CN102565424B - Method for high-flux screening chemical excitons for inducing insect resistance of plants - Google Patents

Abstract

The invention relates to a method for high-flux screening chemical excitons for inducing insect resistance of plants. The method includes the steps that a paddy rice strain built by transgenosis is processed through different small molecular compounds, and whether the small molecular compounds are active can be judged as per the activity variation of GUS protein or GFP fluorescence protein in a transgenic strain, and the transgenic strain is obtained through connecting promoters of related inducing insect-resistance genes with the GUS protein or the GFP fluorescence protein to built an expression vector for the promoters, and then adopting the infection method of agrobacterium tumefaciens for transgenosis. The method provided by the invention can greatly reduce the workload and the screening cost, greatly improve the screening efficiency of the chemical excitons for inducing insect resistance of the plants, and is particularly suitable for screening on a large scale.

Description

A kind of method of high-flux screening chemical excitons for inducing insect resistance of plants

Technical field

The present invention relates to the screening technique of inducing plant insect resistace Chemical elicitor, relate in particular to a kind of high-throughout screening technique.

Background technology

The induction of resistance of plant is the importance that plant is resisted disease and pest harm.Because it has wide spectrum, lasting Disease and insect resistance, be therefore day by day subject to various countries scientist's great attention.Induction of resistance is as the function of plant immune system, and it has the feature of non-specialization, systematicness and persistence and non-pollution.That its application can reach is many anti-, high resistance and the plurality of target such as nuisanceless.Pest management countermeasure is turned to the interior system of mutual work, the inherent resistance mechanism of exploitation plant is carried out prevention and elimination of disease and pests, is an important channel of the modern plants prevention and control of plant diseases, pest control.

The induction of resistance of plant originates in plant to coming from the identification of disease worm exciton, by multiple in activated plant body, as signal transduction pathways such as jasmonic, salicylic acid, ethene, finally causes plant defense response.Utilizing plant inducer to lead aspect insect resistace, some researchs have shown to utilize the pest-resistant reaction that some little molecular signal compounds can activated plant, thereby reach the object of Control pests.As sprayed jasmonic on tomato, can strengthen the resistance of tomato to multiple lepidoptera pest.Because the exploitation of these micromolecular compounds is the signaling molecules based in plant, and its control to insect is to play a role by plant, therefore than the pesticide that directly acts on insect, has better environmental safety.Therefore, exploitation based on can activated plant the environment friendly agricultural of micromolecular compound of induction insect resistace, by important of being Control pests harm from now on and approach safely and effectively.Then, the current micromolecular compound for inducing plant insect resistace, i.e. the screening of Chemical elicitor, method is loaded down with trivial details, biologicall test workload is large, and efficiency is low.

For this reason, the invention provides a kind of method of high-flux screening chemical excitons for inducing insect resistance of plants.Profit in this way, can be screened 100 kinds of above micromolecular compounds for each person every day, and this has not only improved screening effeciency greatly, and can greatly save the raising of needed a large amount of insects in conventional screening methods and a large amount of insect biologicall tests.

Summary of the invention

The object of the invention is the deficiency existing in order to solve above-mentioned background technology, a kind of method of high-flux screening chemical excitons for inducing insect resistance of plants is provided, that the method has is simple to operate, analyze quick and precisely, highly sensitive feature.

For achieving the above object, the present invention adopts following technical scheme:

The invention has the beneficial effects as follows, the present invention utilizes gus protein in constructed Transgenic Rice strain or GFP fluorescin activity index to judge the biologically active of micromolecular compound, can go out to have bioactive micromolecular compound by Effective selection, screening technique is simple, efficient, greatly reduces the workload of biologicall test.

Accompanying drawing explanation

Accompanying drawing 1 is transgenosis pCAMBIA1391 plasmid figure used.

Embodiment

The high-throughput screening method of inducing plant insect resistace Chemical elicitor of the present invention, utilize different micromolecular compounds to process the rice strain that transgenosis builds, according to the variation of gus protein in transgenic strain or GFP fluorescin activity, judge whether micromolecular compound has biologically active.

Transgenic strain is the promoter of anti insect related gene to be connected with gus protein or GFP fluorescence protein gene build promoter expression vector, and the method for then utilizing Agrobacterium to infect obtains by transgenosis.

Selected promoter is induction type anti insect related gene promoter.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in the restriction scope of the invention for the present invention is described.

Embodiment 1: Rice Volatiles linalool can attract brown paddy plant hopper Important Natural Enemy rice lice tassel chalcid fly, with paddy rice linalool synthase gene osLISfor example, introduce operation steps of the present invention.

1. linalool synthase gene osLISpromoter sequence clone and pCAMBIA-LISp vector construction

According to OsLIS gene order (GenBank database login number is AK110925), transcription initiation site upstream 1500bp designs primer:

Forward primer is OsLISP-F:CG aAGCTTcGTGTTCATGTACCCTTTT, reverse primer is OsLISP-R:AG gTCGACgTGGCAAACCATAGATAAGC, for convenience of next step clone, line place designs respectively Hind III and Sal I restriction enzyme site.Take oryza sativa genomic dna as template, carry out pcr amplification, amplified production called after LISp.LISp and pCAMBIA1391 plasmid are carried out to double digestion by Hind III and Sal I respectively, enzyme is cut to product electrophoresis, large fragment is reclaimed in rubber tapping, utilize T4 ligase by the connection of spending the night of two fragments, gus gene in LISp and pCAMBIA1391 plasmid is merged, obtain the carrier pCAMBIA-LISp containing fusion sequence LISp::GUS.

2. turn the acquisition containing LISp::GUS sequence rice strain

Carrier pCAMBIA-LISp electric shocking method is transformed to Agrobacterium EHA105 competent cell, with conversion method for agrobacterium, contaminate elegant water 11 callus, the T0 that gained kanamycin-resistant callus tissue obtains after breaking up, taking root is for rice plant.Plant, after 2 generations of warm indoor propagation, filters out the T2 of two LISp::GUS sequence list copies insertion for isozygotying strain, L15-15 and L15-38.Concrete transgenic method and nutrient culture media preparation reference: Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice ( oryza satival.) mediated by agrobacteriumand sequence analysis of the boundaries of the T-DNA. Plant Journal, 6,271-282.In strain, the insertion copy number of fusion utilizes Southern blot to detect, take gus gene sequence as probe, and concrete reference: Zhou G, et al. (2009) Silencing osHI-LOXmakes rice more susceptible to chewing herbivores, but enhances resistance to a phloem feeder. plant J 60:638 – 648.

3. the Chemical elicitor of inducing plant insect resistace screening

Different micromolecular compounds is configured to the solution of 0-50 mg/L concentration, utilizes spraying on the ground or root absorption to process transgenic strain L15-15 or L15-38, with corresponding solvent in contrast.The concrete operation method of spraying is: on the blade of every strain transgenic paddy rice and stem stalk, evenly spray the little molecular solution of 2 ml (containing 0.01% Tween-20), to spray 2ml solvent (containing 0.01% Tween-20) in contrast.Process after 48 h, get blade or stem stalk position and organize in liquid nitrogen and preserve.The concrete operation method of root absorption is: micromolecular compound is dissolved in paddy rice nutrient solution and processes transgenic paddy rice, with containing the transgenic paddy rice of the rice nutrition liquid plantation of micromolecular compound not in contrast.Process after 48 h, get in root system liquid nitrogen and preserve.Extract the protein of each paddy rice sample, and measure the activity of gus protein in processing and control sample.If a certain micromolecular compound process after gus protein activity in rice protein higher than the GUS activity in corresponding contrast, judge this micromolecular compound be can inducing paddy rice insect resistace Chemical elicitor; If can not induce the rising of gus protein activity in transgenic paddy rice strain, judge that this micromolecular compound is not the Chemical elicitor of inducing paddy rice insect resistace.

Method for extracting protein is: in liquid nitrogen, by paddy rice sample grind into powder, get 0.2g and pack 1.5mL centrifuge tube into, add 1 ml protein extract, shake up, centrifugal 15 min of 12000rpm under 4 ℃ of conditions; Draw supernatant to new 1.5ml centrifuge tube, in-20 ℃ of refrigerators, preserve.Gus protein activity test method is: in 1.5 mL centrifuge tubes, add above-mentioned 10 μ l protein extracts and 100 μ L reaction buffers, 37 ℃ of water-bath 30 min; After completion of the reaction, add 900 μ l reaction terminating liquids; Utilize 96 orifice plates on DTX880 multi-tester, to measure each sample, setting exciting light is that 365 nm, utilizing emitted light are 455 nm.GUS activity represents with nmol MU/mg protein/min.The active concrete grammar detecting of gus protein can reference: Jefferson RA, Kavanagh TA Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal, 6:3901-3907.The assay method of protein concentration can reference: Bradford Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Journal of Biochemistry, 72:248-254.

Embodiment 2: jasmonic is as the demonstration test of Chemical elicitor

Jasmonic (jasmonic acid, JA) is the known little molecule of biologically active that can activate paddy rice induction insect resistace, not only can produce direct resistance (Zhou G, et al. (2009) Silencing to snout moth's larva by inducing paddy rice osHI-LOXmakes rice more susceptible to chewing herbivores, but enhances resistance to a phloem feeder. plant J 60:638 – 648.), and can produce indirect resistance (Lou Y by inducing paddy rice, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous application of jasmonic acid induces volatile emissions in rice and enhances parasitism of nilaparvata lugenseggs by the parasitoid anagrus nilaparvatae. Journal of Chemical Ecology, 31:1985-2002).In the present embodiment, when the spraying of JA overground part is processed, by JA be dissolved in 50mM phosphate buffer to final concentration be 5 mg/L, add 0.01% Tween-20, on the blade of transgenic paddy rice strain L15-15 and L15-38 and stem stalk, evenly spray 2 ml solution, to spray 2 ml containing the phosphate buffer of 0.01% Tween-20 in contrast.After processing 48 h, get leaf sample grinding, measure GUS activity.Testing result shows, after processing with JA, the GUS activity in L15-15 and L15-38 blade is significantly higher than contrast, is respectively 1.73 times and 1.96 times of contrast.When JA root is processed, by JA be directly dissolved in paddy rice nutrient solution to final concentration be 5 mg/L, with nutrient solution, do not add JA in contrast.After 48 h, get root system sample, measure GUS activity.Result shows, the GUS activity after JA processes in L15-15 and L15-38 root system is significantly higher than contrast, is respectively 3.03 and 3.85 times of contrast.The result shows that JA can be used as the exciton of paddy rice induction insect resistace, this with our former JA reporting can inducing paddy rice insect resistace result consistent.The system the set up reliability as the screening of inducing paddy rice insect resistace Chemical elicitor has been described.

Embodiment 3: screen Chemical elicitor from unknown active small molecular compound

It is 5 mg/L that 11 kinds of unknown activity different micromolecular compound A, B, C, D, E, F, G, H, I, J, K are dissolved in to 50 mM phosphate buffers to final concentration, add 0.01% Tween-20, with same procedure spraying rice strain L15-38 aerial part in embodiment 1, with the phosphate buffer that sprays 0.01% Tween-20 in contrast.Process after 48 h, measure gus protein activity in blade.Meanwhile, in kind process wild type paddy rice, and processing after 48 h, measure the behavior reaction of rice lice tassel chalcid fly to little molecule processing wild type rice strain and damping fluid processing wild type rice strain volatile matter." Y " type of utilization olfactometer is measured the behavior reaction of 50 rice lice tassel chalcid flies to Rice Volatiles, concrete operation step reference: Lou Y, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous application of jasmonic acid induces volatile emissions in rice and enhances parasitism of nilaparvata lugenseggs by the parasitoid anagrus nilaparvatae. Journal of Chemical Ecology, 31:1985-2002.

Table 1 is the raw result of surveying after induction situation and the processing wild type paddy rice thereof of 11 kinds of micromolecular compounds to GUS activity in transgenic strain.The active ratio for GUS activity in the transgenic strain of contrast and micromolecular compound processing of GUS.Raw survey result represents the number that rice lice tassel chalcid fly is lured by the wild type rice strain volatile matter of contrast and micromolecular compound processing respectively.*, represent to there is significant difference between contrast and processing.

Table 1

Compound	GUS activity (contrast: process)	The raw result (contrast: process) of surveying
			A	1:1.91*	13:36*
B	1:1.13	19:20
			C	1：0.93	21:24
D	1:1.18	23:24
			E	1:1.06	21:22
F	1:1.13	15:17
			G	1：1.05	18:19
H	1:1.53*	18:29*
			I	1:0.93	23:19
J	1:1.30	21:22
			K	1:2.05*	13:31*

From the result of table 1, in 11 kinds of micromolecular compounds, the rising of GUS activity in A, H, tri-kinds of remarkable inducible strain L15-38 blades of micromolecular compounds energy of K; Meanwhile, after these three kinds of compound treatment paddy rice, can significantly improve equally the attracting action of paddy rice to rice lice tassel chalcid fly; B, C, D, E, F, G, I, J do not have the obvious rising of GUS activity in inducible strain L15-38 blade, can not excite paddy rice to discharge volatile matter and lure rice lice tassel chalcid fly.Embodiment presentation of results, to turn LISp::GUS rice strain as screening model, can screen the Chemical elicitor with inducing plant insect resistace by the active detection of GUS.

Claims (1)

1. the high-throughput screening method of an inducing plant insect resistace Chemical elicitor, it is characterized in that, the method utilizes different micromolecular compounds to process constructed transgenic paddy rice strain, according to the variation of gus protein in transgenic strain or GFP fluorescin activity, judges whether micromolecular compound has biologically active; The method realizes by following steps:

(1) linalool synthase gene osLISpromoter sequence clone and pCAMBIA-LISp vector construction: according to OsLIS gene order transcription initiation site upstream 1500bp, design primer: forward primer is OsLISP-F:CGAAGCTTCGTGTTCATGTACCCTTTT, and reverse primer is OsLISP-R:AGGTCGACGTGGCAAACCATAGATAAGC; Take oryza sativa genomic dna as template, carry out pcr amplification, amplified production called after LISp, LISp and pCAMBIA1391 plasmid are carried out to double digestion by Hind III and Sal I respectively, enzyme is cut to product electrophoresis, large fragment is reclaimed in rubber tapping, utilize T4 ligase by the connection of spending the night of two fragments, the gus gene in LISp and pCAMBIA1391 plasmid is merged, obtain the carrier pCAMBIA-LISp containing fusion sequence LISp::GUS;

(2) turn the acquisition containing LISp::GUS sequence rice strain: carrier pCAMBIA-LISp electric shocking method is transformed to Agrobacterium EHA105 competent cell, with conversion method for agrobacterium, contaminate elegant water 11 callus, the T0 that gained kanamycin-resistant callus tissue obtains after breaking up, taking root is for rice plant; Plant, after 2 generations of warm indoor propagation, filters out the T2 of two LISp::GUS sequence list copies insertion for isozygotying strain, L15-15 and L15-38; In strain, the insertion copy number of fusion utilizes Southern blot to detect, take gus gene sequence as probe;

(3) Chemical elicitor of inducing plant insect resistace screening: the solution that different micromolecular compounds is configured to 0-50 mg/L concentration, utilize spraying on the ground or root absorption to process transgenic strain L15-15 or L15-38, with corresponding solvent in contrast; The concrete operation method of spraying is: on the blade of every strain transgenic paddy rice and stem stalk, evenly spray the little molecular solution of 2 ml, in solution containing 0.01% Tween-20, to spray 2ml solvent in contrast, in solvent containing 0.01% Tween-20; Process after 48 h, get blade or stem stalk position and organize in liquid nitrogen and preserve; The concrete operation method of root absorption is: micromolecular compound is dissolved in paddy rice nutrient solution and processes transgenic paddy rice, with containing the transgenic paddy rice of the rice nutrition liquid plantation of micromolecular compound not in contrast, process after 48 h, get in root system liquid nitrogen and preserve; Extract the protein of each paddy rice sample, and measure process with control sample in the activity of gus protein, if a certain micromolecular compound process after gus protein activity in rice protein higher than the GUS activity in corresponding contrast, judge this micromolecular compound be can inducing paddy rice insect resistace Chemical elicitor; If can not induce the rising of gus protein activity in transgenic paddy rice strain, judge that this micromolecular compound is not the Chemical elicitor of inducing paddy rice insect resistace.

Images