CN102586308A - Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof - Google Patents
Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof Download PDFInfo
- Publication number
- CN102586308A CN102586308A CN2012100596063A CN201210059606A CN102586308A CN 102586308 A CN102586308 A CN 102586308A CN 2012100596063 A CN2012100596063 A CN 2012100596063A CN 201210059606 A CN201210059606 A CN 201210059606A CN 102586308 A CN102586308 A CN 102586308A
- Authority
- CN
- China
- Prior art keywords
- seq
- genetically engineered
- standard plasmid
- strain
- plasmid molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and an application thereof. A standard plasmid molecule applicable to genetically modified soybean DP-305423 strain specificity detection is constructed, the standard plasmid module comprises specificity sequences of the genetically modified soybean DP-305423 strain and soybean endogenesis standard gene Lectin specificity segment, and verification on applicability of the standard plasmid molecule in genetically modified soybean PCR (polymerase chain reaction) detection shows that the standard plasmid molecule is highly specific to detection on the genetically modified soybean DP-305423 strain.
Description
Technical field
The present invention relates to standard plasmid molecule and the application thereof of a kind of specific detection genetically engineered soybean DP-305423, belong to technical field of biological.
Background technology
In recent years, genetically modified crops such as corn, soybean, rape, cotton, tomato allow plantation and production in many countries, and are widely used as processing raw material of food or feed.Because transgenic product exists a series of problems such as ecological risk and food safety; Therefore; The corresponding security control rules of the numerous and confused formulation of countries in the world government and relevant international organization, the standardized administration of reinforcement genetic improvement crop, and to genetic improvement crop and products thereof enforcement sign system.China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001, and has announced agriculture genetically modified organism safety evaluation, sign and three supporting management ways of import security management on January 5th, 2002.In order to tackle genetic improvement crop management relevant laws and regulations and system, foundation is efficient, quick, specific detection technology is very necessary, and it is the strong technical support of each international organization and national management genetic improvement crop.
The transgenic product detection method that has developed at present also widespread use has two types: one type of detection that is based on nucleic acid level, the another kind of immunology detection that is based on protein level.Because of having the advantage of highly sensitive and high specificity, become most important at present, most widely used genetic improvement crop and products thereof detection technique based on polymerase chain reaction (PCR) detection technique of nucleic acid.No matter adopt also to be based on method of protein based on nucleic acid, carrying out all should using reference material as positive control when transgenic detects, with guarantee testing process effectively and the safety of detected result.At present; The positive criteria material that is used for the transgenic detection mainly is to dispose with the transgenic plant material that isozygotys; Be positioned at the subordinate's of Joint Research Centre of Belgian European Union reference material and measurement Research institute (Institute for Reference Materials and Measurements, IRMM) the professional positive criteria article of preparing and being provided for the transgenic quantitative PCR detection.Up to the present only can obtain the reference material of tens kinds of genetic improvement crops of on market, selling.But this type derives from the reference material of agricultural-food; It must have particular study mechanism to prepare, and storage and mensuration process are influenced by several factors, are difficult to keep the constant amount; Cost an arm and a leg; And the transgenic content range of these reference materials generally is from 0.1% to 5%, and the transgenic content in the sample of actual detected may exceed this scope.The shortage of reference material has become the bottleneck that detection method is set up and used, has hindered the smooth implementation of transgenic product sign system.
Standard plasmid molecule is a kind of recombinant plasmid molecule, wherein generally comprises exogenous genetic fragment or strain specificity fragment and species specificity fragment that genetically modified crops detect.The advantage of standard plasmid molecule mainly is to cultivate in a large number through mikrobe, and purity is higher; And processing ease, stability is high, and same standard molecule can comprise a plurality of external source goal gene and internal standard gene, economical and efficient simultaneously.In recent years, more and more receive the attention that various countries' transgenic detects expert and scholars, and replace the PCR detection that traditional positive criteria article are used for transgenic strain and converted products thereof gradually.
Genetically engineered soybean DP-305423 strain is researched and developed by Pioneer Electronic Corp., successively discharges at the U.S., Canada and Japanese three states approval environment, and ratifies to be used for food in 8 countries and regions such as Australia, Korea S, Philippines, Mexico and feed processes raw material.Though genetically engineered soybean is not planted by China, every year, all several ten million tons of genetically engineered soybeans of import were used for food or feed processes raw material.Up to now, also be not applicable to the report of the standard plasmid molecule that genetically engineered soybean DP-305423 strain detects.In order to give Chinese genetically engineered soybean strain supervision supports that provide the necessary technical, be necessary to develop and be applicable to genetically engineered soybean DP-305423 strain specificity standard plasmid molecule detection, reliable and stable.
Summary of the invention
In order to address the above problem; The invention provides standard plasmid molecule and the application thereof of a kind of specific detection genetically engineered soybean DP-305423, the object of the present invention is to provide standard plasmid molecule, its construction process and the application of specific detection genetically engineered soybean strain DP-305423.
Standard plasmid molecule provided by the present invention, it comprises following sequence fragment: the distinguished sequence fragment of the endogenous standard gene Lectin of DP-305423 strain specificity fragment and soybean.
The strain specificity sequence of described DP-305423, the dna sequence dna of exogenous insertion vector and soybean gene group adjoining region that refers to genetically engineered soybean strain DP-305423 is shown in SEQ ID NO:1.
The endogenous standard gene Lectin of said soybean specific fragment refers to the soybean agglutinin gene fragment, and its dna sequence dna is shown in SEQ ID NO:2.
The skeleton plasmid of described standard plasmid molecule is pMD18-T.
Describedly be used for the standard plasmid molecule that genetically engineered soybean detects, the primer sequence that wherein is used to make up standard plasmid molecule is (table 1) as follows:
Table 1 makes up the PCR primer of standard plasmid molecule
The described construction process that is used for the standard plasmid molecule of genetically engineered soybean detection may further comprise the steps:
Response procedures is: 94 ℃ 5 minutes; 94 ℃ of circulations below getting into then 50 seconds, 55 ℃ 50 seconds, 72 ℃ 60 seconds, totally 30 circulations; Last 72 ℃ were extended 5 minutes; Product is designated as: P
DP305423(its sequence is shown in SEQ ID No:1), P
Lectin(its sequence is shown in SEQ ID No:7);
The first step: adopting pMD18-T is the P that carrier is carrier will be gone up the step pcr amplification
DP305423(SEQ ID No:1) fragment adopts T-A clone's mode to be connected in the carrier.
Second step: use restriction enzyme
EcoR I with
BamThe H I is with P
LectinFragment (SEQ ID No:7) and contain P
DP305423Segmental pMD18-T recombinant plasmid carries out double digestion respectively; Use T then
4Ligase enzyme connects the two; Acquisition merges genetically engineered soybean strain DP-305423 strain specificity sequence fragment and the endogenous standard gene Lectin of soybean specific fragment with the standard plasmid molecule on pMD18-T; With its called after pMD-DP305423 (its sequence is shown in SEQ ID No:8), pMD-DP305423 is imported e. coli jm109 can prolonged preservation be used.
The present invention provides a kind of method that detects genetically engineered soybean DP-305423 strain simultaneously, and described method comprises: with the positive reference material of described standard plasmid molecule, the existence of measuring genetically engineered soybean DP-305423 strain in the soybean sample to be measured whether.
Concrete detection method is, adopts the method for PCR increase DP-305423 strain specificity sequence in soybean to be measured or its source sample and the endogenous standard gene Lectin of soybean specific fragment; With the amplification that obtains and same amplification condition down the amplification of the standard plasmid molecule of amplification compare, thereby the existence that obtains transgenic soybean line in soybean to be measured and the source sample thereof whether.
Description of drawings
The structural representation of Fig. 1, standard plasmid molecule pMD-DP305423."
EcoR I " represent that this site contains restriction enzyme
EcoThe restriction enzyme site of R I; "
BamHI " represent that this site contains restriction enzyme
BamThe restriction enzyme site of HI, the endogenous standard gene Lectin of " Lectin " expression soybean specific fragment; The strain specificity sequence of " DP-305423 " expression genetically engineered soybean DP-305423;
Fig. 2, standard plasmid molecule PCR specific detection.(A) with standard plasmid molecule pMD-DP305423 be the amplification of template.(B) respectively with genetically engineered soybean DP-305423, DP-356043, GTS40-3-2 strain, transgenic corns Mon810 strain and transgene cotton Mon513 strain genomic dna are the amplification of template.(C) be the amplification of template with non-transgenic soybean gene group.The M:DNA molecular weight marker; Swimming lane 1: blank; Swimming lane 2: the endogenous standard gene Lectin of soybean fragment; 3-4: genetically engineered soybean DP-305423, DP-356043, GTS40-3-2 strain specificity sequence amplification; Swimming lane 6-7: transgenic corns Mon810 and transgene cotton Mon513 strain specificity sequence amplification.
Fig. 3, the test of standard plasmid molecule PCR detection sensitivity.(A) endogenous standard gene Lectin fragment; (B) genetically engineered soybean DP-305423 strain specificity fragment.The M:DNA molecular weight marker; Swimming lane 1: blank; Swimming lane 2-7 is respectively the amplification of 10000,1000,100,50,10 and 5 copy standard molecules.
Embodiment
Be that example is done detailed explanation to the present invention below with embodiment: present embodiment provided detailed embodiment and process, but protection scope of the present invention is not limited to following embodiment being to implement under the prerequisite with technical scheme of the present invention.
Experiment material: genetically engineered soybean GTS40-3-2, DP-305423, DP-305423 strain, transgenic corns Mon810 strain, transgene cotton Mon531 is commercial strain, and has document open.The non-transgenic soybean varieties is conventional variety " Shandong beans 11 ".
Genetically engineered soybean GTS40-3-2, DP-305423, DP-305423 strain extracting genome DNA:
A, get an amount of above-mentioned genetically engineered soybean seed sample, add in the mortar, grind into powder in the presence of liquid nitrogen takes by weighing about 200mg ground sample and changes in the 2ml centrifuge tube;
B, add the extracting solution (20mM EDTA, 2% CTAB, 100mM Tris-HCl pH 8.0,1.4mol/L NaCl, 1% PVP) of 65 ℃ of preheatings of 1mL, gently behind the mixing, 65 ℃ of water bath heat preservation 30min, during between or the vibration mixing;
C, in pipe, add equal-volume phenol/chloroformic solution (24:1), the abundant mixing that turns upside down, normal temperature leaves standstill extracting 10min;
D, the centrifugal 10min of 12000rpm draw in the new centrifuge tube of supernatant to;
-20 ℃ of precooled ethanol of e, adding twice supernatant volume, mixing is placed after 30 minutes for-20 ℃, and centrifugal 10 minutes of 12000rpm removes supernatant, keeps deposition;
F, with twice of the ethanolic soln washing and precipitating of 500 μ l 70%; Be deposited under the room temperature and dry, after be dissolved in the aseptic ddH of 100 μ l
2O ,-20 ℃ of preservations are subsequent use.
The structure of embodiment 1, standard plasmid molecule
1, the information of announcing according to GenBank and other documents, the required primer of design construction standard plasmid molecule is as shown in table 1.
2, be template with genetically engineered soybean strain DP-305423 genomic dna, carry out pcr amplification with designed primer in the table 1; Reaction system is: TV is 50 μ l, 10 times PCR reaction solution 5 μ l wherein, and dNTPs 4 μ l, each 1 μ l of upstream and downstream primer (20 μ M), template 5 μ l, Taq archaeal dna polymerase 0.5 μ l uses ddH
2O complements to 50 μ l;
Response procedures is: 94 ℃ 5 minutes; 94 ℃ of circulations below getting into then 50 seconds, 55 ℃ 50 seconds, 72 ℃ 60 seconds, totally 30 circulations; Last 72 ℃ were extended 5 minutes; Product is designated as: P
DP305423(its sequence is shown in SEQ ID No:1), P
Lectin(its sequence is shown in SEQ ID No:7);
The first step: adopting pMD18-T is the P that carrier is carrier will be gone up the step pcr amplification
DP305423(SEQ ID No:1) fragment adopts T-A clone's mode to be connected in the carrier.
Second step: use restriction enzyme
EcoR I with
BamThe H I is with P
LectinFragment (SEQ ID No:7) and contain P
DP305423Segmental pMD18-T recombinant plasmid carries out double digestion respectively; Use T then
4Ligase enzyme connects the two; Acquisition merges genetically engineered soybean strain DP-305423 strain specificity sequence fragment and the endogenous standard gene Lectin of soybean specific fragment with the standard plasmid molecule on pMD18-T; With its called after pMD-DP305423 (its sequence is shown in SEQ ID No:8), pMD-DP305423 is imported e. coli jm109 according to ordinary method can prolonged preservation be used.
3, the extraction of standard plasmid molecule
Adopt the Biomiga DNA to extract test kit in a small amount, concrete steps are following:
A, configuration are suitable for the LB liquid medium of intestinal bacteria growth; In the 5ml LB nutrient solution of sterilization, add penbritin and make its final concentration reach 50 μ g/ml, add the e. coli jm109 that 50 μ l contain standard plasmid molecule pMD-DP305423 then; 37 ℃ of overnight shakings are cultivated.Get the 1-2ml overnight culture centrifugal 1 minute, thoroughly abandon supernatant in 6000rpm;
B, adding bacterium liquid 250 μ l contain the Buffer A1 solution of RNase A, with the abundant again suspension cell of thalline;
C, adding 250 μ l Buffer B1 reverse 10 times lightly to mix mixing, and static then 5min clarifies to the solution thickness;
D, adding 350 μ l Buffer N1 turn upside down for several times immediately, make it abundant mixing;
Centrifugal 10 minutes of e, room temperature 13000rpm transfer to cover with supernatant and are put in the DNA adsorption column in the 2ml collection tube, in the centrifugal 1min of room temperature 13000rpm;
F, taking-up DNA adsorption column are outwelled waste liquid in the collection tube, the DNA adsorption column is relay reclaim in the collector, add 500 μ l Buffer KB,, in the centrifugal 1min of room temperature 13000rpm; Outwell waste liquid in the collection tube, the DNA adsorption column is relay reclaim in the collector;
G, in the DNA adsorption column, add 500 μ l DNA Wash Buffer, the centrifugal 1min of room temperature 13000rpm; Outwell waste liquid in the collection tube, the DNA adsorption column is relay reclaim in the collector;
H, open pipe and cover room temperature and place and to make remaining ethanol volatilization in 5 minutes, the back adds 50 μ l Elution Buffer in DNA adsorption column film central authorities, room temperature placement 2 minutes;
I, the DNA adsorption column is put into clean 1.5ml centrifuge tube;
K, the DNA on centrifugal 1 minute wash-out film of room temperature 13000rpm.
L, the DNA-20 ℃ preservation of extracting is subsequent use.
1, specificity test
Comprise genetically engineered soybean DP-305423 strain specificity fragment and the endogenous standard gene Lectin of soybean specific fragment among the standard plasmid molecule pMD-DP305423 that utilizes the present invention to make up, so standard plasmid molecule pMD-DP305423 should be specific to above-mentioned 2 segmental detections.
With the listed primer sequence of table 2 is that primer is respectively with standard plasmid molecule pMD-DP305423, genetically modified crops DNA (genetically engineered soybean DP-356043, P-305423, GTS40-3-2 strain; Transgenic corns Mon810 strain; Transgene cotton Mon531) and non-transgenic soy bean DNA (Shandong beans 11) be the template endogenous standard gene Lectin of the transgenic specific fragment (393bp that increases respectively; SEQ ID NO:2), genetically engineered soybean DP-305423 strain specificity fragment (273bp; SEQ ID NO:1), genetically engineered soybean DP-356043 strain specificity fragment (413bp; SEQ ID NO:9), genetically engineered soybean GTS40-3-2 strain specificity fragment (362bp; SEQ ID NO:10), transgenic corns Mon810 strain specificity fragment (190bp, SEQ ID NO:11), transgene cotton Mom531 strain specificity fragment (335bp, SEQ ID NO:12).
Table 2, genetically engineered soybean detect uses primer sequence
Reaction system is: TV is 50 μ l, 10 times PCR reaction solution 5 μ l wherein, and dNTPs 4 μ l, each 1 μ l of upstream and downstream primer (20 μ M), template 5 μ l, Taq archaeal dna polymerase 0.5 μ l uses ddH
2O complements to 50 μ l;
Response procedures is: 94 ℃ 5 minutes; 94 ℃ of circulations below getting into then 50 seconds, 60-55 ℃ 50 seconds, 72 ℃ 60 seconds, totally 30 circulations; Last 72 ℃ were extended 5 minutes.
The PCR product is used 2% agarose gel electrophoresis, 100V voltage, and electrophoresis is about 30 minutes.Adopt gel imaging system to take electrophorogram.
The result is as shown in Figure 2; With standard plasmid molecule pMD-DP305423 DNA is in the amplification of template; Can in endogenous standard gene Lectin, genetically engineered soybean DP-305423 strain specificity sequence amplification, obtain tangible purpose band (A among Fig. 2), detecting with the strain specificity of genetically engineered soybean DP-356043 strain, genetically engineered soybean GTS40-3-2 strain, transgenic corns Mon810 and transgene cotton Mom531 does not have bands visible when primer increases and produces; And the corresponding positive control of each detection architecture all has the purpose band to produce (B among Fig. 2); The non-transgenic soybean can detect at endogenous standard gene Lectin has obvious visible band to produce (C among Fig. 2) when primer increases.
Therefore standard plasmid molecule pMD-DP305423 is specific to the strain specificity detection of genetically engineered soybean DP-305423.
2, detection sensitivity test
In order to identify that the standard plasmid molecule pMD-DP305423 that the present invention makes up is used for the sensitivity that PCR detects; Standard plasmid molecule pMD-DP305423 is diluted to 10000,1000,100,50,10 and 5 copy/μ l; The endogenous standard gene Lectin of soybean specific fragment (393bp) increases respectively; Genetically engineered soybean DP-305423 strain specificity fragment (413bp) confirms that with standard plasmid molecule pMD-DP305423 be the LOD values of standard substance in PCR detects.
Reaction system is: TV is 50 μ l, 10 times PCR reaction solution 5 μ l wherein, and dNTPs 4 μ l, each 1 μ l of upstream and downstream primer (20 μ M), template 5 μ l, Taq archaeal dna polymerase 0.5 μ l uses ddH
2O complements to 50 μ l;
Response procedures is: 94 ℃ 5 minutes; 94 ℃ of circulations below getting into then 50 seconds, 55 ℃ 50 seconds, 72 ℃ 60 seconds, totally 30 circulations; Last 72 ℃ were extended 5 minutes.
The PCR product is used 2% agarose gel electrophoresis, 100V voltage, and electrophoresis is about 30 minutes.Adopt gel imaging system to take electrophorogram.
Experimental result is as shown in Figure 3, and the minimum standard plasmid molecule copy number of the target fragment that can increase Lectin is 10 copies; The copy number of the segmental minimum standard plasmid molecule of the target fragment that can increase genetically engineered soybean DP-305423 strain specificity pMD-DP305423 DNA is 50 copies.Therefore standard plasmid molecule pMD-DP305423 is 10 copies as the LOD value of the detection target fragment Lectin of standard substance in PCR detects, and detecting the segmental LOD value of genetically engineered soybean DP-305423 strain specificity is 50 copies.
In sum, the positive criteria article that the standard plasmid molecule pMD-DP305423 that utilizes the present invention to make up can well substitute plant origin are used for genetically engineered soybean DP-305423 and come the product-derived strain specificity to detect.
Claims (4)
1. the standard plasmid molecule of a specific detection genetically engineered soybean DP-305423 is characterized in that its sequence is shown in SEQ ID No:8.
2. the standard plasmid molecule of a kind of specific detection genetically engineered soybean DP-305423 as claimed in claim 1 construction process, it is characterized in that may further comprise the steps:
Response procedures is: 94 ℃ 5 minutes; 94 ℃ of circulations below getting into then 50 seconds, 55 ℃ 50 seconds, 72 ℃ 60 seconds, totally 30 circulations; Last 72 ℃ were extended 5 minutes; Product is designated as: P
DP305423SEQ ID No:1, P
LectinSEQ ID No:7;
The first step: adopting pMD18-T is the P that carrier is carrier will be gone up the step pcr amplification
DP305423SEQ ID No:1 fragment adopts T-A clone's mode to be connected in the carrier;
Second step: use restriction enzyme
EcoR I with
BamThe H I is with P
LectinFragment SEQ ID No:7 with contain P
DP305423Segmental pMD18-T recombinant plasmid carries out double digestion respectively; Use T then
4Ligase enzyme connects the two; Acquisition merges genetically engineered soybean strain DP-305423 strain specificity sequence fragment and the endogenous standard gene Lectin of soybean specific fragment with the standard plasmid molecule on pMD18-T; With its called after pMD-DP305423; Its sequence is shown in SEQ ID No:8, and pMD-DP305423 is imported e. coli jm109 can prolonged preservation be used.
3. the standard plasmid molecule of a kind of specific detection genetically engineered soybean DP-305423 as claimed in claim 2 construction process, it is characterized in that described primer sequence is following:
DP305-F：ACATAATTTTGAAAGATGATTAATG SEQ?ID?NO:3
DP305-R：CAAAGCTTATATATGCCTTCCG SEQ?ID?NO:4
LN-F：CGGAATTCAAGGCAAACTCAGCGGAAAC SEQ?ID?NO:5
LN-R：CGGGATCCAGTGTCAAACTCAACAGCGAC SEQ?ID?NO:6。
4. the standard plasmid molecule of a kind of specific detection genetically engineered soybean DP-305423 as claimed in claim 1 in detecting genetically engineered soybean DP-305423 strain as the application of positive criteria material.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100596063A CN102586308A (en) | 2012-03-08 | 2012-03-08 | Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100596063A CN102586308A (en) | 2012-03-08 | 2012-03-08 | Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102586308A true CN102586308A (en) | 2012-07-18 |
Family
ID=46475533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100596063A Pending CN102586308A (en) | 2012-03-08 | 2012-03-08 | Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102586308A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063171A (en) * | 2007-05-24 | 2007-10-31 | 上海交通大学 | Standard plasmid molecule for detection of genetic improved soybean strain GTS40-3-2 and constructing method thereof |
| WO2008054747A2 (en) * | 2006-10-31 | 2008-05-08 | E. I. Du Pont De Nemours And Company | Soybean event dp-305423-1 and compositions and methods for the identification and/or detection thereof |
-
2012
- 2012-03-08 CN CN2012100596063A patent/CN102586308A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008054747A2 (en) * | 2006-10-31 | 2008-05-08 | E. I. Du Pont De Nemours And Company | Soybean event dp-305423-1 and compositions and methods for the identification and/or detection thereof |
| CN101063171A (en) * | 2007-05-24 | 2007-10-31 | 上海交通大学 | Standard plasmid molecule for detection of genetic improved soybean strain GTS40-3-2 and constructing method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 张敬平 等: "转基因大豆定量检测方法的建立", 《毒理学杂志》, vol. 22, no. 1, 28 February 2008 (2008-02-28), pages 67 - 70 * |
| 胡尚杰 等: "转基因作物筛查用阳性质粒分子的构建及应用研究", 《中国油料作物学报》, vol. 32, no. 2, 30 June 2010 (2010-06-30), pages 173 - 179 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974520B (en) | Molecular maker SIsv1118 closely linked with high gene of millet strain | |
| CN101982545B (en) | Molecular marker SIsv0053 closely linked with millet plant height genes | |
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN101724702B (en) | Standard molecule contrast for genetically modified maize detection and prepration method thereof | |
| CN106048010A (en) | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit | |
| CN103757038B (en) | Be applicable to the standard molecule of five kinds of transgenic soybean lines specific detection simultaneously | |
| CN102115754A (en) | Application of rice phosphate transport protein gene ORYsa;Pht1;4 | |
| CN105483136B (en) | A kind of wheat anti growing out gene TaZFP18 and its application | |
| CN107337720A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsNHX5 and its encoding gene and application | |
| CN104862404B (en) | The multiple PCR detection kit of two kinds of seed-borne diseases and its primer special and multi-PCR detection method on rice | |
| CN104032017B (en) | For detecting the primer pair turning G2-aroA gene herbicide-resistant corn G1105E-823C | |
| CN107384946A (en) | The artificial directed mutants of rice fecula branching enzyme SBE3 genes and its application | |
| CN102002497B (en) | Molecular mark SIsv0115 tightly interlinked with millet plant height gene | |
| CN103409433A (en) | Novel broad-spectrum rice blast resistance allele pi21t and resistance application thereof | |
| CN103509821B (en) | The application of a kind of Plant P Nutrition quick diagnosis and Visual Dynamic monitoring method and recombinant expression vector thereof | |
| CN106282338A (en) | The molecular detecting method of rice photo-thermo-sensitive male sterility pms3 and p/tms12 1 gene and molecular marker thereof | |
| CN102533832B (en) | Standard plasmid molecule for specific detection of transgenic soybeans DP-356043 and application thereof | |
| CN103045640B (en) | Plant expression vector for SGF14a gene of Tanba black soybean and application of plant expression vector | |
| CN102492777B (en) | Standard plasmid molecule for transgenic maize Mon810 detection and construction method thereof | |
| CN102286624B (en) | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite | |
| CN102586308A (en) | Standard plasmid molecule capable of specifically detecting genetically modified soybean DP-305423 and application thereof | |
| CN101812445B (en) | Kit for quickly extracting paddy DNA | |
| CN101701038A (en) | Plant low temperature growth associated protein, code genes and application thereof | |
| CN103131755A (en) | Method for rapidly detecting brassica oleracea var. italic hybrid purity by using SRAP mark | |
| CN110257545B (en) | Molecular marker for identifying hybrid paper mulberry and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120718 |