CN102586289A - Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof - Google Patents
Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof Download PDFInfo
- Publication number
- CN102586289A CN102586289A CN2011103961488A CN201110396148A CN102586289A CN 102586289 A CN102586289 A CN 102586289A CN 2011103961488 A CN2011103961488 A CN 2011103961488A CN 201110396148 A CN201110396148 A CN 201110396148A CN 102586289 A CN102586289 A CN 102586289A
- Authority
- CN
- China
- Prior art keywords
- rhodotorula glutinis
- acetyl
- coa carboxylase
- carboxylase gene
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a rhodotorula glutinis acetyl coenzyme A carboxylase gene and coded protein thereof and a clone method and a function verification method of the gene. A nucleotide sequence of the rhodotorula glutinis acetyl coenzyme A carboxylase gene is indicated as SEQ ID NO:1, and an amino acid sequence of the coded protein is indicated as SEQ ID NO:2. By testing fatty acid content of recombination bacterial strains during expression and coexpression of three function fields of the rhodotorula glutinis acetyl coenzyme A carboxylase gene respectively, functions of the gene are verified. The nucleotide sequence of the rhodotorula glutinis acetyl coenzyme A carboxylase gene, the coded protein sequence of the gene, the clone method of the gene and a prokaryotic expression method can be widely applied to oil microorganism research and oil crop transgenosis engineering.
Description
Technical field
The present invention relates to the genetically engineered field, be specifically related to the rhodotorula glutinis acetyl-coA carboxylase gene, the invention still further relates to the protein of this genes encoding, cloning process and the function verification method and the application of this gene in transgenic oil plant crop of this gene.
Background technology
(acetyl-CoA carboxylase, ACC) (EC 6.4.1.2) is the rate-limiting enzyme of catalysis lipid acid anabolism the first step reaction to acetyl-CoA carboxylase, and acetyl-coa carboxylase is generated malonyl-list acyl coenzyme A, is the vitamin H dependent enzyme.This enzyme is present in most of biological tissues, comprises bacterium, ancient bacterium, fungi, yeast, plant, animal and human's class.Can be divided into 4 big types.Acetyl-CoA carboxylase is many subunits type ACC for first type, and promptly heterogeneous type is present in bacterium, dicotyledons and the monocotyledonous plastid of non-Gramineae.The ACC of Escherichia coli is the typical case's representative in the first kind; Form by four subunits; Be biotin carboxylase (biotin carboxylase; BC), biotin carboxyl carrier protein (biotin carboxyl carrier protein, BCCP) and carboxyltransferase (carboxyltransferase, 2 subunit α-CT CT) and β-CT.These subunits are combined together to form the ACC holoenzyme, maybe be with (BC)
2(BCCP)
4(CT α, CT β)
2Form exists.Second largest type ACC is multifunctional type ACC, i.e. homogeneity type, and human and most of Eukaryotic ACC belong to this class.The monomeric molecular mass of this type of ACC is more than 200kD, and BC, BCCP, CT domain are present on the polypeptied chain successively.There are two kinds of Special Circumstances in the classification of ACC in plant with the location, and as containing the first kind and second type of ACC in the chloroplast(id) of rape simultaneously, and ACC all belongs to second type in plastid of grass and the kytoplasm.In addition, the ACC that in streptomyces coelicolor and Corynebacterium glutamicum, finds is made up of α and two subunits of β, and the α subunit comprises BC and two domains of BCCP, and the β subunit comprises the CT domain, and this is the 3rd type of ACC.The 4th type of ACC find from archeobacteria Metallosphaera sedula, with heterogeneous type ACC difference be that CT is made up of a subunit.
Along with the continuous minimizing of chemical fuel, utilize the method for biological tissue's synthesising biological energy to receive much concern in recent years.Because a lot of grease microorganism oil offtake are high, people extensively utilize grease microorganism, like yeast, fungi etc. as Unicell Oils and Fats source mill (Chisti Y.Biodiesel from microalgae.Biotechnol Adv, 2007,25 (3): 294-306).The oleaginous microorganism of having reported is in the majority with yeast and mould fungi; Xue Fei swallow etc. (2009 wherein; Industrial biotechnology is at resource and investigation of energy field application development and achievement exchanging meeting collection of thesis) through discovering to Chlamydomonas reinhardtii (Chlamydomonas reinhardtii), spirulina plalensis (Spirulina platensi), yeast saccharomyces cerevisiae (Saccharomymyces cerevisiae) and rhodotorula glutinis (Rhodotorula glutinis) four kinds of oleaginous microorganisms; The grease of rhodotorula glutinis is formed very similar with biodiesel raw material oil; And living weight for the highest, if can further improve the thalline content of oil and grease, then possibly reach the mass-produced requirement of biodiesel raw material oil in four kinds of mikrobes; So it should be feasible, promising utilizing its new way of opening up a production biofuel.And fat content and grease contain rate to reach the used time of optimum value identical in the rhodotorula glutinis culture cycle, and this helps the optimization of culture condition.
Simultaneously along with engineered rise; People can be with ACC gene clone good in the grease microorganism in oil crops such as rape, soybean; Thereby improve greasy quality of oil crops and content (Davis MS; Solbiati J; Cronan JE.Overproduction of acetyl-CoA carboxylase activity increases the rate of fatty acid biosynthesis in Escherichia coli.J Biol Chem, 2000,275 (37): 28593-28598).
Wonder in the existing literature that whether an enzyme has function that activity is arranged all is to measure its enzyme to live usually, the method for acetyl-CoA carboxylase determination of activity mainly contains: labelled with radioisotope method, oxidative coupling method and intermediate product method.The labelled with radioisotope method is based on following reaction:
Reaction PH is 8.0-8.5.Determination of activity reaction finish the back through add acid, add heat extraction unreacted [H14CO3]-; End product is to acid, heat stable 14 [C] Malonyl-CoA; 14 [C] Malonyl-CoA is carried out fluorescent mark; Adopt KC18F reversed phase chromatography method to detect, and the acetyl-CoA carboxylase activity is estimated through the content of measuring 14 [C] Malonyl-CoA.This method biggest advantage is that sense cycle is short, detection sensitivity is high; Therefore this method is the main method of present acetyl-CoA carboxylase determination of activity; But the labelled with radioisotope method needs expensive labelled reagent; The processing of radioactivity pollution that the border is caused simultaneously and waste liquid is also comparatively complicated, therefore needs special safeguard procedures in use, for experimental implementation is brought certain difficulty.
The oxidative coupling method is similar with the intermediate product ratio juris, all is by reacting final product ADP and Pi and the easy NAD+ that detects of PEP (PEP) linked reaction generation.This type of detection method sense cycle is short, and reagent is also comparatively cheap, but reactions step is too much, intermediate product is complicated, the end product amount is few, has influenced its sensitivity.
Summary of the invention
First purpose of the present invention provides the protein of a kind of rhodotorula glutinis acetyl-coA carboxylase gene and this genes encoding.
Second purpose of the present invention provides a kind of cloning process of rhodotorula glutinis acetyl-coA carboxylase gene.
An empty carrier and a recombinant plasmid that contains the foreign gene domain are changed in the express cell simultaneously, if the fatty acid content of this genetic expression and recombinant bacterial strain has improved, then provable this expression of exogenous gene product has activity.Seeing that rhodotorula glutinis acetyl-coA carboxylase gene nucleotide sequence is longer; Be difficult to carry out total length expressed and be unfavorable for application in transgenic plant genetic engineering; Therefore; The 3rd purpose of the present invention is to contain three domains according to the rhodotorula glutinis acetyl-CoA carboxylase, these three domains expressed respectively and coexpression, relatively the fatty acid content of recombinant bacterial strain and then verify the function of this gene.
The 4th purpose of the present invention provides the application of rhodotorula glutinis acetyl-coA carboxylase gene in transgenic oil plant crop.
Above-mentioned purpose of the present invention realizes through following technical scheme:
The rhodotorula glutinis acetyl-coA carboxylase gene, its nucleotide sequence is shown in SEQ ID NO:1.
Rhodotorula glutinis acetyl-coA carboxylase gene encoded protein matter, its aminoacid sequence is shown in SEQ ID NO:2.
Acetyl-coA carboxylase gene of the present invention has two introns, lays respectively at 42-147bp and 315-677bp.The BC domain of acetyl-CoA carboxylase is positioned at 198-1722bp, and the BCCP domain is positioned at 1888-2331bp, and the CT domain is positioned at 4828-6456bp.Said gene is RgACCase from rhodotorula glutinis (Rhodotorula glutinis) with this unnamed gene.Coded protein called after RgACCase protein.Its sequence is compared the back find on NCBI, this sequence is not delivered and is not carried out functional annotation.
The cloning process of rhodotorula glutinis acetyl-coA carboxylase gene may further comprise the steps:
(1) extraction of the total DNA of rhodotorula glutinis;
(2) utilize two couples of degenerated primer IN-F/FY-R, QK-F/WG-R to carry out pcr amplification, the PCR product cloning that amplification is obtained transforms DH5 α competence to carrier pMD18-T, obtain the part conserved sequence of rhodotorula glutinis acetyl-coA carboxylase gene;
(3) utilize the chromosome walking method to obtain the unknown nucleotide sequence of rhodotorula glutinis acetyl-coA carboxylase gene;
(4) through the splicing of extension increasing sequence being obtained the full length sequence of rhodotorula glutinis acetyl-coA carboxylase gene,
Described degenerated primer IN-F/FY-R, QK-F/WG-R are respectively:
QK-F：CAGAAGATYATYGAGGAGGC；WG-R：ACVGAGAAGTAACCCCA；
IN-F：ATYGCBAACAACGGNATYGC；FY-R：GAGCCTCCTCRATRATCTTCTG。
The function verification method of rhodotorula glutinis acetyl-coA carboxylase gene may further comprise the steps:
(1) extracts, digests the total RNA of rhodotorula glutinis, synthetic cDNA first chain;
(2) be template with synthetic cDNA first chain, clone three domain genes of rhodotorula glutinis ACC respectively with Auele Specific Primer;
(3) make up medial expression vector pETDuet-1-NH1, pETDuet-1-NH3, pETDuet-1-NH1-NH3, pETDuet-1-NH2;
(4) make up co-expression carrier pETDuet-1-NH1-NH2-NH3;
(5) all medial expression vectors and the co-expression carrier with above-mentioned acquisition transforms respectively;
The fatty acid content of recombinant bacterial strain when (6) measuring three domain coexpressions,
Said Auele Specific Primer is:
NH1-B-F：CGGGATCCATCAACAAGGTCCTCATCGCTAACAAC
NH1-N-R：AATGCGGCCGCGATAAGCTCATCCAGCCA
NH2-E-F：CGGAATTCGACTTCATCTACGAGGGCCA
NH2-H-R：CCAAGCTTAAGGGCCAAGATACCGAGGAT
NH3-E-F：CGGAATTCCCGAGTACCCTCGAG
NH3-H-R：CCCAAGCTTAGCATCCTTCCACACAAG。
The rhodotorula glutinis acetyl-CoA carboxylase is the homogeneity acetyl-CoA carboxylase, and BC, BCCP, three domains of CT are present on the polypeptied chain successively, and this enzyme is a control lipid acid synthetic key enzyme.The cloning process of the nucleotide sequence of acetyl-CoA gene disclosed by the invention and encoded protein matter sequence and this gene and prokaryotic expression method can be widely used in the research and oil crops transgenic engineering of grease microorganism.
The present invention directly judges the function of three domains of acetyl-CoA carboxylase through the recombinant bacterial strain fatty acid content; Defectives such as contaminate environment, labelled reagent costliness and complicated operation have easily been overcome in the labelled with radioisotope method, defective such as the sensitivity that overcome also that step in the additive method is many, intermediate product complicacy etc. causes is low.
Description of drawings
Fig. 1 is degenerate pcr amplification rhodotorula glutinis ACC Gene Partial sequence, A: utilize primer QK-F/WG-R to be carried out the result of pcr amplification; B: utilize primer that IN-F/FY-R is carried out the result of pcr amplification, LaneM:DL2000 Maker.
Fig. 2 is the extraction of the total RNA of rhodotorula glutinis.
Fig. 3 is the amplification of three domain cDNA of rhodotorula glutinis ACC sequence, swimming lane M:DL2000Marker; Swimming lane 1:BC domain cDNA; Swimming lane 2:BCCP domain cDNA; Swimming lane 3:CT domain cDNA.
Fig. 4 is the structure of carrier pETDuet-1-NH1.
Fig. 5 is the structure of carrier pETDuet-1-NH2.
Fig. 6 is the structure of carrier pETDuet-1-NH3.
Fig. 7 is the structure of carrier pETDuet-1-NH1-NH3.
Fig. 8 is the structure of carrier pETDuet-1-NH1-NH2-NH3.
Fig. 9 is the SDS-PAGE figure of three domain coexpressions of rhodotorula glutinis ACC, swimming lane 1,3,5: three recombinant strains; Swimming lane 2,4,6: three control strains.Swimming lane M: albumen Marker, arrow represent the target protein position.
Figure 10 is the comparing result of different treatment bacterial strain fatty acid content after the gas chromatographic analysis.
Embodiment
Below in conjunction with instance the present invention is done detailed description.
(1) is experiment material with rhodotorula glutinis (Rhodotorula glutinis), extracts genomic dna.
(2) as shown in Figure 1; From DB, in the KEGG DB, download the acetyl-CoA carboxylase aminoacid sequence of different sorts yeast and filamentous fungus; After utilizing software Clustal X1.83 to carry out multisequencing comparison, choose that three conservative region IANNGA, QKIIEEA, WGYFSV have designed two couples of degenerated primer IN-F/FY-R, QK-F/WG-R carries out pcr amplification.Primer is following:
QK-F CAGAAGATYATYGAGGAGGC
WG-R ACVGAGAAGTAACCCCA
IN-F ATYGCBAACAACGGNATYGC
FY-R GAGCCTCCTCRATRATCTTCTG
The PCR system is (50uL) as follows: 10 * buffer 5uL, 2.5mM dNTPs 4uL, each 1uL of upstream and downstream primer, E * Taq enzyme 0.5uL (5U/uL), dd H2O 37.5uL.Adopt the touchdown PCR program: 94 ℃ of preparatory sex change 5min; Thereafter 94 ℃ of 1min, 51 ℃ of 1min whenever reduce by 0.5 ℃ through a circulating temperature, 72 ℃ of 1min, 11 circulations; 94 ℃ of 1min then, 46 ℃ of 1min, 72 ℃ of 1min, 19 circulations; Last 72 ℃ are extended 10min.
The conserved regions fragment that amplification is obtained connects pMD18-T, and 4 ℃ are spent the night, and according to the operation of pMD18-T support agent box, the specification sheets linked system is following:
Purpose fragment: 3uL
pMD18T-vector： 1uL
Solution?I： 5uL
ddH2O： 1uL
After connecting product transformed into escherichia coli DH5 α competent cell, adopt blue hickie sieve method screening positive clone to carry out bacterium colony PCR checking, the correct bacterium colony of checking is checked order, obtain rhodotorula glutinis part conserved sequence.
(3) respectively with four kinds of flat end limit property restriction endonuclease EcoR V, Pvu II, Dra I, Stu I digested genomic dna making up Genome walking enzyme Qie Wenku, it is following that enzyme is cut system:
Enzyme behind the purifying is cut product and is linked to each other with Genome walker Adaptor, and system is following:
Genome walking library DNA with suitable dilution is a template, carries out first run PCR with primer AP1 and outside Auele Specific Primer, and system is following: DNA enzyme Qie Wenku 1uL; 10 * LA buffer5uL; 2.5mM dNTPs 4uL, 10uM outside primer 1uL, AP1 1uL; LA Taq enzyme 0.5uL (5U/uL), dd H2O 37.5uL; First run PCR product with suitable dilution is a template again, carries out the nest-type PRC of next round with primer AP2 and inboard Auele Specific Primer, and system is the same.Agarose gel electrophoresis reclaims the suitably specificity nest-type PRC product of size, sequence verification.Primer is following:
AP1 GTAATACGACTCACTATAGGGC lateral joint primer
AP2 ACTATAGGGCACGCGTGGT inner contact primer
The fragment sequence that chromosome walking is obtained splices the full length sequence that has obtained the rhodotorula glutinis acetyl-coA carboxylase gene.
The clone and the coexpression of three domains of embodiment 2 rhodotorula glutinis acetyl-coA carboxylase genes
(1) as shown in Figure 2, use E.Z.N.A.
TMYeast RNA Kit test kit extracts the total RNA of rhodotorula glutinis.
(2) with reference to RevertAid
TMFirst Strand cDNA Synthesis Kit specification sheets at first digests total RNA with DNase I, and system is following: RNA 1ug, and 10 * DNase I reaction buffer with MgCl2 1uL, DEPC Water adds to 9uL, DNase I 1uL.TV 10uL.37 ℃ of incubation 30min add EDTA65 ℃ of 10min termination reaction of 1uL25mM.
Getting the total RNA of 1ug is template, adds oligo (dT) 18 as the reverse transcription primer, adds the DEPC treating water to 12uL, slight mixing, 65 ℃ of incubation 5min, of short duration ice bath.Add following component successively: 5 * Reaction Buffer 4uL, Ribolock RNase Inhibitor (200u/uL) 1uL, 10mM dNTP Mix 2uL, RevertAid M-MuL V Reverse Transcriptase (200u/uL) 1uL.Slight mixing.42℃1h。72 ℃ of 5min termination reactions.Synthetic cDNA first chain use immediately or-70 ℃ subsequent use.
As shown in Figure 3, be template with synthetic cDNA first chain, clone three domain genes of rhodotorula glutinis ACC respectively with Auele Specific Primer.The same 2.2.3 of system.Amplification condition is following: 94 ℃ of 3min; 94 ℃ of 30s, 45 ℃ of 45s, 72 ℃ of 2min carry out 5 circulations, again by 94 ℃ of 30s, 58 ℃ of 45s, 72 ℃ of 2min carry out 30 circulations, and last 72 ℃ are extended 10min.Primer is following:
NH1-B-F CGGGATCCATCAACAAGGTCCTCATCGCTAACAAC
NH1-N-R AATGCGGCCGCGATAAGCTCATCCAGCCA
NH2-E-F CGGAATTCGACTTCATCTACGAGGGCCA
NH2-H-R CCAAGCTTAAGGGCCAAGATACCGAGGAT
NH3-E-F CGGAATTCCCGAGTACCCTCGAG
NH3-H-R CCCAAGCTTAGCATCCTTCCACACAAG
(3) at first, with Nde I and EcoR V difference double digestion expression vector pETDuet-1 and pMD-18T-GBD-NH1, reclaim the pETDuet-1 and the GBD-NH1 of band sticky end, both are 16 ℃ of connections of spending the night under the effect of DNA Ligase.Connect product transformed competence colibacillus e. coli host cell DH5 α.Bacterium colony PCR identifies positive transformant.With recombinant plasmid called after pETDuet-1-NH1 (as shown in Figure 4).With EcoR I and Not I difference double digestion expression vector pETDuet-1 and pMD-18T-GBD-NH3, reclaim the pETDuet-1 and the GBD-NH3 of band sticky end, with above-mentioned identical method carrier construction pETDuet-1-NH3 (as shown in Figure 6).Then with EcoR I and Not I difference double digestion expression vector pETDuet-1-NH1 and pMD-18T-GBD-NH3; Reclaim the pETDuet-1-NH1 and the GBD-NH3 of band sticky end, with above-mentioned identical method carrier construction pETDuet-1-NH1-NH3 (as shown in Figure 7).With Not I and Af1 II difference double digestion pETDuet-1 and pMD-18T-GBD-NH2, carrier construction pETDuet-1-NH2 (as shown in Figure 5).
As shown in Figure 8, be template with expression vector pETDuet-1-NH2, adopt primer T7-pDuet-bccp-f/T7-pDuet-bccp-r to carry out pcr amplification (T7-pDuet-bccp-f:ataagaatgcggccgctaatacgactcactatagggga; T7-pDuet-bccp-r:aatccccttaagttaaagggccaagataccgaggat); Obtain fragment GBD-NH2-2 and be with a T7 promoter sequence; The GBD-NH2-2 that will have Not I and Af1 II sticky end at last is connected on the pETDuet-1-NH1-NH3 with identical sticky end; Make up the expression vector called after pETDuet-1-NH1-NH2-NH3-2 that obtains, each purpose fragment all has a promotor in this expression vector.
(4) all medial expression vectors and the co-expression carrier pETDuet-1-NH1-NH2-NH3 with above-mentioned acquisition transforms Transetta (DE3) competence respectively, and coating contains the LB solid plate of 50 μ g/mL Amp, 37 ℃ of incubated overnight.Bacterium colony PCR verifies transformant.
The fatty acid content of recombinant bacterial strain and then verify the function of this gene when embodiment 3 measures three domain coexpressions
A large amount of abduction delivering recombinant bacterial strains, centrifugal collection thalline ,-80 ℃ of freezing 3h vacuumize lyophilize then.Adopt immersion method (Li et al., 2006) extracting thalline lipid acid, step is following:
(1) reagent preparation: 5% (volume percent) vitriol oil/methanol solution; 0.2% (mass percent) BHT/ methanol solution; 2.5mg/mL carbon 17 fatty acid methyl esters/sherwood oil (90 ℃-120 ℃) solution; 0.9% (mass percent) NaCl/ aqueous solution;
(2) the exsiccant thalline being ground the back with mortar takes by weighing in the 50mg adding 20mL jaw head space bottle with analytical balance; Adding 5% vitriol oil methanol solution 2mL (adds at twice; Each 1mL), after being rinsed well, glass rod in bottle, adds following reagent successively: 0.2%BHT solution 25 μ L, toluene 300 μ L;
(3) with the gland device head space bottle is sealed with the aluminium lid of band tetrafluoroethylene pad, said mixture is slightly rocked mixing, 90-95 ℃ of water-bath 1.5h extracts in thermostat water bath then;
(4) extract the taking-up of end back and be cooled to room temperature; Make interior mark with adding 5 μ L10mg/mL carbon, 20 difatty acid methyl esters after the cap opener opening, add 0.9%NaCl2mL again, a little vibration; Use the 3mL n-hexane extraction; Get supernatant with liquid-transfering gun during extraction and be blown in the bottle again, 3-4 time to guarantee that extraction fully, is transferred to supernatant in the 10mL centrifuge tube repeatedly;
(5) extract that obtains dries up under Nitrogen evaporator, uses the n-hexane dissolution constant volume of 1mL then, vortex 2-3s, and centrifugal again (4 ℃ of rotating speed 4500rpm, time 5min, temperature) gets supernatant;
(6) carry out the gas chromatographic analysis (working conditions of gas chromatograph: FID flame ionization ditector, HP-INNOWax chromatographic column, 250 ℃ of injector temperatures; Splitting ratio 10: 1,260 ℃ of detector temperatures, 210 ℃ of chromatographic column initial temperature; 9min; 20 ℃/min of temperature programming rises to 230 ℃, and under this temperature, keeps 8min)
Each sample is done three repetitions, gets empty carrier conversion bacterial strain simultaneously and does contrast, and the grease method of calculation are following:
S1: total peak area
S2: interior mark peak area
N: interior mark consumption
M: thalline quality
Figure 10 is the comparing result of different treatment bacterial strain fatty acid content after the gas chromatographic analysis.
The fatty acid content of the recombinant bacterial strain in expression difference in functionality territory is shown in figure 10.Ck among the figure is that empty carrier transforms expression strain, the carrier pETDuet-1 that does not promptly contain foreign gene transform survey behind Transetta (DE3) competent cell fatty acid content.
Claims (5)
1. rhodotorula glutinis acetyl-coA carboxylase gene, its nucleotide sequence is shown in SEQ ID NO:1.
2. rhodotorula glutinis acetyl-coA carboxylase gene encoded protein matter, its aminoacid sequence is shown in SEQ ID NO:2.
3. the cloning process of rhodotorula glutinis acetyl-coA carboxylase gene according to claim 1 is characterized in that may further comprise the steps:
(1) extraction of the total DNA of rhodotorula glutinis;
(2) utilize two couples of degenerated primer IN-F/FY-R, QK-F/WG-R to carry out pcr amplification, the PCR product cloning that amplification is obtained transforms DH5 α competence to carrier pMD18-T, obtain the part conserved sequence of rhodotorula glutinis acetyl-coA carboxylase gene;
(3) utilize the chromosome walking method to obtain the unknown nucleotide sequence of rhodotorula glutinis acetyl-coA carboxylase gene;
(4) through the splicing of extension increasing sequence being obtained the full length sequence of rhodotorula glutinis acetyl-coA carboxylase gene,
Described degenerated primer IN-F/FY-R, QK-F/WG-R are respectively:
QK-F：CAGAAGATYATYGAGGAGGC；WG-R：ACVGAGAAGTAACCCCA；
IN-F：ATYGCBAACAACGGNATYGC；FY-R：GAGCCTCCTCRATRATCTTCTG。
4. the function verification method of rhodotorula glutinis acetyl-coA carboxylase gene according to claim 1 is characterized in that may further comprise the steps:
(1) extracts, digests the total RNA of rhodotorula glutinis, synthetic cDNA first chain;
(2) be template with synthetic cDNA first chain, clone three domain genes of rhodotorula glutinis acetyl-CoA carboxylase with Auele Specific Primer respectively;
(3) make up medial expression vector pETDuet-1-NH1, pETDuet-1-NH3, pETDuet-1-NH1-NH3, pETDuet-1-NH2;
(4) make up co-expression carrier pETDuet-1-NH1-NH2-NH3;
(5) all medial expression vectors and the co-expression carrier with above-mentioned acquisition transforms respectively;
The fatty acid content of recombinant bacterial strain when (6) measuring three domain coexpressions,
Said Auele Specific Primer is:
NH1-B-F：CGGGATCCATCAACAAGGTCCTCATCGCTAACAAC
NH1-N-R：AATGCGGCCGCGATAAGCTCATCCAGCCA
NH2-E-F：CGGAATTCGACTTCATCTACGAGGGCCA
NH2-H-R：CCAAGCTTAAGGGCCAAGATACCGAGGAT
NH3-E-F：CGGAATTCCCGAGTACCCTCGAG
NH3-H-R：CCCAAGCTTAGCATCCTTCCACACAAG。
5. the application of the described rhodotorula glutinis acetyl-coA carboxylase gene of claim 1 in transgenic oil plant crop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103961488A CN102586289A (en) | 2011-12-02 | 2011-12-02 | Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103961488A CN102586289A (en) | 2011-12-02 | 2011-12-02 | Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102586289A true CN102586289A (en) | 2012-07-18 |
Family
ID=46475516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103961488A Pending CN102586289A (en) | 2011-12-02 | 2011-12-02 | Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102586289A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110174472A (en) * | 2019-05-14 | 2019-08-27 | 中国农业科学院茶叶研究所 | A method of the fatty acid composition based on fresh leaf determines that tea tree breed fits property processed |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216464A (en) * | 2008-08-29 | 2011-10-12 | 纳幕尔杜邦公司 | Manipulation of snf1 protein kinase activity for altered oil content in oleaginous organisms |
-
2011
- 2011-12-02 CN CN2011103961488A patent/CN102586289A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216464A (en) * | 2008-08-29 | 2011-10-12 | 纳幕尔杜邦公司 | Manipulation of snf1 protein kinase activity for altered oil content in oleaginous organisms |
Non-Patent Citations (2)
| Title |
|---|
| 李洁琼等: "乙酰辅酶A羧化酶_脂肪酸代谢的关键酶及其基因克隆研究进展", 《应用与环境生物学报》, vol. 17, no. 5, 25 October 2011 (2011-10-25), pages 753 - 758 * |
| 李洁琼等: "粘红酵母乙酰辅酶A羧化酶_ACC_基因的克隆及CT功能域基因的原核表达", 《微生物学杂志》, vol. 31, no. 3, 31 May 2011 (2011-05-31), pages 6 - 11 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110174472A (en) * | 2019-05-14 | 2019-08-27 | 中国农业科学院茶叶研究所 | A method of the fatty acid composition based on fresh leaf determines that tea tree breed fits property processed |
| CN110174472B (en) * | 2019-05-14 | 2022-04-29 | 中国农业科学院茶叶研究所 | Method for judging tea tree variety adaptability based on fatty acid composition of fresh leaves |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Overexpression of malic enzyme (ME) of Mucor circinelloides improved lipid accumulation in engineered Rhodotorula glutinis | |
| CN104284974B (en) | For generating the recombinant host cell of malonic acid | |
| CN107002019B (en) | Recombinant yeast producing 3-hydroxypropionic acid and method for producing 3-hydroxypropionic acid using same | |
| CN112574974B (en) | Lipase mutant D163F with improved catalytic activity and application thereof | |
| Zhu et al. | Coproduction of acetaldehyde and hydrogen during glucose fermentation by Escherichia coli | |
| JP2012503993A (en) | Identification and use of bacterial [2Fe-2S] dihydroxy acid dehydratase | |
| JP2008525026A (en) | Description of US Government Assistance for Recombinant Microorganisms to Highly Produce Organic Acids This invention was made with assistance from the US Government at Cooperative Active No. DE-FC36-02GO12001, awarded by the Department of Energy. The US government has certain rights in this invention. | |
| US20200399666A1 (en) | Method for preparation of diester derivatives of malonic acid | |
| WO2015057155A1 (en) | Engineering of hydrocarbon metabolism in yeast | |
| KR20220139351A (en) | Modified Microorganisms and Methods for Improved Production of Ectoins | |
| CN102586289A (en) | Rhodotorula glutinis acetyl coenzyme A carboxylase gene and clone and function verification method and application thereof | |
| CN101899411B (en) | Engineering escherichia coli for preparing medium-carbon fatty alcohol | |
| CN106479947A (en) | Fermenting and producing 3 hydracrylic acid genetic engineering bacterium and its construction method and application | |
| CN104726477A (en) | Lipase coding gene and engineering strain thereof | |
| CN107488644A (en) | The lipase TTL mutant TTL-Gly60Glu/Ser61Asn and its gene and application that a kind of heat endurance improves | |
| CN103667228B (en) | Fungal nitrilase mutant that a kind of catalysis activity and heat endurance improve and construction method thereof | |
| Tang et al. | The isocitrate dehydrogenase gene of oleaginous yeast Lipomyces starkeyi is linked to lipid accumulation | |
| Kumari et al. | Tailored designing of a diploid S. cerevisiae natural isolate for increased production of fatty acid ethyl ester | |
| CN113801857B (en) | NADH dehydrogenase mutant SlNOX with improved enzyme activity and application thereof | |
| Branny et al. | An operon encoding three glycolytic enzymes in Lactobacillus delbrueckii subsp. bulgaricus: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase and triosephosphate isomerase | |
| CN110438097B (en) | L-isoleucine hydroxylase mutant with improved heat stability and enzyme activity | |
| CN114058560B (en) | Process for the production of glycine | |
| CN114990043A (en) | Engineering bacterium for metabolizing lysine and construction method and application thereof | |
| Shi et al. | Characterization of Three Genes Encoding the Subunits of Light‐Independent Protochlorophyllide Reductase in Chlorella protothecoides CS‐41 | |
| CN107488647A (en) | The lipase TTL mutant TTL-Gly60Glu and its gene and application that a kind of heat endurance improves |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120718 |