CN102559694A - Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene - Google Patents
Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene Download PDFInfo
- Publication number
- CN102559694A CN102559694A CN2012100413768A CN201210041376A CN102559694A CN 102559694 A CN102559694 A CN 102559694A CN 2012100413768 A CN2012100413768 A CN 2012100413768A CN 201210041376 A CN201210041376 A CN 201210041376A CN 102559694 A CN102559694 A CN 102559694A
- Authority
- CN
- China
- Prior art keywords
- macaque
- sequence
- race
- cdna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cloning method for a cDNA (complementary Deoxyribonucleic Acid) full-length sequence of a macaque resistin gene, relates to an animal gene sequence, in particular to clone of the cDNA full-length sequence of the macaque resistin gene, and belongs to the technical field of genetic engineering. The gene sequence is obtained by the following steps of: designing a primer by applying a known segment of a human resistin gene; extracting total RNA (Ribonucleic Acid) by using macaque adipose tissues; performing RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification; taking the macaque resistin gene segment obtained by amplification as a known sequence; tagging unknown sequences of end 5' and end 3' of the known segment sequence through 5'-RACE (Rapid Amplification of cDNA End) and 3'-RACE by using an RACE technology; and splicing the cDNA sequences by applying sequence assembly software.
Description
Technical field
The present invention relates to a kind of animal gene sequence, relate in particular to a kind of cloning process of macaque resistin gene cDNA full length sequence, belong to gene engineering technology field.
Background technology
Phylaxin is newfound a kind of fatty tissue specific secretion factor; Effect with opposing Regular Insulin; Think not found contact tie between obesity and the type II diabetes, even think that obesity can cause that insulin resistant is exactly because the cause that adipocyte has been secreted phylaxin.The discovery of phylaxin is that one in the diabetes study makes progress greatly, has become to connect research focus fat and the type II diabetes dependency.The resistin gene cDNA full length sequence and the cloning process of species such as human, big mouse, rabbit all have report, and its nucleotide sequence has all comprised non-coding region and coding region, has become the important information resource of its biological function of research; But up to the present still being vacancy for the clone of macaque resistin gene cDNA full length sequence and to the access method that angles of unknown nucleotide sequence, therefore is to carry out macaque resistin gene biological function and utilize macaque to study an obstacle of human phylaxin relative disease.
The acquisition of full-length gene is an important step of carrying out the genes involved functional study, normally obtains the cDNA full length sequence of goal gene through gene library screening, and this method complex operation, experimental period are longer, and suitable difficulty is arranged in the real work.And the RACE that occurs in recent years technology (Rapid amplification of cDNA ends) has stronger advantage relatively in the obtaining of full-length gene.When being to use Oligo (dT) that mRNA is carried out reverse transcription, this method adds universal joint (primer) at two; Utilize primer (the gene specific primer of gene specific; GSP) carrying out the terminal aim sequence that obtains fast of cDNA through PCR, is by known one section cDNA fragment, through extend amplification toward two ends on the round pcr basis; Thereby obtaining the technology of complete 3' end and 5' end, is one of means comparatively efficiently of obtaining full-length gene at present.
Macaque is the most approaching with the mankind on sibship; With the human genetic material 75% ~ 98.5% homology is arranged, physiological and biochemical index is very similar with the mankind, is the desirable animal model of research human health and disease; Therefore; Set up a kind of method of quick clone macaque resistin gene cDNA full length sequence, understand macaque resistin gene cDNA full length sequence, significant to human resistin gene function of substitution studies and relative disease.
Summary of the invention
The objective of the invention is clone, further use it to carry out biological function and the research of human relative disease for Rapid Realization macaque resistin gene cDNA full length sequence.
The macaque resistin gene that the present invention obtains, its cDNA full length sequence is shown in SEQ ID NO.1.Information is shown in this gene order:
(a) sequence signature:
Length: 526 base pairs;
Type: nucleic acid;
Chain: two strands;
Topological framework: linearity;
(b) molecule type: cDNA;
(c) suppose: not;
(d) antisense: not;
(e) initial source: macaque (
Macaca malutta);
(f) sequence description: SEQ ID NO.1.
The cloning process of macaque resistin gene cDNA full length sequence of the present invention is the known fragment design of the human resistin gene of a utilization primer; Extract total RNA with the macaque fatty tissue; Carry out the RT-PCR amplification; As known array, adopt the RACE technology with the macaque resistin gene fragment that increases again, angle the unknown nucleotide sequence of getting known fragment sequence 5' end and 3' end through 5'-RACE and 3'-RACE; Utilization sequence assembly software promptly is cloned into macaque resistin gene cDNA full length sequence with the cDNA sequence assembly that obtains.
The acquisition of macaque resistin gene cDNA full length sequence not only can be filled up the vacancy of macaque resistin gene research; Can also lay the foundation for the substitution studies of human resistin gene relative disease, explore significant to human resistin gene functional study and gene therapy thereof especially.
Description of drawings
Fig. 1 takes turns the pcr amplification product electrophorogram for 3'RACE second.
Wherein, the big tick marks of nucleic acid M.200bp; 1. 3'RACE positive control; 2. 3'RACE first round amplimer F1 product and second is taken turns the amplified production of amplimer F3; 3. the negative control amplified production of " 2 "; 4. 3'RACE first round amplimer F2 product and second is taken turns the amplified production of amplimer F4; 5. the negative control PCR product of " 4 ".
Fig. 2 expands PCR raising the output thing electrophorogram for 5'RACE second takes turns.
Wherein, the big tick marks of nucleic acid M.200bp; 1. 5'RACE positive control; 2. 5'RACE first round amplimer 5R1 product and second is taken turns the amplified production of amplimer 5R2; 3. the negative control amplified production of " 2 "; 4. 5'RACE first round amplimer 5R1 product and second is taken turns the amplified production of amplimer 5R3; 5. the negative control PCR product of " 4 ".
Embodiment
Below in conjunction with embodiment the present invention is further specified.
Embodiment 1: the cloning process of macaque resistin gene cDNA full length sequence.
1) extraction of total RNA: adopt the TRILzol method to extract the total RNA of macaque fatty tissue.
2) rt: carry out rt according to High Fedelity Prime ScriptTM RT-PCR Kit test kit specification sheets operation steps, reaction conditions is: 25 ℃ of reaction 5min, 42 ℃ of reaction 60min, 70 ℃ of reaction 5min.
3) PCR reaction system and condition:
At first with template cDNA/1.5 μ L, forward primer (20mM)/1 μ L, reverse primer (20mM)/1 μ L, PCR Master Mix/12.5 μ L, deionized water/9 μ L mix, and totally are 25 μ L.
According to human resistin gene highly conserved sequence designed primer be then:
Forward primer: For 5'GTTAGCTGAGCCCACCGAGA 3';
Reverse primer: Re 5'GACCTCAGGGCTGCACACGA 3';
The reaction conditions of PCR is: 94 ℃ of preparatory sex change 3min at first, get into following circulation then, and 93 ℃ of sex change 30s, 57 ℃ of annealing 50s, 72 ℃ extend 50s, totally 35 circulations, last 72 ℃ are extended 7min.Set up the test of M-MLV (-) negative control, the PCR product detects through 1% agarose gel electrophoresis.
4) purifying of reaction product: utilize Agarose Gel DNA Purification Kit Ver.2.0 glue to reclaim test kit, operation steps is cut glue by product description and is reclaimed purifying.
5) sequencing and homology search: send completion order-checking with purified pcr product, with institute's calling sequence and gene pool sequence alignment by TaKaRa (Dalian) company.
6) macaque resistin gene 3'RACE:
According to known macaque resistin gene fragment sequence and 3'-Full RACE Core Set Ver.2.0 test kit specification sheets schedule of operation, design 3'-RACE specificity GSP primer.
GSP primer: F1 5'AAAGCCCTCTGTCTCCTCCTCCTG 3';
GSP primer: F2 5'TGGAAGAAGCCGTCAATGAGAAGA 3';
GSP primer: F3 5'GCGCCGAGACCACATGTCACTGCC 3';
GSP primer: F4 5'CAGTGCGCGGGCATGGACTGGACC 3';
Use 3'-Full RACE Core Set Ver.2.0 test kit to carry out reverse transcription, set up M-MLV (-) negative control simultaneously, reaction system and condition are:
Reaction system: total RNA (1 μ g/ μ L)/1 μ L, 3'RACE Adaptor (5 μ M)/1 μ L, dNTP Mixture (10mM each)/1 μ L and RNase Free dH after the DNase I is handled
2O/4.5 μ L mixes; 65 ℃ of reaction 5min; Place 2min on ice immediately, add 5 * M-MLV Buffer/2 μ L, RNase Inhibitor (40U/ μ L)/0.25 μ L and Reverse Transcriptase M-MLV (RNase H) (200U/ μ L)/0.25 μ L successively, TV is 10 μ L; 42 ℃ of reaction 60min, 70 ℃ of reaction 15min.
3'RACE first round PCR reaction:
Reaction system: 3'-RACE reverse transcription product/1 μ L, dNTP Mixture (2.5mM each)/8 μ L, GSP1 Primer (20 μ M) F1/F2/1 μ L, 3'RACE Outer Primer (10 μ M)/2 μ L, 2 * GC Buffer I/25 μ L, TaKaRa LA Taq (5U/ μ L)/0.5 μ L and dH
2O/12.5 μ L, TV are 50 μ L.
Reaction conditions is: 94 ℃ of preparatory sex change 3min, and 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ of extension 2min, 25 circulations, 72 ℃ are extended 3min.
3'RACE second takes turns the PCR reaction:
Reaction system: first round PCR product/1 μ L, dNTP Mixture (2.5mM each)/8 μ GSP2 Primer (20 μ M) F3/F4/1 μ L, 3'RACE Inner Primer (10 μ M)/2 μ L, 2 * GC Buffer I/25 μ L, TaKaRa LA Taq (5U/ μ L)/0.5 μ L and dH
2O/12.5 μ L, TV are 50 μ L.
Reaction conditions: 94 ℃ of preparatory sex change 1min, 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ of extension 2min, 31 circulations, 72 ℃ are extended 7min.
3'RACE second takes turns the PCR product and respectively gets 5 μ L and carry out 1% agarose gel electrophoresis and detect, and the result is as shown in Figure 1.Use Agarose Gel DNA Purification Kit Ver.2.0 to cut glue and reclaim purifying 3'RACE product, and send by TaKaRa (Dalian) company and check order.
7) macaque resistin gene 5'-RACE:
According to known macaque resistin gene fragment sequence and 5'-Full RACE Kit test kit specification sheets schedule of operation, design 5'-RACE specificity GSP primer.
GSP primer: 5R1 5'GCACTGGCAGTGACATGTGGTCTC 3';
GSP primer: 5R2 5'ACAAGTGCAACTGGTGACGGCGAA 3';
GSP primer: 5R3 5'TCCTGAATCTTCTCATTGACGGCT 3';
The total RNA that handles through the DNase I carries out the dephosphorylation processing:
Reaction system: Total RNA (1 μ g/ μ L)/2 μ L, RNase Inhibitor (40U/ μ L)/1 μ L, 10 * Alkaline Phosphatase Buffer (MgCl
2Free)/5 μ L, Alkaline Phosphatase (Calf intestine) (16 U/ μ L)/0.6 μ L and RNase Free dH2O/41.4 μ L, TV 50 μ L, 50 ℃ of reaction 1h add the 3M CH of 20 μ L successively
3COONa (PH5.2), 130 μ L RNase Free dH
2O, fully mixing; Add 200 μ L phenol/chloroform/primary isoamyl alcohol (25:24:1) again, the abundant centrifugal 5min of 13000r/min room temperature behind the mixing, with the upper water phase transition to new Microtube; The chloroform that adds 200 μ L again, the abundant centrifugal 5min of 13000r/min room temperature behind the mixing to new Microtube, adds mixing behind the NA Carrier of 2 μ L with the upper water phase transition; Add 200 μ L Virahols again, cooled on ice 10min behind the mixing, 4 ℃ of centrifugal 20min of 13000r/min abandon supernatant; Add 500 μ L, 70% cold ethanol rinsing again, 4 ℃ of centrifugal 5min of 13000r/min abandon the supernatant drying; The RNase Free dH that adds 7 μ L again
2The O dissolution precipitation obtains CIAP-treated RNA.
" remove cap " and react:
Reaction system: CIAP-treated RNA/7 μ L, RNase Inhibitor (40U/ μ L)/1 μ L, 10 * TAP Reaction Buffer/1 μ L, Tobacco Acid Pyrophosphatase (0.5U/ μ L)/1 μ L; TV 10 μ L; 37 ℃ of reaction 1h promptly obtain CIAP/TAP-treated RNA.
5'RACE Adaptor is connected to Ligated RNA:
Prepare following solution earlier: CIAP/TAP-treated RNA/5 μ L, 5'RACE Adaptor (15 μ M)/1 μ L, RNase Free dH
2O/4 μ L mixes; Place 2min on ice behind 65 ℃ of insulation 5min; Add RNase Inhibitor (40U/ μ L)/1 μ L, 5 * RNA Ligation Buffer/8 μ L, 40%PEG#6000/20 μ L and T4 RNA Ligase (40U/ μ L)/1 μ L then successively; TV 40 μ L, 16 ℃ are reacted 1h, add the 3M CH of 20 μ L
3The RNase Free dH of COONa (PH5.2), 140 μ L
2The abundant mixing of O; Phenol/chloroform/the primary isoamyl alcohol (25:24:1) that adds 200 μ L again, the abundant centrifugal 5min of 13000r/min room temperature behind the mixing, with the upper water phase transition to new Microtube; The chloroform that adds 200 μ L again, the abundant centrifugal 5min of 13000r/min room temperature behind the mixing, with the upper water phase transition to new Microtube; Add mixing behind the NA Carrier of 2 μ L again; Add 200 μ L Virahols, cooled on ice 10min behind the mixing, 4 ℃ of centrifugal 20min of 13000r/min abandon supernatant; Add 500 μ L, 70% cold ethanol rinsing again, 4 ℃ of centrifugal 5min of 13000r/min abandon the supernatant drying; The RNase Free dH that adds 6 μ L again
2The O dissolution precipitation promptly obtains Ligated RNA.
Ligated RNA reverse transcription reaction, set up M-MLV (-) negative control simultaneously:
Reaction system: Ligated RNA/6 μ L, Ologo dT Primer (2.5 μ M)/0.5 μ L and dNTP (10mM each)/1 μ L; Put 2min on ice behind the insulation 10min down for 70 ℃; Add 5 * M-MLV Buffer/2 μ L, RNase Inhibitor (40U/ μ L)/0.25 μ L and Reverse Transcriptase M-MLV (RNase H-)/0.25 μ L successively, TV 10 μ L.
Reaction conditions: 42 ℃ of reaction 60min, 70 ℃ of reaction 15min.
5'-RACE first round PCR reaction:
Reaction system: Ligated RNA reverse transcription product/1 μ L, dNTP Mixture (2.5mM each)/8 μ L, GSP Primer 5R1/1 μ L, 5'RACE Outer Primer (10 μ M)/2 μ L, 2 * GC Buffer I/25 μ L, TaKaRa LA Taq (5U/ μ L)/0.5 μ L and dH
2O/12.5 μ L, TV are 50 μ L.
Reaction conditions: 94 ℃ of preparatory sex change 3min, 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ of extension 2min 30s, 25 circulations, 72 ℃ are extended 7min.
5'-RACE second takes turns the PCR reaction:
Reaction system: first round PCR product/1 μ L, dNTP Mixture (2.5mM each)/8 μ L, GSP Primer (20 μ M) 5R2/5R3/1 μ L, 5'RACE Inner Primer (10 μ M)/2 μ L, 2 * GC Buffer I/25 μ L, TaKaRa LA Taq (5U/ μ L)/0.5 μ L and dH
2O/12.5 μ L, TV are 50 μ L.
Reaction conditions: 94 ℃ of preparatory sex change 1min, 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ of extension 2min 30s, 32 circulations, 72 ℃ are extended 7min.
5'RACE second takes turns the PCR product and respectively gets 5 μ L and carry out 1% agarose gel electrophoresis and detect, and the result is as shown in Figure 2.Use Agarose Gel DNA Purification Kit Ver.2.0 to cut glue and reclaim purifying 5'RACE product, and send by TaKaRa (Dalian) company and check order.
8) sequence assembly: the new segment sequence that known template sequence and 3'RACE, 5'RACE obtain is carried out sequence assembly with SequencherTM software; Carry out sequence in conjunction with order-checking peak figure and proofread and correct, obtain macaque resistin gene cDNA full length sequence shown in the SEQ ID NO.1.
Sequence table
SEQ?ID?NO.1
< 110>Chinese Academy of Medical Sciences Beijing Union Medical College Institute of Health on Nutriology
< 120>a kind of cloning process of macaque resistin gene cDNA full length sequence
<160>1
<210>1
<211>526
<212>cDNA
<213>Macaque (
Macacamalutta)
< 221>macaque resistin gene
<222>(1)…(526)
<400>1
acccccagag?gcctcaaaga?aagagctgcg?gtgcaagaat?tcgtgtgcca?gatttggtta 60
gctgagtcca?cccagaggcg?cctgcaggat?gaaagccctc?tgtctcctcc?tcctgcctgt 120
cctggggctg?ctggtgtcta?gccagaccct?gtgctccatg?gaagaagccg?tcaatgagaa 180
gattcaggag?ggcgccagct?ccttagtatt?tagggcaata?aggagcattg?gcctggagtg 240
ccagagcgtc?acctccaggg?gggacctggc?tacttgcccc?cgaggcttcg?ccgtcaccag 300
ttgcacttgt?ggctccgcct?gtggctcgtg?ggatgtgcgc?gccgagacca?catgtcactg 360
ccagtgcgcg?ggcatggact?ggaccggagc?gcgctgctgt?cgtctgcagc?cctgaggtcg 420
cgcgcagcgc?gtgcacagcg?ctggcggagg?cggctccagg?tgcggacggg?ttgtggggga 480
gctggaaata?aacctggaga?tgatgatgat?gatggaaaaa?aaaaaa 526
Claims (1)
1. the cloning process of a macaque resistin gene cDNA full length sequence; Its cDNA full length sequence that is obtained is shown in SEQ ID NO.1; It is characterized in that this method is the known fragment design of the human resistin gene of a utilization primer, extract total RNA, carry out the RT-PCR amplification with the macaque fatty tissue; Use the macaque resistin gene fragment that increases as known array; Adopt RACE technology again, angle through 5'-RACE and 3'-RACE and get known fragment sequence 5' end and the unknown nucleotide sequence that 3' holds, obtain macaque resistin gene cDNA full length sequence after using sequence assembly software with the cDNA sequence assembly that obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100413768A CN102559694A (en) | 2012-02-23 | 2012-02-23 | Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100413768A CN102559694A (en) | 2012-02-23 | 2012-02-23 | Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102559694A true CN102559694A (en) | 2012-07-11 |
Family
ID=46406300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100413768A Pending CN102559694A (en) | 2012-02-23 | 2012-02-23 | Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559694A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343133A (en) * | 2013-07-03 | 2013-10-09 | 中国农业大学 | Full-length cDNA (complementary Deoxyribose Nucleic Acid) of switchgrass lignin biosynthetic enzyme gene PvCCoAOMT and cloning method of full-length cDNA |
| CN104880564A (en) * | 2015-04-30 | 2015-09-02 | 南京格耀生物科技有限公司 | Kit for detecting resistin as well as preparation method and detection method of kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1594363A (en) * | 2004-07-08 | 2005-03-16 | 中国医学科学院放射医学研究所 | Anti-human phylaxin synthetic polypeptide antibody and its preparation method |
| CN101721704A (en) * | 2008-06-18 | 2010-06-09 | 谭焕然 | Method and medicament for regulating glycogen content in liver cell |
| CN102236015A (en) * | 2011-04-12 | 2011-11-09 | 黄若磐 | Competitive inhibiting enzyme-linked immune chip kit for detecting obesity factors and preparation method of competitive inhibiting enzyme-linked immune chip kit |
-
2012
- 2012-02-23 CN CN2012100413768A patent/CN102559694A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1594363A (en) * | 2004-07-08 | 2005-03-16 | 中国医学科学院放射医学研究所 | Anti-human phylaxin synthetic polypeptide antibody and its preparation method |
| CN101721704A (en) * | 2008-06-18 | 2010-06-09 | 谭焕然 | Method and medicament for regulating glycogen content in liver cell |
| CN102236015A (en) * | 2011-04-12 | 2011-11-09 | 黄若磐 | Competitive inhibiting enzyme-linked immune chip kit for detecting obesity factors and preparation method of competitive inhibiting enzyme-linked immune chip kit |
Non-Patent Citations (1)
| Title |
|---|
| NCBI: "Macaca mulatta resistin (RETN), mRNA", 《GENBANK》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343133A (en) * | 2013-07-03 | 2013-10-09 | 中国农业大学 | Full-length cDNA (complementary Deoxyribose Nucleic Acid) of switchgrass lignin biosynthetic enzyme gene PvCCoAOMT and cloning method of full-length cDNA |
| CN103343133B (en) * | 2013-07-03 | 2015-12-02 | 中国农业大学 | Switchgrass lignin biosynthesis gene PvCCoAOMT full-length cDNA and cloning process thereof |
| CN104880564A (en) * | 2015-04-30 | 2015-09-02 | 南京格耀生物科技有限公司 | Kit for detecting resistin as well as preparation method and detection method of kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Transcriptome profile analysis of adipose tissues from fat and short-tailed sheep | |
| Zhang et al. | Characterization and differential expression of microRNAs in the ovaries of pregnant and non-pregnant goats (Capra hircus) | |
| Shpilman et al. | Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia | |
| CN107025385B (en) | Design method of circular RNA primer | |
| CN102559694A (en) | Cloning method for cDNA (complementary Deoxyribonucleic Acid) full-length sequence of macaque resistin gene | |
| CN107974507A (en) | A kind of curved spot octopus mitochondrial genome complete sequence primer and design, phylogenetic analysis and amplification method | |
| CN101845439B (en) | Method for using silkworm cultured cell to express antibacterial peptide Cecropin B | |
| CN102443602A (en) | Construction method of RNA interference carriers for interfering in a plurality of genes of silencing rice black-streaked dwaf disease | |
| Kawakoshi et al. | CNP is the only natriuretic peptide in an elasmobranch fish, Triakis scyllia | |
| Liebscher et al. | Seasonal freeze resistance of rainbow smelt (Osmerus mordax) is generated by differential expression of glycerol-3-phosphate dehydrogenase, phosphoenolpyruvate carboxykinase, and antifreeze protein genes | |
| CN106749615A (en) | A kind of turbot somatomammotropin SL genes, recombinant protein and preparation method thereof | |
| CN116333082A (en) | Brown yellow blood tick ferritin, gene, preparation method and application | |
| CN102732972A (en) | Screening library of nucleic acid aptamers | |
| CN103966231A (en) | Molecular cloning of GLP2R gene fragments associated with pork quality traits and application of GLP2R gene fragments | |
| RU2013154399A (en) | METHODS AND COMPOSITIONS FOR SILENCING FAMILIES OF GENES WITH APPLICATION OF ARTIFICIAL MICRORNA | |
| CN104164437A (en) | Method for acquiring novel transcription spliced variant of goat Dlk1 gene | |
| CN102643817B (en) | Sheep K71 skin hair follicle specificity promoter and clone thereof | |
| CN114958982A (en) | Nucleic acid reagent, kit and method for detecting trace human SRY gene by fluorescent quantitative PCR | |
| CN104195148B (en) | A kind of pavlova viridis delta-5 delta 8 desaturase genes and preparation method for EPA synthesis | |
| Liu et al. | Effect of TEA domain transcription factor 1 (TEAD1) on the differentiation of intramuscular preadipocytes in goats | |
| Xue et al. | Molecular characterization of myostatin in black seabream, Acanthopagrus schlegelii: Full Length Research Paper | |
| CN102839145A (en) | Genetic engineering bacterium expressing snake venom kininogenase as well as constructing method and application thereof | |
| CN110804672B (en) | PCR method for identifying variety of dragon tree | |
| EP2726619B1 (en) | Peptide with the enzymatic activity of a dicer-like protein, a method for preparing short rna molecules, and use thereof | |
| CN107541519B (en) | Heterophylly falsestarwort root cyclic peptide HA precursor protein gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120711 |