CN102586324A - Construction method of cell for gene therapy and obtained cell - Google Patents
Construction method of cell for gene therapy and obtained cell Download PDFInfo
- Publication number
- CN102586324A CN102586324A CN201210013934XA CN201210013934A CN102586324A CN 102586324 A CN102586324 A CN 102586324A CN 201210013934X A CN201210013934X A CN 201210013934XA CN 201210013934 A CN201210013934 A CN 201210013934A CN 102586324 A CN102586324 A CN 102586324A
- Authority
- CN
- China
- Prior art keywords
- gene
- cell
- screening
- recognition sequence
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a construction method of a cell which can be used for gene therapy. The method comprises the following steps of: constructing a repair vector with normal genes and a homologous knockout vector; knocking out disease genes of iPSC of a patient by using the knockout vector; and performing recombinant repair on the iPSC by using the repair vector to obtain the iPSC cell for the gene therapy. The method can quickly repair a plurality of multiple types of gene mutations in the cells.
Description
Technical field
The present invention relates to a kind of construction process that is used for the cell of gene therapy, and use this method to make up the cell that obtains.
Background technology
Gene therapy is a kind of emerging physics that is different from conventional medicament treatment and operative treatment.Mainly be meant the engineered means of utilizing, transform genetic information, change disease table shape thereby play, the effect of treatment disease.Since last century first, example was utilized the gene therapy that adenovirus carrier carries out, this technology was used widely at global biomedical sector.Though FDA does not ratify gene therapy as yet, clinical prospect is still very wide.
The target of gene therapy mainly is a heredopathia, or claims molecular disease, and the genetic information that refers to the patient changes.Common molecular disease comprises thalassemia, myasthenia gravis etc.
Existing gene therapy main policies is virus therapy or nucleic acid therapy.Specifically, adenovirus is used the widest.The adenoviral gene group is of moderate size, easy handling; Simultaneously adenovirus has non-genomic group conformability, can not duplicate and synchronization replication with host genome, compares with slow virus or retrovirus and has improved SF greatly.Cell is the natural host of virus, so the more conventional transfection means of gene expression efficiency are high.The nucleic acid therapy mainly is antisense nucleic acid and small molecules siRNA medicine.Because this type of RNA molecule is little, is easy to administration, it is convenient, safe to store, and existing part is able to listing through the FDA annotations and comments.
Existing gene therapy method, general expression has the albumen of normal function in vivo through introducing foreign vector or nucleic acid, or makes Disease-causing gene reticent, to realize gene therapy purpose.
These therapies or preparation can't be normal cell with the cytothesis that contains Disease-causing gene all, realize gene therapy truly.Owing to can't mutator gene be revised, also just can't realize normal protein expression regulation and control, also there is certain risk in existing gene therapy.Though the SiRNA security is higher, it is of limited application, and needs long-term prescription, and this has also increased the weight of client's economic pressures.
Summary of the invention
One object of the present invention is to provide a kind of construction process that is used for the cell of gene therapy.
Another object of the present invention is to provide and adopts aforesaid method to make up the cell that obtains.
A further object of the present invention is to provide a kind of construction process that is used to can be used for the cell of β-thalassemia treatment.
The technical scheme that the present invention taked is:
A kind of construction process that is used for the cell of gene therapy comprises the steps:
1) with introducing the recombinase recognition sequence in the carrier, between recognition sequence, inserts the normal gene sequence, obtain repair vector;
2) normal gene sequence and linearizing restriction enzyme site are introduced in the carrier, obtained the homology knockout carrier;
3) with the knockout carrier linearizing, add the sequence-specific Zinc finger nuclease of homology normal gene, the iPSC of cotransfection Disease-causing gene knocks out the mutator gene among the iPSC, filters out the positive iPSC cell that at least one homeotic mutation gene is knocked out;
4) the carrier corotation of repair vector, express recombinant enzyme is gone into the iPSC cell that screening obtains,, carry out the displacement reparation of gene, obtain can be used for the positive iPSC cell of gene therapy based on recombinase recognition sequence and recombinase.
Preferably, also be connected with screening-gene in the repair vector.
Preferably, homology knocks out between the normal gene sequence of carrying and the linearizing restriction enzyme site and is inserted with the recombinase recognition sequence, is connected with screening-gene between the recombinase recognition sequence.
Preferably, screening-gene is an antibiotics resistance gene.
Preferably, the screening-gene both sides are provided with the recombinase recognition sequence.
Preferably, repair vector is made up of two kinds of different repair vectors, and the difference of two kinds of repair vectors is that its screening-gene is different.
Preferably, knockout carrier is made up of two kinds of different knockout carriers, and the difference of two kinds of knockout carriers is that its screening-gene is different.
A kind of construction process that can be used for the cell of β-thalassemia treatment comprises the steps:
1) first group of recombinase recognition sequence is inserted in the carrier; Between two recognition sequences, insert normal beta-thalassemia globin gene; Between recognition sequence and normal beta-thalassemia globin gene, insert second group of recombinase recognition sequence; Be inserted with the resistance screening gene in second group of recombinase sequence, it is right that this obtains repair vector, and the difference between the repair vector only is that its resistance screening gene is different;
2) 5 ' arm and the 3 ' arm with linearizing enzyme, β-thalassemia globin gene is inserted in the carrier; Between 5 ' arm and 3 ' arm, insert first group of recombinase recognition sequence; Be inserted with second group of recombinase recognition sequence between first group of recombinase recognition sequence; Be inserted with screening-gene between second group of recombinase recognition sequence; Also be inserted with the GFP sequence between first group and second group of recombinase recognition sequence, obtain 2 homology knockout carriers, the difference between 2 homology knockout carriers only is that its screening-gene is different;
3) with the linearizing of homology knockout carrier; Add the β-sequence-specific zinc fat of thalassemia globin gene nucleicacidase; Change β-thalassemia patient's iPSC jointly over to; Add the screening factor screening and go out the iPSC that morbific β-the thalassemia globin gene is all knocked out, obtain positive iPSC;
4) go into to screen the carrier corotation of repair vector, first group of recombinase of expression among the positive iPSC that obtains; Carry out recombinational repair; Filter out the positive colony cell strain, this cell strain is through increasing, inducing differentiation can obtain being used to treat β-thalassemic hemopoietic stem cell.
Preferably, filter out after the positive colony cell strain, knock out screening-gene wherein.
The invention has the beneficial effects as follows:
The inventive method can be quick; Easy obtain a large amount of iPSC that can be used for gene therapy; The different iPSC cells that has Disease-causing gene can adopt essentially identical method to make up and obtain; Avoided effectively having significantly reduced the difficulty of the cell that can be used for gene therapy to specified disease design particular build method.
Use method of the present invention, can be in the external reparation of carrying out the sudden change of multidigit point gene simultaneously, like the point mutation of multidigit point; Deletion mutantion etc.; Can repair patient's stem cell in spite of illness fast and effectively, the cell after repairing after inducing to unipotent stem cell, is fed back to the patient and can effectively treats corresponding gene-correlation disease; Overcome the prior art complicated operation, defective such as remediation efficiency is low.
It is induced to after the corresponding unipotent stem cell, be re-introduced in the human body, can accomplish gene therapy.Can alleviate patient's burden effectively.Because what use is patient's self iPSC cell, when carrying out gene therapy, the harm of having avoided using heterogenous cell or carrier to cause human body.Cell after the reparation receives the regulation and control identical with normal cell, has avoided gene overexpression or has expressed defect of insufficient.
Description of drawings
Fig. 1: No. 1 deletion carrier synoptic diagram of practicing shooting;
Fig. 2: No. 2 deletion carrier synoptic diagram of practicing shooting;
Fig. 3: No. 1 repair vector synoptic diagram;
Fig. 4: No. 2 repair vector synoptic diagram;
Fig. 5: No. 3 repair vector synoptic diagram;
Fig. 6: No. 4 repair vector synoptic diagram.
Embodiment
A kind of construction process that is used for the cell of gene therapy comprises the steps:
1) with introducing the recombinase recognition sequence in the carrier, between recognition sequence, inserts the normal gene sequence, obtain repair vector;
2) normal gene sequence and linearizing restriction enzyme site are introduced in the carrier, obtained the homology knockout carrier;
3) with the knockout carrier linearizing, add the sequence-specific Zinc finger nuclease of homology normal gene, the iPSC of cotransfection Disease-causing gene knocks out the mutator gene among the iPSC, filters out the positive iPSC cell that at least one homeotic mutation gene is knocked out;
4) the carrier corotation of repair vector, express recombinant enzyme is gone into the iPSC cell that screening obtains,, carry out the displacement reparation of gene, obtain can be used for the positive iPSC cell of gene therapy based on recombinase recognition sequence and recombinase.
Preferably, also be connected with screening-gene in the repair vector.
Preferably, homology knocks out between the normal gene sequence of carrying and the linearizing restriction enzyme site and is inserted with the recombinase recognition sequence, is connected with screening-gene between the recombinase recognition sequence.
Through inserting screening-gene, can filter out needed positive cell easily through screening conditions are set, simplified the difficulty of screening greatly.
Preferably, screening-gene is an antibiotics resistance gene, so just can simply usually filter out needed cell through in substratum, adding corresponding antibiosis.
Preferably, the screening-gene both sides are provided with the recombinase recognition sequence.Like this can be simply through adding the carrier of recombinase or express recombinant enzyme; Screening-gene between the reorganization enzyme recognition sequence is replaced; Greatly reduce repair vector, the workload when knockout carrier makes up, help replacing fast, easily different screening-genes.
Preferably, repair vector is made up of two kinds of different repair vectors, and the difference of two kinds of repair vectors is that its screening-gene is different.
Preferably; Also be inserted with fluorescence protein gene in repair vector and/or the homology knockout carrier, can judge whether needed nucleotide sequence expresses simply through fluoroscopic examination like this; And then filter out needed cell, perhaps select the cell that can better express after the reparation.
Preferably, knockout carrier is made up of two kinds of different knockout carriers, and the difference of two kinds of knockout carriers is that its screening-gene is different.
Through using different screening-genes, add multiple screening conditions simultaneously, can obtain homologous gene easily all by the cell of deletion or reparation.
For avoiding with screening-gene, particularly cause potential harm in the antibiotics resistance gene introducing patient body, the screening-gene in the positive iPSC cell that finally obtains is knocked out.
A kind of construction process that can be used for the cell of β-thalassemia treatment comprises the steps:
1) first group of recombinase recognition sequence is inserted in the carrier; Between two recognition sequences, insert normal beta-thalassemia globin gene; Between recognition sequence and normal beta-thalassemia globin gene, insert second group of recombinase recognition sequence; Be inserted with the resistance screening gene in second group of recombinase sequence, it is right that this obtains repair vector, and the difference between the repair vector only is that its resistance screening gene is different;
2) 5 ' arm and the 3 ' arm with linearizing enzyme, β-thalassemia globin gene is inserted in the carrier; Between 5 ' arm and 3 ' arm, insert first group of recombinase recognition sequence; Be inserted with second group of recombinase recognition sequence between first group of recombinase recognition sequence; Be inserted with screening-gene between second group of recombinase recognition sequence; Also be inserted with the GFP sequence between first group and second group of recombinase recognition sequence, obtain 2 homology knockout carriers, the difference between 2 homology knockout carriers only is that its screening-gene is different;
3) with the linearizing of homology knockout carrier; Add the β-sequence-specific zinc fat of thalassemia globin gene nucleicacidase; Change β-thalassemia patient's iPSC jointly over to; Add the screening factor screening and go out the iPSC that morbific β-the thalassemia globin gene is all knocked out, obtain positive iPSC;
4) go into to screen the carrier corotation of repair vector, first group of recombinase of expression among the positive iPSC that obtains; Carry out recombinational repair; Filter out the positive colony cell strain, this cell strain is through increasing, inducing differentiation can obtain being used to treat β-thalassemic hemopoietic stem cell.
Preferably, filter out after the positive colony cell strain, knock out screening-gene wherein.
Below in conjunction with embodiment, further specify the present invention.
The structure that can be used for the cell of β-thalassemia treatment:
The structure of homology knockout carrier:
(1)With pDREV0 is masterplate; Directly Loxp2272 and Loxp511 are added to deletion carrier element Venus-Rox-Puro+-Rox both sides through PCR method; And adding Sfi1 forms the structure of Sfi1A-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-Sfi1B; And be connected into p-simple-18T Vector, form 18T-Sfi1A-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-Sfi1B.
The PCR primer, Forward:5'-GGCCATTACGGCCATAACTTCGTATAGGATACTTTATACGAAGTTAT-3' (SEQ ID NO:1)
RE:?5'-?GGCCGCCCTGGCCATAACTTCGTATAGTATACATTATACGAAGTTATGGCGCGCCTAAC-3'（SEQ?ID?NO：2）
1. PCR system:
Kod plus PCR (Kod and reaction reagent thereof are Japan's mill Company products).
Kod?buffer 5μl
MgCl2?(2mM) 2μl
dNTP?(2mM) 5μl
For?primer 2μl
Re?primer 2μl
Kod enzyme 2 μ l
H
2O 31μl
Masterplate 1 μ l
Total 50μl
95℃?2min,?94℃?30?sec,68℃?5min,?30cycle。
2. tail end adds T system (Premix Extaq and reaction reagent thereof are the Takara Company products):
Premix?Extaq: 25μl
Kod?PCR?products 25μl
Total 50μl
95℃?5min,?72℃?20min.
3. p-simple-18T linked system (p-simple-18T and reaction reagent thereof are the Takara Company products):
P-simple-18T 1μl
Solution?1 5μl
Add T product 4 μ l
Total 10μl
16℃，2h。
Utilize the Sal1-Bgl II of PB-Sal1-CAG-Bgl II-Sfi1A-CM-Sfi1B-Mlu1-EcoR1 carrier 5 '; 3 ' Mlu1-EcoR1; Respectively with the 986-bp homology arm at β-globin gene coding region initiation site ATG upper reaches; The homology arm of termination site TAA downstream 898-bp pack into Sal1-Bgl II zone and Mlu1-EcoR1 introduce Nhe1 and Asisl 5 ' simultaneously, form PB-Sal1-Nhe1-Asis1-5 ' Arm-Bgl II-Sfi1A-CM-Sfi1B-Mlu1-3 ' Arm-EcoR1.
(1) enzyme is cut system (restriction endonuclease and reaction reagent thereof are the Takara Company products):
EcoR1/Sal1 2μl
BglⅡ/Mlu1 2μl
H?buffer 5μl
PCR fragment/carrier 20 μ l
H
2O 21μl
37℃，4h。
(2) fragment linked system (ligation reagent is the Takara Company products):
PCR fragment 4 μ l
Carrier 1 μ l
Solution1 5μl
16℃，?2h。
(3)Utilize Sfi1A, Sfi1B enzyme site; Loxp2272-Venus-Rox-Puro+-Rox-Loxp511 in (1) is cloned into intermediate carrier PB-Sal1-Nhe1-Asis1-5 ' Arm-Bgl II-Sfi1A-CM-Sfi1B-Mlu1-3 ' Arm-EcoR1 carrier, forms PB-Sal1-Nhe1-Asis1-5 ' Arm-Bgl II-Sfi1A-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-Sfi1B-Mlu1-3 ' Arm-EcoR1.
1. enzyme is cut system (restriction endonuclease and reaction reagent thereof are the Takara Company products):
Sfi1 5μl
H?buffer 5μl
Fragment/carrier 20 μ l
H
2O 20μl
56℃，8h.
2. fragment linked system (ligation reagent is the Takara Company products):
Fragment 4 μ l
Carrier 1 μ l
Solution1 5μl
16℃，?2h。
(4)The carrier Nhe1-EcoR1 enzyme that (3) form is at last cut; Be connected into pl253/Spe1-EcoR1, finally form the deletion carrier of β-globin gene coding region: Asis1-5 ' Arm-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-3 ' Arm-PGK-dTK; Utilize the Rox sequence and the BAD-Dre engineering bacteria of this deletion carrier Puro+ both sides, change Puro+ into Neo+, form 2 deletion carriers.Finally:
No. 1: Asis1-986bp-5 ' Arm-Sfi1A-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-Sfi1B-3 ' Arm-PGK-dTK
(Fig. 1)
No. 2: Asis1-986bp-5 ' Arm-Sfi1A-Loxp2272-Venus-Rox-Neo+-Rox-Loxp511-Sfi1B-3 ' Arm-PGK-dTK
(Fig. 2)
1. enzyme is cut system (restriction endonuclease and reaction reagent thereof are the Takara Company products):
Nhe1/Spe1 2μl
EcoR1 2μl
H?buffer 5μl
Fragment/carrier 20 μ l
H2O 21μl
37℃，4h.
2. fragment linked system (ligation reagent is the Takara Company products):
Fragment 4 μ l
Carrier 1 μ l
Solution1 5μl
16℃，?2h。
3. BAD-Dre transformation system:
To contain the BAD-Dre engineering bacteria earlier and be prepared into competent cell; Change pl253-Asis1-5 ' Arm-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511-3 ' Arm-PGK-dTK carrier over to engineering bacillus afterwards; 32 ℃ add the expression 2 hours that 100 μ g/ml pectinoses are induced Dre, receive bacterium afterwards and with the frozen water repetitive scrubbing, change competence to be prepared into electricity; Competence is changeed in Rox-Neo-Rox sheet outage, and 37 ℃ get final product at A+, K+ resistance chart board.
The structure of repair vector:
(5)Utilize the Pac1-Rsr II of Venus reading frame both sides among (1) 18T-Loxp2272-Venus-Rox-Puro+-Rox-Loxp511; Gene (containing intron) and the β-globin cDNA of correct β-globin are inserted Pac1-Rsr II zone; Replace the Venus gene simultaneously, form 18T-Loxp2272-hBB cDNA (gene)-Rox-Puro+-Rox-Loxp511.Utilize the Rox sequence and the BAD-Dre engineering bacteria of this carrier Puro+ both sides afterwards, change Puro+ into Zeocin+ and Hygro+, finally form 4 repair vectors of β-globin correct gene:
No. 1: 18T-Sfi1A-Loxp2272-hBB cDNA-Rox-Zeocin+-Rox-Loxp511-Sfi1B
(Fig. 3)
No. 2: 18T-Sfi1A-Loxp2272-hBB cDNA-Rox-Hygro+-Rox-Loxp511-Sfi1B
(Fig. 4)
No. 3: 18T-Sfi1A-Loxp2272-hBB gene (intron)-Rox-Zeocin+-Rox-Loxp511-Sfi1B
(Fig. 5)
No. 4: 18T-Sfi1A-Loxp2272-hBB gene (intron)-Rox-Hygro+-Rox-Loxp511-Sfi1B
(Fig. 6)
The PCR primer:
hbbF3:?5'?–CGCCGGACCGCCACCATGGTGCATCTGACTCCTG-3'（SEQ?ID?NO：3）
hbbR3:?5'-ACGTTAATTAACTTAGTGATACTTGTGGGCCAG-3'（SEQ?ID?NO：4）
1. PCR system:
Premix?Extaq 25μl
For?primer 2μl
Re?primer 2μl
Masterplate 1 μ l
H2O 20μl
Total 50μl
95℃?5min,?94℃?40?sec,55℃?40?sec,?72℃?1.5min,?30cycle.
2. enzyme is cut system (restriction endonuclease and reaction reagent thereof are the NEB Company products):
Pac1 2μl
RsrⅡ 2μl
1?buffer 5μl
Fragment/carrier 20 μ l
H2O 21μl
37℃，6h.
3. linked system: the same.
4. the BAD-Dre transformation system is the same.
(6)Repair vector No. 1, No. 2, No. 3, No. 4 is connected among the PB-CAG-Sfi1A-CM-Sfi1B with Sfi1, utilizes the CAGG promoter on this carrier, the β-globin that detects 4 repair vectors expresses situation.
The clockwise HEK293 cell of several carriers more than inciting somebody to action, collecting cell albumen carries out the proteic western Blot analysis of β-globin after 24 hours, and the result shows that it can give expression to albumen.
(7)The Asis1 linearizing is used in No. 1, formation in (4) and No. 2 mutator genes deletion carriers; Add simultaneously and express the sequence-specific zinc fat of β-globin nucleicacidase; Common electricity changes β-thalassemia patient's iPSC; At Puromycin, carry out the screening of forward and negative sense in Neomycin and the gancyclovir substratum afterwards.
1. be linearizing system (restriction endonuclease and reaction reagent thereof are the NEB Company products):
Asis1 4μl
4?buffer 5μl
Carrier 20 μ l
H
2O 21μl
37℃，6h.
2. electricity changes and the screening system:
Linearizing target practice DNA amount: 30 μ g, Zinc finger nuclease expression vector 30 μ g.Electroporation model: Bio-Rad Gene Pulser (Cat.No.165-2105); Electroporation conditions: voltage 240 v, electric capacity 500 μ F, conduction time 8-9.5ms.The colony screening condition: 300 μ g/ml G418,1 μ g/ml puromycin and 2 μ M GanC screened 8 days
(8)The iPSC that (7) are filtered out clones the evaluation of carrying out PCR and order-checking; Seek the clone strain that the β-globin of two homologous chromosomess sudden change is deleted; Repair vector while electricity with two different resistances changes positive iPSC clone strain on this basis, changes identification and displacement reparation that the recombinant plasmid PB-CAG-Cre that expresses Cre carries out Loxp2272 and Loxp511 simultaneously over to.Zeocin+ and Hygro+ resistance screening, the positive colony cell strain is selected in the negative screening of Puromycin+ and Neomycin+.
Electricity changes and the screening system: linearizing target practice DNA amount: 30 μ g, Cre expression plasmid 30 μ g.Electroporation model: Bio-Rad Gene Pulser (Cat.No.165-2105); Electroporation conditions: voltage 240 v, electric capacity 500 μ F, conduction time 8-9.5ms.Colony screening condition: 2 μ g/ml Zeocin+, 2 μ g/ml Hygro+ screening.
(9)Utilize PCR and order-checking, identify whether the clone that is sieved to is the iPS clone after correct the reparation, and will repair correct iPS and induce and break up to hemopoietic stem cell.Through experimental verification, the function of differentiation gained hemocyte obtains to correct.
< 110>Chinese Academy of Sciences Guangzhou Institute of Biomedicine and Health
< 120>a kind of preparation method of the cell that is used for gene therapy and the cell that makes
<130>
<160> 4
<170> PatentIn?version?3.5
<210> 1
<211> 47
<212> DNA
< 213>artificial primer
<400> 1
ggccattacg?gccataactt?cgtataggat?actttatacg?aagttat 47
<210> 2
<211> 59
<212> DNA
< 213>artificial primer
<400> 2
ggccgccctg?gccataactt?cgtatagtat?acattatacg?aagttatggc?gcgcctaac 59
<210> 3
<211> 34
<212> DNA
< 213>artificial primer
<400> 3
cgccggaccg?ccaccatggt?gcatctgact?cctg 34
<210> 4
<211> 33
<212> DNA
< 213>artificial primer
<400> 4
acgttaatta?acttagtgat?acttgtgggc?cag 33
Claims (10)
1. a construction process that is used for the cell of gene therapy comprises the steps:
1) with introducing the recombinase recognition sequence in the carrier, between recognition sequence, inserts the normal gene sequence, obtain repair vector;
2) normal gene sequence and linearizing restriction enzyme site are introduced in the carrier, obtained the homology knockout carrier;
3) with the knockout carrier linearizing, add the sequence-specific Zinc finger nuclease of homology normal gene, the iPSC of cotransfection Disease-causing gene knocks out the mutator gene among the iPSC, filters out the positive iPSC cell that at least one homeotic mutation gene is knocked out;
4) the carrier corotation of repair vector, express recombinant enzyme is gone into the iPSC cell that screening obtains,, carry out the displacement reparation of gene, obtain can be used for the positive iPSC cell of gene therapy based on recombinase recognition sequence and recombinase.
2. a kind of construction process that is used for the cell of gene therapy according to claim 1 is characterized in that: also be connected with screening-gene in the repair vector.
3. a kind of construction process that is used for the cell of gene therapy according to claim 1; It is characterized in that: homology knocks out between the normal gene sequence of carrying and the linearizing restriction enzyme site and is inserted with the recombinase recognition sequence, is connected with screening-gene between the recombinase recognition sequence.
4. according to claim 2 or 3 described a kind of construction processs that are used for the cell of gene therapy, it is characterized in that: screening-gene is an antibiotics resistance gene.
5. according to claim 2 or 3 described a kind of construction processs that are used for the cell of gene therapy, it is characterized in that: the screening-gene both sides are provided with the recombinase recognition sequence.
6. according to claim 2 or 4 described a kind of construction processs that are used for the cell of gene therapy, it is characterized in that: repair vector is made up of two kinds of different repair vectors, and the difference of two kinds of repair vectors is that its screening-gene is different.
7. according to claim 3 or 4 described a kind of construction processs that are used for the cell of gene therapy, it is characterized in that: knockout carrier is made up of two kinds of different knockout carriers, and the difference of two kinds of knockout carriers is that its screening-gene is different.
8. adopt the said method of above-mentioned any claim to make up the cell that obtains.
9. a construction process that can be used for the cell of β-thalassemia treatment comprises the steps:
1) first group of recombinase recognition sequence is inserted in the carrier; Between two recognition sequences, insert normal beta-thalassemia globin gene; Between recognition sequence and normal beta-thalassemia globin gene, insert second group of recombinase recognition sequence; Be inserted with the resistance screening gene in second group of recombinase sequence, it is right that this obtains repair vector, and the difference between the repair vector only is that its resistance screening gene is different;
2) 5 ' arm and the 3 ' arm with linearizing enzyme, β-thalassemia globin gene is inserted in the carrier; Between 5 ' arm and 3 ' arm, insert first group of recombinase recognition sequence; Be inserted with second group of recombinase recognition sequence between first group of recombinase recognition sequence; Be inserted with screening-gene between second group of recombinase recognition sequence; Also be inserted with the GFP sequence between first group and second group of recombinase recognition sequence, obtain 2 homology knockout carriers, the difference between 2 homology knockout carriers only is that its screening-gene is different;
3) with the linearizing of homology knockout carrier; Add the β-sequence-specific zinc fat of thalassemia globin gene nucleicacidase; Change β-thalassemia patient's iPSC jointly over to; Add the screening factor screening and go out the iPSC that morbific β-the thalassemia globin gene is all knocked out, obtain positive iPSC;
4) go into to screen the carrier corotation of repair vector, first group of recombinase of expression among the positive iPSC that obtains; Carry out recombinational repair; Filter out the positive colony cell strain, this cell strain is through increasing, inducing differentiation can obtain being used to treat β-thalassemic hemopoietic stem cell.
10. a kind of construction process that can be used for the cell of β-thalassemia treatment according to claim 9 is characterized in that: filter out after the positive colony cell strain, knock out screening-gene wherein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210013934.XA CN102586324B (en) | 2012-01-17 | 2012-01-17 | Construction method of cell for gene therapy and obtained cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210013934.XA CN102586324B (en) | 2012-01-17 | 2012-01-17 | Construction method of cell for gene therapy and obtained cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102586324A true CN102586324A (en) | 2012-07-18 |
| CN102586324B CN102586324B (en) | 2015-01-28 |
Family
ID=46475548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210013934.XA Expired - Fee Related CN102586324B (en) | 2012-01-17 | 2012-01-17 | Construction method of cell for gene therapy and obtained cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102586324B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109563479A (en) * | 2016-05-25 | 2019-04-02 | 约翰霍普金斯大学 | The cytode of engineering as novel biological agent delivery platform and extracellular vesica |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101412999A (en) * | 2008-12-02 | 2009-04-22 | 唐冬生 | A kind of gene targeting locus-specific transgenic method and application thereof |
| CN101693902A (en) * | 2009-10-16 | 2010-04-14 | 南开大学 | Construction method of conditional gene knockout carrier |
| CN102234628A (en) * | 2011-05-06 | 2011-11-09 | 中国科学院广州生物医药与健康研究院 | CCR5 deleted hematopoietic stem cell, preparation method and application thereof |
| CN101418292B (en) * | 2007-10-24 | 2012-01-11 | 上海市儿童医院 | Method for preparing beta IVS-II-654 transgene mouse model carrying human beta globin gene |
-
2012
- 2012-01-17 CN CN201210013934.XA patent/CN102586324B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418292B (en) * | 2007-10-24 | 2012-01-11 | 上海市儿童医院 | Method for preparing beta IVS-II-654 transgene mouse model carrying human beta globin gene |
| CN101412999A (en) * | 2008-12-02 | 2009-04-22 | 唐冬生 | A kind of gene targeting locus-specific transgenic method and application thereof |
| CN101693902A (en) * | 2009-10-16 | 2010-04-14 | 南开大学 | Construction method of conditional gene knockout carrier |
| CN102234628A (en) * | 2011-05-06 | 2011-11-09 | 中国科学院广州生物医药与健康研究院 | CCR5 deleted hematopoietic stem cell, preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 罗庆苗等: "转基因动物新技术研究进展", 《遗传》, vol. 33, no. 5, 31 May 2011 (2011-05-31), pages 449 - 458 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109563479A (en) * | 2016-05-25 | 2019-04-02 | 约翰霍普金斯大学 | The cytode of engineering as novel biological agent delivery platform and extracellular vesica |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102586324B (en) | 2015-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200155606A1 (en) | Crispr/rna-guided nuclease systems and methods | |
| US20210254061A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| Jang et al. | An evolved adeno-associated viral variant enhances gene delivery and gene targeting in neural stem cells | |
| US20200340012A1 (en) | Crispr-cas genome engineering via a modular aav delivery system | |
| US20200157515A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| CA3071769A1 (en) | Cellular models of and therapies for ocular diseases | |
| CN109689865A (en) | BCL11A homing endonuclease variants, composition and application method | |
| KR20130097156A (en) | Transgenic animals and methods of use | |
| CA2948728A1 (en) | Crispr/cas-related methods and compositions for treating leber's congenital amaurosis 10 (lca10) | |
| US20240344085A1 (en) | Altering tissue tropism of adeno-associated viruses | |
| US20220073951A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| CN108291216A (en) | The composition and method of disease for treating complement-mediated | |
| CN107746859B (en) | Hematopoietic stem cell gene modification method of targeted hemoglobin HBB mutant gene | |
| JP2021500070A5 (en) | ||
| WO2019134561A1 (en) | High efficiency in vivo knock-in using crispr | |
| CN112359065A (en) | Small molecule composition for improving gene knock-in efficiency | |
| CA3109114A1 (en) | Non-disruptive gene therapy for the treatment of methaylmalonic aciduria | |
| CN111718420B (en) | Fusion protein for gene therapy and application thereof | |
| JP2023551873A (en) | RNA targeting compositions and methods for treating CAG repeat disease | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| AU2019230210A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| CN111601620A (en) | Adeno-associated virus gene therapy for 21-hydroxylase deficiency | |
| CN102586324B (en) | Construction method of cell for gene therapy and obtained cell | |
| CN109536494A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| WO2014114934A1 (en) | Methods for improving the efficiency of gene targeting |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150128 Termination date: 20160117 |
|
| EXPY | Termination of patent right or utility model |