriallization, the purpose that acid producing ability is strong; Thereby greatly reduce production cost, increase economic efficiency.
For realizing the object of the invention, the present invention adopts following technical scheme.
Utilize the construction process of xylose metabolism succinic acid-producing bacillus coli gene engineering bacteria, it is characterized in that comprising the steps:
(1) with lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
(2) separately purifying amplify PEP carboxylation kinases ( Pck) gene, perhaps purifying amplify PEP carboxylation kinases ( Pck) gene, and select from malic enzyme ( SfcA) gene, MDH ( Mdh) gene or pyruvate carboxylase ( Pyc) a kind of in these three kinds of genes of gene; Structure obtains independent overexpression PEP carboxylation kinases; A kind of expression plasmid of perhaps overexpression PEP carboxylation kinases, and selection in these three kinds of enzymes of malic enzyme, MDH or pyruvate carboxylase;
(3) the described plasmid of step (2) is imported the competence bacterial strain that step (1) obtains, obtain positive transformant;
(4) utilize the independent overexpression PEP of the positive transformant carboxylation kinases of step (3); Perhaps overexpression PEP carboxylation kinases; And select a kind of in these three kinds of enzymes of malic enzyme, MDH or pyruvate carboxylase; Recover its ability of metabolism wood sugar under anaerobic, obtain xylose metabolism succinic acid-producing genetic engineering bacterium capable of using.
Concrete, utilize aforesaid method of the present invention can be subdivided into following several concrete grammar.
A, overexpression PEP carboxylation kinases obtain efficiently utilizing the also intestinal bacteria of succinic acid-producing of wood sugar growth Escherichia coliBA204:
With lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
Synthetic a pair of 5 ' end has the primer of restriction enzyme site, with Bacillus subtilisGenomic dna is a template, and purifying amplifies PckBehind the gene, expression plasmid pTrc99a uses consistent enzyme double digestion, the connection of restriction enzyme site that is designed with primer to obtain recombinant plasmid pTrc99a- PckWith plasmid pTrc99a- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA204;
Utilize Escherichia coliBA204 overexpression PEP carboxylation kinases recovers its ability of metabolism wood sugar under anaerobic.Recombinant plasmid pTrc99a- PckThe structure collection of illustrative plates as shown in Figure 3.
B, excessive coexpression PEP carboxylation kinases and malic enzyme obtain efficiently utilizing the also intestinal bacteria of succinic acid-producing of wood sugar growth Escherichia coliBA205:
With lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
Synthetic a pair of 5 ' end has the primer of identical restriction enzyme site, with Bacillus subtilisGenomic dna is a template, and purifying amplifies PckBehind the gene, the recombinant plasmid pTrc99a-that has made up SfcAUse consistent enzyme single endonuclease digestion, the connection of restriction enzyme site that is designed with primer to obtain recombinant plasmid pTrc99a- SfcA- Pck
With plasmid pTrc99a- SfcA- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA205;
Utilize Escherichia coliBA205 coexpression PEP carboxylation kinases and malic enzyme recover its ability of metabolism wood sugar under anaerobic.Recombinant plasmid pTrc99a- SfcA- PckThe structure collection of illustrative plates as shown in Figure 4.
C, excessive coexpression PEP carboxylation kinases and MDH make it can efficiently utilize wood sugar growth and succinic acid-producing, obtain intestinal bacteria Escherichia coliBA206:
With lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
Synthetic a pair of 5 ' end has the primer of identical restriction enzyme site, with Bacillus subtilisGenomic dna is a template, and purifying amplifies PckBehind the gene, the recombinant plasmid pTrc99a-that has made up MdhUse consistent enzyme single endonuclease digestion, the connection of restriction enzyme site that is designed with primer to obtain recombinant plasmid pTrc99a- Mdh- Pck
With plasmid pTrc99a- Mdh- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA206;
Utilize Escherichia coliBA206 coexpression PEP carboxylation kinases and MDH recover its ability of metabolism wood sugar under anaerobic.Recombinant plasmid pTrc99a- Mdh-pckThe structure collection of illustrative plates as shown in Figure 5.
D, excessive coexpression PEP carboxylation kinases and pyruvate carboxylase make it can efficiently utilize wood sugar growth and succinic acid-producing, obtain intestinal bacteria Escherichia coliBA207:
With lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
Synthetic a pair of 5 ' end has the primer of identical restriction enzyme site, with Bacillus subtilisGenomic dna is a template, and purifying amplifies PckBehind the gene, the recombinant plasmid pTrc99a-that has made up PycUse consistent enzyme single endonuclease digestion, the connection of restriction enzyme site that is designed with primer to obtain recombinant plasmid pTrc99a- Pyc- Pck
With plasmid pTrc99a- Pyc- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA207;
Utilize Escherichia coliBA207 coexpression PEP carboxylation kinases and pyruvate carboxylase recover its ability of metabolism wood sugar under anaerobic.Recombinant plasmid pTrc99a- Pyc-pckThe structure collection of illustrative plates as shown in Figure 6.
Beneficial effect of the present invention is:
At first, produce in the anaerobic fermentation process in a large number such as the by product to the toxic effect of bacterial strain such as acetate, therefore consider two stage fermentation modes, the aerobic stage is improved living weight, and anaerobic stages carries out acidogenic fermentation.Also can optionally adopt membrane separation technique, reach the purpose of separating thallus, again and then be used for anaerobically fermenting.Concrete steps are following: adopt two stage fermentation patterns; Rule-80 ℃ of frozen bacterium liquid of guaranteeing the Tibetan to the flat board that contains penbritin; The single bacterium colony that grows on the picking flat board is to the test tube of 5 ml LB substratum, and 1% (v/v) inoculum size inserts in the triangular flask, as aerobic culture bacteria body OD 600IPTG with 0.3 mM during to the 0.8-1.0 left and right sides is induced to OD 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%.Fermentation is the result show, new that make up and the relevant genetic engineering bacterium of intestinal bacteria ATP biosynthetic pathway Escherichia coliBA 204, Escherichia coliBA 205, Escherichia coliBA 206 draws Escherichia coliBA 207 has recovered the ability of metabolism wood sugar under the anaerobic condition, and efficiently utilizes the wood sugar succinic acid-producing.
Secondly; The present invention transforms colibacillary ATP biosynthetic pathway through molecular biology method; Improving ATP supplies with; Replenish the wood sugar transhipment and supply with, make the recombination bacillus coli can the growth of sustainable utilization wood sugar and the method for its efficient synthesizing succinic acid is not seen openly, and this application will advance the progress and the development of Succinic Acid industry greatly with the energy in the metabolic process.
Description of drawings
The electrophoresis of Fig. 1 linear DNA fragment is identified figure.
The electrophoresis of Fig. 2 homologous recombination positive recombinant is identified figure.
Fig. 3 recombinant plasmid pTrc99a- PckThe structure collection of illustrative plates.
Fig. 4 recombinant plasmid pTrc99a- SfcA-pckThe structure collection of illustrative plates.
Fig. 5 recombinant plasmid pTrc99a- Mdh-pckThe structure collection of illustrative plates.
Fig. 6 recombinant plasmid pTrc99a- Pyc-pckThe structure collection of illustrative plates.
Fig. 7 PCR product PckAgarose gel electrophoresis identify figure.
Fig. 8 recombinant plasmid pTrc99a- PckSingle double digestion identify figure.
Fig. 9 recombinant plasmid pTrc99a- SfcA-pckSingle double digestion identify figure.
Figure 10 recombinant plasmid pTrc99a- Mdh-pckSingle double digestion identify figure.
Figure 11 recombinant plasmid pTrc99a- Pyc-pckSingle double digestion identify figure.
Embodiment
Following embodiment elaborates to the present invention, but to not restriction of the present invention.
The source of apramycin resistant gene of the present invention is: pIJ773 obtains from the azure professor of Shao of Nanjing Normal University place.
The source of plasmid that can abduction delivering λ recombinase of the present invention is: pKD46, and available from Introvegen company.
The source of the plasmid that produces the FLP recombinase of can inducing of the present invention is: pCP20, and available from Introvegen company.
Of the present invention Bacillus subtilisGenomic source is: available from China typical culture collection center.
Expression plasmid of the present invention with the source of pTrc99a is: available from Introvegen company.
Starting strain of the present invention: E.coliThere are two places in the source of the competence bacterial strain of NZN111:
（1）Biotechnol?Bioeng,?2001,74:89～95。The applicant is at first through finding the above-mentioned document source of this biomaterial, and to have got in touch the utterer be the David P. Clark professor of Univ Chicago USA, and its this biomaterial of gifting of mail requests, and freely obtained this biomaterial; And the applicant guarantees in 20 years the application's days, to provide this biomaterial to the public;
(2) this biomaterial also discloses in the patent documentation of Chinese patent (application number 96198547.X, applying date 1996.10.31 authorize day on January 1st, 2003, Granted publication CN1097632C) and obtains the authorization.
Primer design of the present invention and synthetic: design and outer Si Rui covered with gold leaf biotech company are synthetic voluntarily.
Embodiment 1
The present embodiment explanation makes up the kinase whose expression plasmid of overexpression PEP carboxylation, recovers the recombinant bacterial strain ability of metabolism wood sugar under anaerobic, obtains bacterial strain Escherichia coliBA204.
1, with lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC.
Utilize homologous recombination technique to knock out phosphoric acid enol pyruvic acid carboxylase (PPC) gene: the apramycin resistant gene that has the FRT site with both sides is a template; Utilize high-fidelity pcr amplification system; And design the amplimer that two ends have the PPC homologous fragment, successfully amplify the linear DNA homologous fragment; In starting strain NZN111, import can abduction delivering λ recombinase plasmid; Make after electricity changes linear DNA fragment over to, can suppress the inner exonuclease of thalline, prevent the decomposition of linear fragment; Carry out homologous recombination simultaneously, obtain positive recombinant through resistance screening; Importing can be induced the plasmid that produces the FLP recombinase, after inducing, utilizes pair of plates, carries out parallel point sample, can on the non-resistant flat board, grow, but the NZN111 bacterial strain that has all very knocked out resistance that can not on resistant panel, grow.
Concrete method:
(1) utilizes the LB substratum, in 37 ℃, the following intestinal bacteria NZN111 to OD that cultivates of aerobic conditions 600=0.4～0.6, being prepared into electricity changes competence.
(2) change plasmid pKD46 electricity over to competent intestinal bacteria NZN111.The electric shock condition is: 200 Ω, 25 μ F, electric shock voltage 2.3 kV, electric shock times 4～5 ms.The SOC substratum that rapidly thalline is added precooling 1 mL after shocking by electricity, 150 r/min, 30 ℃ of cultivation 1 h coat and be with the LB culture medium flat plate of penbritin (amp) to filter out positive transformant intestinal bacteria NZN111 (pKD46) afterwards.
(3) L-arabinose of adding 10 mM in the LB substratum induces plasmid pKD46 to give expression to the λ recombinase under 30 ℃, processes electricity and changes competence.
(4) the apramycin resistant gene that has a FRT site with both sides is a template; Utilizing high-fidelity pcr amplification system, is template with plasmid pIJ773, and the design two ends have the amplimer of PPC homologous fragment; Amplify the linear DNA homologous fragment, primer sequence is following:
Upper reaches band homology arm primer H1-P1, underscore is a homologous fragment:
5’- ATGAACGAACAATATTCCGCATTGCGTAGTAATGTCAGTATGCTCGGCATTCCGGGGATCCGTCGACC-3’。
Downstream band homology arm primer H2-P2, underscore is a homologous fragment:
5’- AGCACGAGGGTTTGCAGAAGAGGAAGATTAGCCGGTATTACGCATACCTGTAGGCTGGAGCTGCTTC-3’。
Reaction system: each 0.5 μ L of upstream and downstream primer (100 pmol/ μ L) of band homology arm; Template DNA (100 ng/ μ L) 0.5 μ L; 10 * buffer, 5 μ L; Each 1 μ L of dNTPs (10 mM); DMSO (100%) 2.5 μ L; Pyrobest archaeal dna polymerase (2.5 U/ μ L) 1 μ L; DdH 2O 36/35.5 μ L; TV 50 μ L.
Reaction conditions: 94 ℃, 2 min; (94 ℃ of 45 sec; 50 ℃ of 45 sec; 72 ℃ of 90 sec; 10 circulations); (94 ℃ of 45 sec; 50 ℃ of 45 sec; 72 ℃ of 90 sec; 15 circulations); 72 ℃, 5 min.
The evaluation of linear DNA fragment such as Fig. 2.
(5) electricity changes linear DNA fragment intestinal bacteria NZN111 (pKD46) competence of abduction delivering λ recombinase extremely, and coats and be with the LB flat screen of apramycin to select positive recombinant, and has carried out the PCR evaluation, and electrophorogram is as shown in Figure 3.
(6) positive recombinant process pour into after the competence can abduction delivering FLP recombinase plasmid pCP20, after the FLP recombinase is expressed in 42 ℃ of heat shocks, can eliminate the apramycin resistance.Utilize pair of plates, carry out parallel point sample, can on the non-resistant flat board, grow, but the bacterial strain that has all very knocked out resistance that can not on resistant panel, grow.
2, make up the kinase whose expression plasmid of overexpression PEP carboxylation, its process comprises:
(1) synthetic having SacI with XbaThe primer of I restriction enzyme site,
Upstream primer: 5 '-CGAGCTCATGAACTCAGTTGATTTGACCG-3 ';
Downstream primer: 5 '-GCTCTAGAGCATTCCGTCAATTAAAACAAG-3 '.
(2) with Bacillus subtilisGenomic dna is a template, the pcr amplification target gene fragment, and reaction conditions is: 94 ℃, 5 min; (94 ℃ of 45 s, 55 ℃ of 45 s, 72 ℃ of 100 s, 35 circulations); 72 ℃, 10 min.Purifying amplifies PckGene and expression plasmid pTrc99a use respectively SacI with XbaI double digestion, connection obtain recombinant plasmid pTrc99a- PckThe PCR product PckAgarose gel electrophoresis identify that figure is as shown in Figure 7; Plasmid pTrc99a- PckThe double digestion electrophoresis identify as shown in Figure 8.
3, with plasmid pTrc99a- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA204.
Embodiment 2
The present embodiment explanation makes up the expression plasmid of coexpression PEP carboxylation kinases and malic enzyme, recovers the recombinant bacterial strain ability of metabolism wood sugar under anaerobic, obtains bacterial strain Escherichia coliBA205.
1, with lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain (with embodiment 1) with PPC.
2, make up the expression plasmid of coexpression PEP carboxylation kinases and malic enzyme, its process comprises:
(1) synthetic upstream and downstream all has HinThe primer of dIII restriction enzyme site,
Upstream primer: 5 '-CCCAAGCTTATGAACTCAGTTGATTTGACCG-3 ';
Downstream primer: 5 '-CCCAAGCTTGCATTCCGTCAATTAAAACAAG-3 '.
(2) with Bacillus subtilisGenomic dna is a template, the pcr amplification target gene fragment, and reaction conditions is: 94 ℃, 5 min; (94 ℃ of 45 s, 55 ℃ of 45 s, 72 ℃ of 100 s, 35 circulations); 72 ℃, 10 min.Purifying amplifies PckGene and expression plasmid pTrc99a- SfcAUse respectively HinDIII single endonuclease digestion, connection obtain recombinant plasmid pTrc99a- SfcA- PckRecombinant plasmid pTrc99a- SfcA-pckSingle double digestion identify that figure is as shown in Figure 9.
3, with plasmid pTrc99a- SfcA- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA205.
Embodiment 3
The present embodiment explanation makes up the expression plasmid of coexpression PEP carboxylation kinases and MDH, recovers the recombinant bacterial strain ability of metabolism wood sugar under anaerobic, obtains bacterial strain Escherichia coliBA206.
1, with lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain (with embodiment 1) with PPC.
2, make up the expression plasmid of coexpression PEP carboxylation kinases and MDH, its process comprises:
(1) synthetic upstream and downstream all has HinThe primer of dIII restriction enzyme site,
Upstream primer: 5 '-CCCAAGCTTATGAACTCAGTTGATTTGACCG-3 ';
Downstream primer: 5 '-CCCAAGCTTGCATTCCGTCAATTAAAACAAG-3 '.
(2) with Bacillus subtilisGenomic dna is a template, the pcr amplification target gene fragment, and reaction conditions is: 94 ℃, 5 min; (94 ℃ of 45 s, 55 ℃ of 45 s, 72 ℃ of 100 s, 35 circulations); 72 ℃, 10 min.Purifying amplifies PckGene and expression plasmid pTrc99a- MdhUse respectively HindIII single endonuclease digestion, connection obtain recombinant plasmid pTrc99a- Mdh- PckRecombinant plasmid pTrc99a- Mdh-pckSingle double digestion identify that figure is shown in figure 10.
3, with plasmid pTrc99a- Mdh- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA206.
Embodiment 4
The present embodiment explanation makes up the expression plasmid of coexpression PEP carboxylation kinases and pyruvate carboxylase, recovers the recombinant bacterial strain ability of metabolism wood sugar under anaerobic, obtains bacterial strain Escherichia coliBA207.
1, with lack lactate dehydrogenase gene ( LdhA), the pyruvate formate-lyase gene ( PflB) active E.coliThe NZN111 bacterial strain is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase (PPC) gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain (with embodiment 1) with PPC.
2, make up the expression plasmid of coexpression PEP carboxylation kinases and pyruvate carboxylase, its process comprises:
(1) synthetic upstream and downstream all has HinThe primer of dIII restriction enzyme site,
Upstream primer: 5 '-CCCAAGCTTATGAACTCAGTTGATTTGACCG-3 ';
Downstream primer: 5 '-CCCAAGCTTGCATTCCGTCAATTAAAACAAG-3 '.
(2) with Bacillus subtilisGenomic dna is a template, the pcr amplification target gene fragment, and reaction conditions is: 94 ℃, 5 min; (94 ℃ of 45 s, 55 ℃ of 45 s, 72 ℃ of 100 s, 35 circulations); 72 ℃, 10 min.Purifying amplifies PckGene and expression plasmid pTrc99a- PycUse respectively HindIII single endonuclease digestion, connection obtain recombinant plasmid pTrc99a- Pyc- PckRecombinant plasmid pTrc99a- Pyc-pckSingle double digestion identify that figure is shown in figure 11.
3, with plasmid pTrc99a- Pyc- PckEliminate the apramycin resistance before importing, knocked out the competence of the NZN111 bacterial strain of phosphoric acid enol pyruvic acid carboxylase (PPC) gene, the positive transformant of acquisition is Escherichia coliBA207.
Embodiment 5
The contrast of the recombination bacillus coli BA204 of the new structure of present embodiment illustrative embodiment 1 and starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA204 can efficiently utilize wood-sugar fermentation, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ wood sugar (20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 1.
Table 1 Escherichia coliThe result of BA204 and starting strain fermentation and acid relatively
Annotate: ND representes not detect.
Embodiment 6
The new recombination bacillus coli BA204 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA204 can efficiently utilize the fermentation of corn cob hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ corn cob hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 2.
Table 2 Escherichia coliThe result of BA204 and starting strain fermentation and acid relatively
Figure 156608DEST_PATH_IMAGE004
Annotate: ND representes not detect.
Embodiment 7
The new recombination bacillus coli BA204 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA204 can efficiently utilize the fermentation of rice straw hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ rice straw hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 3.
Table 3 Escherichia coliThe result of BA204 and starting strain fermentation and acid relatively
Figure 467504DEST_PATH_IMAGE006
Annotate: ND representes not detect.
Embodiment 8
The new recombination bacillus coli BA204 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA204 can efficiently utilize the fermentation of bagasse hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ bagasse hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 4.
Table 4 Escherichia coliThe result of BA204 and starting strain fermentation and acid relatively
Annotate: ND representes not detect.
Embodiment 9
The new recombination bacillus coli BA205 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA205 can efficiently utilize wood-sugar fermentation, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ wood sugar (20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 5.
Table 5 Escherichia coliThe result of BA205 and starting strain fermentation and acid relatively
Figure 942665DEST_PATH_IMAGE008
Annotate: ND representes not detect.
Embodiment 10
The new recombination bacillus coli BA205 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA205 can efficiently utilize the fermentation of corn cob hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ corn cob hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 6.
Table 6 Escherichia coliThe result of BA205 and starting strain fermentation and acid relatively
Figure 293356DEST_PATH_IMAGE010
Annotate: ND representes not detect.
Embodiment 11
The new recombination bacillus coli BA205 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA205 can efficiently utilize the fermentation of rice straw hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ rice straw hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 7.
Table 7 Escherichia coliThe result of BA205 and starting strain fermentation and acid relatively
Annotate: ND representes not detect.
Embodiment 12
The new recombination bacillus coli BA205 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA205 can efficiently utilize the fermentation of bagasse hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ bagasse hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 8.
Table 8 Escherichia coliThe result of BA205 and starting strain fermentation and acid relatively
Figure 290448DEST_PATH_IMAGE010
Annotate: ND representes not detect.
Embodiment 13
The new recombination bacillus coli BA206 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA206 can efficiently utilize wood-sugar fermentation, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ wood sugar (20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 9.
Table 9 Escherichia coliThe result of BA206 and starting strain fermentation and acid relatively
Figure 2012101022051100002DEST_PATH_IMAGE014
Annotate: ND representes not detect.
Embodiment 14
The new recombination bacillus coli BA206 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA206 can efficiently utilize the fermentation of corn cob hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ corn cob hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 10.
Table 10 Escherichia coliThe result of BA206 and starting strain fermentation and acid relatively
Figure 2012101022051100002DEST_PATH_IMAGE016
Annotate: ND representes not detect.
Embodiment 15
The new recombination bacillus coli BA206 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA206 can efficiently utilize the fermentation of rice straw hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ rice straw hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 11.
Table 11 Escherichia coliThe result of BA206 and starting strain fermentation and acid relatively
Figure 2012101022051100002DEST_PATH_IMAGE018
Annotate: ND representes not detect.
Embodiment 16
The new recombination bacillus coli BA206 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA206 can efficiently utilize the fermentation of bagasse hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ bagasse hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 12.
Table 12 Escherichia coliThe result of BA206 and starting strain fermentation and acid relatively
Figure 83960DEST_PATH_IMAGE016
Annotate: ND representes not detect.
Embodiment 17
The new recombination bacillus coli BA207 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA207 can efficiently utilize wood-sugar fermentation, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ wood sugar (20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 13.
Table 13 Escherichia coliThe result of BA207 and starting strain fermentation and acid relatively
Annotate: ND representes not detect.
Embodiment 18
The new recombination bacillus coli BA207 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA207 can efficiently utilize the fermentation of corn cob hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ corn cob hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 14.
Table 14 Escherichia coliThe result of BA207 and starting strain fermentation and acid relatively
Figure 139641DEST_PATH_IMAGE022
Annotate: ND representes not detect.
Embodiment 19
The new recombination bacillus coli BA207 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA207 can efficiently utilize the fermentation of rice straw hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ rice straw hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 15.
Table 15 Escherichia coliThe result of BA207 and starting strain fermentation and acid relatively
Figure 690708DEST_PATH_IMAGE024
Annotate: ND representes not detect.
Embodiment 20
The new recombination bacillus coli BA207 that makes up of present embodiment explanation and the contrast of starting strain intestinal bacteria NZN111 fermentation and acid ability.
Intestinal bacteria Escherichia coliBA207 can efficiently utilize the fermentation of bagasse hydrolyzed solution, and accumulates Succinic Acid in a large number, adopts two stage fermentation modes, it is characterized in that inserting the triangular flask, as aerobic culture bacteria body OD from frozen pipe by 1% (v/v) inoculum size 600Be induced to OD to about 0.4～0.6 IPTG with 0.3 mM 600During=3 left and right sides, be forwarded to anaerobically fermenting in the serum bottle by inoculum size 10%, 48 h ferment.
Aerobic stage substratum is: LB+ Amp (penbritin 50 μ g/mL).
The anaerobic stages substratum is: LB+ bagasse hydrolyzed solution (total reducing sugar 20 g/L)+magnesium basic carbonate 0.48 g+Amp (penbritin 50 μ g/mL)+0.3 mM IPTG.
The fermentation result sees table 16.
Table 16 Escherichia coliThe result of BA207 and starting strain fermentation and acid relatively
Annotate: ND representes not detect.

Claims (1)

1. a construction process that utilizes xylose metabolism succinic acid-producing bacillus coli gene engineering bacteria is characterized in that comprising the steps:
(1) to lack lactate dehydrogenase gene, the coli strain of pyruvate formate-lyase gene activity is a starting strain, knocks out wherein phosphoric acid enol pyruvic acid carboxylase gene, is lacked simultaneously LdhA, PflBCompetence bacterial strain with PPC;
(2) purifying amplifies PEP carboxylation kinase gene separately; Perhaps purifying amplifies PEP carboxylation kinase gene; And select a kind of in these three kinds of genes of malic enzyme gene, malate dehydrogenase gene or pyruvate carboxylase gene; Structure obtains independent overexpression PEP carboxylation kinases; A kind of expression plasmid of perhaps overexpression PEP carboxylation kinases, and selection in these three kinds of enzymes of malic enzyme, MDH or pyruvate carboxylase;
(3) the described plasmid of step (2) is imported the competence bacterial strain that step (1) obtains, obtain positive transformant;
(4) utilize the independent overexpression PEP of the positive transformant carboxylation kinases of step (3); Perhaps overexpression PEP carboxylation kinases; And select a kind of in these three kinds of enzymes of malic enzyme, MDH or pyruvate carboxylase; Recover its ability of metabolism wood sugar under anaerobic, obtain xylose metabolism succinic acid-producing genetic engineering bacterium capable of using.
CN2012101022051A 2011-07-18 2012-04-10 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism Pending CN102618477A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2012101022051A CN102618477A (en) 2011-07-18 2012-04-10 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN2011102007425A CN102296082A (en) 2011-07-18 2011-07-18 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism
CN201110200742.5 2011-07-18
CN2012101022051A CN102618477A (en) 2011-07-18 2012-04-10 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism

Publications (1)

Publication Number Publication Date
CN102618477A true CN102618477A (en) 2012-08-01

Family

ID=45356757

Family Applications (2)

Application Number Title Priority Date Filing Date
CN2011102007425A Pending CN102296082A (en) 2011-07-18 2011-07-18 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism
CN2012101022051A Pending CN102618477A (en) 2011-07-18 2012-04-10 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN2011102007425A Pending CN102296082A (en) 2011-07-18 2011-07-18 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism

Country Status (2)

Country Link
CN (2) CN102296082A (en)
WO (1) WO2013010483A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110951660A (en) * 2019-12-19 2020-04-03 江南大学 Fixed CO2Construction and application of malic acid-producing escherichia coli engineering bacteria

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102296082A (en) * 2011-07-18 2011-12-28 南京工业大学 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism
CN102399738B (en) * 2011-07-18 2013-12-04 南京工业大学 Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium
CN103131663B (en) * 2013-03-07 2014-08-06 中国科学院天津工业生物技术研究所 Recombinant bacteria for increasing yield of succinic acid and construction method thereof
CN103320366B (en) * 2013-07-10 2014-12-31 南京工业大学 Screening and application of high-yield succinic acid escherichia coli by anaerobic utilization of synthetic culture medium
CN105779513B (en) * 2016-05-10 2019-12-06 华东理工大学 Method for producing succinic acid by fermentation of recombinant escherichia coli by using glycerol as carbon source
CN106167772B (en) * 2016-06-21 2019-05-17 中国科学院过程工程研究所 The Recombinant organism and its construction method of a kind of high yield pyruvic acid and application
CN106544285B (en) * 2016-12-07 2019-07-02 江南大学 A kind of reinforcing torulopsis glabrata synthesis Pyruvate Method
CN114958703B (en) * 2022-06-15 2024-01-05 山东理工大学 Recombinant bacterium for synthesizing succinic acid by utilizing grease, construction method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101255405A (en) * 2008-04-11 2008-09-03 南京工业大学 Novel constructed high-yield malic acid gene engineering bacterium and method for producing malic acid by using same

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102296082A (en) * 2011-07-18 2011-12-28 南京工业大学 Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101255405A (en) * 2008-04-11 2008-09-03 南京工业大学 Novel constructed high-yield malic acid gene engineering bacterium and method for producing malic acid by using same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
于丽，等: "过量表达Bacillus subtilis 磷酸烯醇式丙酮酸羧化激酶对大肠杆菌产琥珀酸的影响", 《微生物学通报》, vol. 37, no. 3, 20 March 2010 (2010-03-20), pages 325 - 330 *
于丽等: "产琥珀酸重组大肠杆菌的发酵性能研究", 《中国生物工程杂志》, vol. 30, no. 9, 31 December 2010 (2010-12-31), pages 43 - 48 *
谢鑫等: "产丁二酸工程菌的构建及其厌氧发酵", 《生物工程学报》, vol. 24, no. 1, 25 January 2008 (2008-01-25), pages 101 - 105 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110951660A (en) * 2019-12-19 2020-04-03 江南大学 Fixed CO2Construction and application of malic acid-producing escherichia coli engineering bacteria
CN110951660B (en) * 2019-12-19 2021-12-03 江南大学 Construction and application of Escherichia coli engineering bacterium for producing malic acid by fixing CO2

Also Published As

Publication number Publication date
CN102296082A (en) 2011-12-28
WO2013010483A1 (en) 2013-01-24

Similar Documents

Publication Publication Date Title
CN102618477A (en) Construction method of escherichia coli genetic engineering bacteria for producing succinic acid by utilizing xylose metabolism
Sun et al. Efficient production of lactic acid from sugarcane molasses by a newly microbial consortium CEE-DL15
CN102329765B (en) XZ-A26 bacterial strain for producing L-alanine with high yield as well as construction method and application of XZ-A26 bacterial strain
CN101255405B (en) Novel constructed high-yield malic acid gene engineering bacterium and method for producing malic acid by using same
CN101240259B (en) Newly constructed high-yield fumaric acid genetic engineering bacteria and method for producing fumaric acid by using same
CN103045528B (en) Engineering bacteria producing DL-alanine and method of producing DL-alanine by using engineering bacteria
CN104046577A (en) Gene engineering bacterium for producing malic acid and construction and application thereof
CN107022515B (en) Genetically engineered bacterium for producing L-aspartic acid by utilizing anaerobic fermentation of lignocellulose hydrolysate and construction method and application thereof
Assavasirijinda et al. Efficient fermentative production of polymer-grade d-lactate by an engineered alkaliphilic Bacillus sp. strain under non-sterile conditions
CN102154339A (en) Construction method of gene engineering strain for producing succinic acid escherichia coli
CN102399738B (en) Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium
CN102102086A (en) L-lactate dehydrogenase gene-deleted engineering bacterium and construction method and application thereof
CN102994439A (en) Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof
CN102533626A (en) Genetic engineering strain for producing succinic acid by using glucose and fermentation acid production method thereof
CN106434510A (en) Genetically engineered bacterium for producing L-aspartic acid through fermentation
CN103865869A (en) Genetically engineered bacterium for producing alpha-ketobutyric acid and application of genetically engineered bacterium
CN105543214A (en) Construction method and applications of metabolic engineering escherichia coli strain for producing succinic acid by using acetic acid
CN102643774B (en) Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium
CN102864116B (en) Gene engineering bacterium for producing succinic acid and construction and application thereof
CN102604880A (en) Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium
CN102517303B (en) Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof
CN104974946B (en) Recombination bacillus coli resistant to high osmotic pressure and its application
CN102643775A (en) Gene engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of gene engineering bacterium
CN103509747B (en) A kind of Corynebacterium glutamicum engineering bacteria of high-yield succinic and construction process thereof
CN103898089A (en) Strain capable of highly producing L-alanine and tolerant to tap water and construction method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20120801