CN102559684A - Branchiostoma belcheri actin gene promoter and application thereof - Google Patents

Branchiostoma belcheri actin gene promoter and application thereof Download PDF

Info

Publication number
CN102559684A
CN102559684A CN2012100435644A CN201210043564A CN102559684A CN 102559684 A CN102559684 A CN 102559684A CN 2012100435644 A CN2012100435644 A CN 2012100435644A CN 201210043564 A CN201210043564 A CN 201210043564A CN 102559684 A CN102559684 A CN 102559684A
Authority
CN
China
Prior art keywords
gene
lancelet
branchiostoma
promoter
actin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2012100435644A
Other languages
Chinese (zh)
Other versions
CN102559684B (en
Inventor
冯俊
王义权
李光
刘欣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xiamen University
Original Assignee
Xiamen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xiamen University filed Critical Xiamen University
Priority to CN 201210043564 priority Critical patent/CN102559684B/en
Publication of CN102559684A publication Critical patent/CN102559684A/en
Application granted granted Critical
Publication of CN102559684B publication Critical patent/CN102559684B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a Branchiostoma belcheri actin gene promoter and application thereof, relate to a Branchiostomactin gene and provides the Branchiostoma belcheri actin gene promoter and application thereof to the regulation of expression of the Branchiostoma belcheri gene. The Branchiostoma belcheri actin gene promoter can effectively regulate the expression of a downstream gene; a cloned and separated minimal promoter can be applied to study on functions of Branchiostoma transcription regulating elements, such as an enhancer, while a basic promoter of the acting gene can be applied to study on interested gene functions at different times and in different spaces; and a promoter-mediated target gene is integrated into a Branchiostoma genome to obtain a transgenic Branchiostoma, so that target genes in different developmental stages or at different parts of the Branchiostoma can be studied.

Description

Bai Shi lancelet actin gene promotor and application thereof
Technical field
The present invention relates to the lancelet actin gene, particularly Bai Shi lancelet actin gene promotor and application thereof.
Background technology
Lancelet (Amphioxus) is subordinate to Chordata (Chordate) Cephalochordata (Cephalochordate); It is in invertebrates and evolves to important transitory stage of vertebrates, is to be similar to one of monoid of the direct ancestors of Vertebrata most in the existing biology.Because of its unique evolution status, and simple in structure, health is translucent; It is human 1/6 that genome is merely, demonstrate vertebrates ancestors before the gene multiplication genomic characteristic (1, Balczarek, K.A.; Lai, Z.C., Kumar; S., Evolution of functional diversification of the pair box (Pax) DNA-binding domains.Molecular.Biology and Evolution [J] .1997. (14), 829-842.).Along with the research to lancelet is deep day by day, Florida lancelet (Branchiostoma flloridae) and Bai Shi lancelet (Branchiostoma belcheri) genome sequencing are accomplished, the especially lancelet laboratory success of breeding continuously (2, Zhang; Q.J., Sun, Y.; Zhong, J., Li; G., L ü, X.M.; Wang, Y.Q, Continuous culture of two lancelets and production of the second filial generation in laboratory.Journal of Experimental Zoology (Molecular and Developmental Evolution) [J] .2007; 308 (4), 464-472) and the stable foundation of microinjection technique, greatly promoted the medelling process of lancelet.The biotechnology of successful Application in other model animalss is progressively set up in lancelet like RNA perturbation technique and cell culture technology etc. equally.As a kind of novel model animals, the molecular tool of studying its regulation and control destination gene expression is absolutely necessary, up to the present; Have only Fox D gene promoter in the lancelet of Florida (3, Yu, J.K., Holland; N.D., Holland, L.Z.; Tissue-specific expression of FoxD reporter constructs in amphioxus embryos.Development Biology.2004. (274) 452-461) is in the news.
In existing several modes biology, set up some regulate gene expression systems, as the tsiklomitsin inducible system (5, Gossen; M., and Bujard, H.; Anhydrotetracycline, a novel effector for the tetracycline controlled gene expression systems in eukaryotic cells.Nucleic Acids Research, 1993.21; 4411-4412), the Gal/UAS system (6, Lewandoski, M.; Conditional control of gene expression in the mouse.Nature Reviews Genetics.2001.2 (10) 743-755), or develops some tissue-specific promotor or enhansers; As the vasa gene promoter can make the downstream goal gene only in sexual cell, express (7, Tanaka, M., Kinoshita; M., Kobayashi, D.; Nagahama, Y., Establishment of medaka (Oryzias latipes) transgenic lines with the expression of green fluorescent protein fluorescence exclusively in germ cells:a useful model to monitor germ cells in a live vertebrate.Proceedings of the National Academy of Sciences.2001.98 (5); 2544-2549), the promotor of the cadherin gene that kidney cell is special can guide reporter gene in kidney and genitourinary tract specifically expressing (8, Shao, X.L.; Johson, J.E., Richardson; J.A., Hiesberger, T.; Igarashi; P., Aminimal Ksp-Cadhe-rin promoter linked to a green fluorescent protein reporter gene exhibits tissue-specific expression in the developing kidney and genitourinary tract.Journal of American.Sociology.2002.13,1824-1836).Yet there is unsurmountable drawback in the above two kinds of methods of mentioning, the one, need numerous tissue-specific promotor of exploitation or enhanser, simultaneously not the easy-regulating target gene expression (9, Rome, C., Couillaud; F., Moonen, C.T.W., Spatial and temporal control of expression of therapeutic genes using heat shock protein promoters.Methods [J] .2005.35,188-198); The 2nd, chemicals is induced, to body harmful or have the potential spinoff (10, Oda, S., Mikami, S.; Urushihara, Y., Murata, Y., Kamei; Y., Deguchi, T., Kitano; T., Fujimori, K.E.; Yuba, S., Todo, T.; Mitani, H., Identification of a functional medaka heat shock promoter and characterization of its ability to induce exogenous gene expression in medaka in vitro and in vivo.Zoological Science.2010.27 (5), 410-415).Thereby, in novel model animals lancelet, need set up better expression regulation system.Actin gene promotor as molecular tool can be used for the research of upstream region of gene transcriptional regulatory element and exogenous gene expression (11, McElroy, D., Zhang, W G.; Cao, J., Wu, R.; 1990.lsolation of an Efficient Actin Promoter for Use in Rice Transformation.The Plant Cell, Vol.2,163-171.12, Liu, Z J.; Moav, B., Faras, A J.; Guise, K S., Kapuscinski, A R.; Hackett, P B., 1990.Functional analysis of elements affecting expression of the beta-actin gene of carp.Mol Cell Biol.July; 10 (7): 3432-3440.13, Liu, Z J., Moav, B., Faras; A J., Guise, K S., Kapuscinski, A R.; Hackett, P B., 1991.Importance of the CArG box in regulation of β-actin-encoding genes.Gene, 108211-217.14, Yee, S P.; Righby, P W J., 1993.The regulation of myogenin gene expression during the embryonic development of the mouse.Genes & Dev..7:1277-1289.15, M ü ller, F., Williams; DW., Kobolak J., Gauvry L., Goldspink G., Orban L.; Maclean N., 1997.Activator Effect of Coinjected Enhancerson the Muscle-Specific Expression of Promoters in Zebrafish Embryos.Molecular Reproduction and Development, 47:404-412.16, Feng, H., Cheng; J., Liu, S J., Liu, Y.; 2006.Cloning of Black Carp β-actin Gene and Primarily Detecting the Function of Its Promoter Region.Acta Genetica Sinica, 33 (2): 133-140.17, Beckmann, S., Wippersteg, V.; El-Bahay, A., Hirzmann, J., Oliveira; G., Grevelding, C G., 2007.Schistosoma mansoni:Germ-line transformation pproaches and actin-promoter analysis.Experimental Parasitology, 117 292-303.18, Goode; D., Callaway, H A., Cerda; G A., Lewis, K E., Elgar G.; 2011.Minor change, major difference:divergent functions of highly conserved cis-regulatory elements subsequent to whole genome duplication events.Development, 138,879-884).In transgenic zebrafish, mouse isotype animal, all well used, but still blank at present to the research of lancelet actin gene promotor.In addition, self promotor should than other source of species will more suitable lancelet research.
Summary of the invention
The object of the present invention is to provide basic promotor of Bai Shi lancelet actin gene and minimal promoter.
Second purpose of the present invention is to provide basic promotor of Bai Shi lancelet actin gene and the application of minimal promoter in the genetic expression of regulation and control Bai Shi lancelet.
The nucleotides sequence of the basic promotor of said Bai Shi lancelet actin gene is classified as:
gccctagatt?gtttcacatc?tggtgtagct?acaccaatat?tgggcttgcc?cagtacacgc 60
catgagtaag?caatgctgcc?attgtgtaaa?catgggggca?tccctccaca?ggaccatatt 120
tggcaagcaa?aattgtgtct?cacctgagca?agggctgctg?atattgtgat?aagcctggat 180
ttgcatacta?taggatgggt?gtggccacat?attctgtgct?aatgaatagt?aaatactagc 240
tgccttttct?tttgtgcatt?gtcattgtgc?atttgatttg?gatttttcct?aaactttcct 300
ttatctacta?aactttgtga?ttttggtgct?tgcatgctca?ttagttttgt?gtaaatttgt 360
tgtgcttagg?gaagtcatat?ttgagtgtag?ggaagtcttt?tcctgcagaa?aactaggttg 420
tgtggatgtt?cctgaaaatg?tggggggaag?acttcctcat?tcctaactgc?tgtgagtcat 480
ggctggctgc?ctggttgata?tgtcagaaga?ggaagtggct?agtaagtggg?ggcaggaagg 540
gcttcccctg?acacctgatg?tccaaatatg?gccctggctc?cttgccctat?aaggctttgg 600
gtgtgtcctt?atatgggcat?cagcctctgt?ctgattggtg?agtcagggaa?gtgacatcat 660
ccaaccactc?accatatcca?gtgcttataa?gcagtgctct?ctggcttctt?tcattcattc 720
ggtgctcttg?cattttgctg?ctcca 745
The nucleotides sequence of said Bai Shi lancelet actin gene minimal promoter is classified as:
gcatcagcct?ctgtctgatt?ggtgagtcag?ggaagtgaca?tcatccaacc?actcaccata 60
tccagtgctt?ataagcagtg?ctctctggct?tctttcattc?attcggtgct?cttgcatttt 120
gctgctcca 129
Said basic promotor of Bai Shi lancelet actin gene and minimal promoter can be used in the genetic expression of regulation and control Bai Shi lancelet.
Said Bai Shi lancelet actin gene promotor can effectively be regulated and control downstream gene expression; The minimal promoter of clone and separate can be used for the research of the function of lancelet transcriptional regulatory element such as enhanser etc.; The basic promotor of actin gene then can be with opposing interested gene function on different time, the research on the different spaces.The goal gene of this promotor mediation is incorporated in the lancelet genome, sets up the transgenic lancelet, can study the different development stage of lancelet or the goal gene of different sites.This shows that Bai Shi lancelet actin gene promotor can be used for regulating and control Bai Shi lancelet expression of gene.
Basic promotor of Bai Shi lancelet actin gene and minimal promoter starting efficiency are high.And be the endogenic promotor of Bai Shi lancelet, can be applied to easily promptly should be able to and the research of transcriptional regulatory element.The present invention has successfully cloned basic promotor and the minimal promoter of 129bp of the upper reaches 745bp sequence of lancelet actin gene; And this fragment is written into the report carrier that has the LAcZ gene; Carry out functional check the lancelet embryo; Proved that these two fragments are basic promotor and minimal promoter really, can be used as the molecular switch of regulation and control lancelet gene spatial and temporal expression and the molecular tool of transcriptional regulatory element function.
Description of drawings
Fig. 1 is that different recombinant plasmids are at lancelet embryo expression data statistical graph.The recombinant plasmid of 745bp is the highest at body segment (s) expression amount, at notochord (n), and neural ridge (nc), it is 91.46% that ectoderm (e) etc. also has expression, expression efficiency; The expression of recombinant plasmid efficient of 129bp is 0; The expressive site of the recombinant plasmid of 129bp front insertion enhancer element is mainly at body segment (s) and notochord (n), and at neural ridge (nc), ectoderm (e) also has expression, and expression efficiency is 93.82%.The 129bp front is inserted immediately, and the expression efficiency of segmental recombinant plasmid is 0; LacZ recombinant plasmid vector and expression thereof:
Figure DEST_PATH_GDA0000146246440000041
TATA?Box?
Figure DEST_PATH_GDA0000146246440000042
CArG?Motif?■:CAAT?Box
Fig. 2 is basic promotor of lancelet actin gene and the expression of minimal promoter mediation LacZ in lancelet.A~C and E~G are that left surface is seen; D and H are that (the fish sample of D section is from C for the picture of lancelet paraffin section; The fish sample of H section is from G); A, B, E, F: the photo of about 14 body segments of neurula; C, G: the photo of the young before the opening; Expressive site: s:Somite (body segment), n:Notochord (notochord), n c:Nerve cord (neural ridge), e:Ectoderm (ectoderm), p:Pharynx (pharynx), ectopic (ectopic expression).
Embodiment
Embodiment 1 Bai Shi lancelet actin gene promotor sequence is obtained
1, Bai Shi lancelet actin gene family identifies and the EST data processing
With the actin gene sequence of Florida lancelet (19, Wei, Y., H., Zhang; Y., J., Chen; Y., Mao, B.; Y., 2009.Expanssion of the The Actin Gene Family in amphioxue.Zoological Research, 30 (5): 473-479) make bait and all Bai Shi lancelet actin genes are located from the genome that Zhongshan University has just discharged through homology sequence analysis BlastN program.33 actin genes have been found altogether.Through evolutionary analysis these genes are sorted out, Actin muscle protein sequence comparison have the CLUSTAL_W program accomplish (20, Thompson, J.; D., Higgins, D.; G., Gilson, T.; J.; 1994.CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucl.Acids Res. (1994) 22 (22): 4673-4680), comparison result is used for genealogical tree and makes up.System is accomplished by MEGA5.0 software in abutting connection with tree, and parameter is the Poisson distance method.These actin genes are divided into 3 types: plasmotype, and muscularity, and marginal.Through processing, confirmed the Bai Shi lancelet β type plasmotype actin gene Actin-6-2 of a high expression level in addition, be used for the research of follow-up promoter function Florida lancelet and Bai Shi lancelet EST data.
2, β-Actin-6-2 upstream region sequential analysis
In conjunction with the data of Bai Shi lancelet cDNA order-checking before the experiment and the data of Zhongshan University's release, the green initiation site of commentaries on classics of Bai Shi lancelet β-Actin-6-2 gene of choosing is predicted.Sequence to the about 1Kb in the transcription initiation site upper reaches is analyzed, and finds that it has comprised the typical controlling element that β-the Actin promotor is had: CAAT box, CArG motif, TATA box.Sequence to the transcription initiation site upper reaches 745bp that includes these 3 controlling elements has designed a pair of special primer, and primer sequence is:
Actin-F1: GCCCTAGATTGTTTCACATCTGG, the underscore italicized item is the HindIII restriction enzyme site;
Actin-R:
Figure BDA0000138024290000052
FGGAGCAGCAAAATGCAAGAG; The underscore italicized item is that Not I restriction enzyme site underscore italicized item is an EcoR I restriction enzyme site; Pcr amplification is carried out in this zone, obtain the basic promotor of Bai Shi lancelet actin gene.And then research and design only contain TATA box in above-mentioned 3 elements of a pair of special primer pcr amplification the zone study the function of minimal promoter, 129bp is only contained in this zone, primer sequence:
Actin-F2: GCCCTAGATTGTTTCACATCTGG; The underscore italicized item is the HindIII restriction enzyme site, and Actin-R is with above-mentioned the same.In addition; For whether the fragment of verifying this 129bp is minimal promoter; Further chosen a near enhancer sequence (21 that known Florida lancelet ZNF503/703 gene is; Holland et al, 2008, The amphioxus genome illuminates vertebrate origins and cephalochordate biology.Genome Res; 18 (7): 1100-11.) BlastN in the Bai Shi of the Zhongshan University lancelet genome; The homologous sequence of its correspondence in the Bai Shi lancelet is located out, with this section enhancer sequence (1748bp) from Bai Shi lancelet genome through pcr amplification come out (upper reaches that this enhanser fragment is positioned at the ZNF503/703 gene equally in Bai Shi lancelet genome), the sequence of special primer is:
Enhancer-F:
Figure BDA0000138024290000061
FGTTCGCGTTTTTGTTTGACAAG, the underscore italicized item is the HindIII restriction enzyme site;
Enhancer-R:
Figure BDA0000138024290000062
FCAACAGTCCTTCGCAGATGTTT; The underscore italicized item is the HindIII restriction enzyme site; At last; Selected one section Bai Shi lancelet genome sequence (636bp) to verify the segmental function of this 129bp, the sequence of random fragment primer immediately from another angle.
Random-F:CCC AGCAAACATTTGGGGAGGTG, the underscore italicized item is the HindIII restriction enzyme site;
Random-R:CCC
Figure BDA0000138024290000064
CTGTTTGTTCGTTAGCGTTG, the underscore italicized item is the HindIII restriction enzyme site.
The nucleotides sequence of the basic promotor of gained Bai Shi lancelet actin gene is classified as:
gccctagatt?gtttcacatc?tggtgtagct?acaccaatat?tgggcttgcc?cagtacacgc 60
catgagtaag?caatgctgcc?attgtgtaaa?catgggggca?tccctccaca?ggaccatatt 120
tggcaagcaa?aattgtgtct?cacctgagca?agggctgctg?atattgtgat?aagcctggat 180
ttgcatacta?taggatgggt?gtggccacat?attctgtgct?aatgaatagt?aaatactagc 240
tgccttttct?tttgtgcatt?gtcattgtgc?atttgatttg?gatttttcct?aaactttcct 300
ttatctacta?aactttgtga?ttttggtgct?tgcatgctca?ttagttttgt?gtaaatttgt 360
tgtgcttagg?gaagtcatat?ttgagtgtag?ggaagtcttt?tcctgcagaa?aactaggttg 420
tgtggatgtt?cctgaaaatg?tggggggaag?acttcctcat?tcctaactgc?tgtgagtcat 480
ggctggctgc?ctggttgata?tgtcagaaga?ggaagtggct?agtaagtggg?ggcaggaagg 540
gcttcccctg?acacctgatg?tccaaatatg?gccctggctc?cttgccctat?aaggctttgg 600
gtgtgtcctt?atatgggcat?cagcctctgt?ctgattggtg?agtcagggaa?gtgacatcat 660
ccaaccactc?accatatcca?gtgcttataa?gcagtgctct?ctggcttctt?tcattcattc 720
ggtgctcttg?cattttgctg?ctcca 745
The nucleotides sequence of Bai Shi lancelet actin gene minimal promoter is classified as:
gcatcagcct?ctgtctgatt?ggtgagtcag?ggaagtgaca?tcatccaacc?actcaccata 60
tccagtgctt?ataagcagtg?ctctctggct?tctttcattc?attcggtgct?cttgcatttt 120
gctgctcca 129。
Embodiment 2 Bai Shi lancelet heat shock protein 70 gene promoters
1, makes up recombinant expression plasmid
Through HindIII, Not I double digestion is handled with the PCR product of 2 promoter regions of amplification, and (this carrier does not have promotor to be written into the LacZ that handles through same double digestion; Professor You Zhikai of Taiwan Academia Sinica is so kind as to give) in the carrier, transform DH5 α bacterial strain, after PCR and enzyme are cut evaluation, obtain positive colony and check order; It is errorless that proof is inserted fragment, likewise will be handled through the HindIII single endonuclease digestion by enhanser fragment and random fragment that PCR obtains, is written in the LacZ report carrier of the insertion 129bp that has obtained that handles through the HindIII single endonuclease digestion; Through transforming; Enzyme is cut, and order-checking obtains positive colony, carries out functional verification at last.Make up the recombinant plasmid of 4 kinds of LacZ altogether: the recombinant plasmid that comprises the 745bp of 3 elements (CAAT box, CArG box, TATA box); The recombinant plasmid that only comprises the 129bp of TATA box; The recombinant plasmid of an enhanser is inserted at the 129bp sequence upper reaches; A segmental immediately recombinant plasmid (referring to Fig. 1) is inserted at the 129bp sequence upper reaches.
2, microinjection lancelet embryo
Use lancelet embryo microinjection technique, the recombinant plasmid that builds is taken among the lancelet embryo verified.The lancelet embryo of injection is a unfertilized egg; Adopt 45 ℃ of oblique modes of inserting needle down to inject in the ovum; Each unfertilized egg injection volume is about 1~2 μ l, and the recombinant plasmid concentration of injection is about 100ng/ μ l, adds an amount of seawater and seminal fluid (according to seminal concentration and fertilization situation adjustment on same day consumption); If seminal concentration is not enough, can add an amount of NH 4CL solution stimulates motility of sperm.After fertilization, with renewing bright seawater, in order to avoid excessive fertilization, destroying fertilization membrane influences its growth.Place the fixed temperature and humidity incubator to cultivate (25 ℃ of temperature).The middle continuation cultivation of crystallizing dish (diameter 60mm) of fresh seawater slowly zygote the transferring to of growing in the petridish is equipped with.The micrurgy appearance is Narishige IM-30 type and Eppendorf Transferman NK2.Every kind of recombinant plasmid ovum ejection situation is seen Fig. 1; Active coloring shows that the fragment starting efficiency of 745bp is 91.46%; And the 129bp starting efficiency is 0, but after the 129bp recombinant vectors added positive enhanser, its expression efficiency had reached 93.82%; And expressive site also with the expressive site the same (Holland etc., 2008) of this tissue-specific enhancer (Fig. 1 and 2).Above data have proved absolutely that the sequence of this section 745bp has the function of promotor, and the sequence of 129bp is a minimal promoter.Can utilize it and institute's gene of interest to set up the transgenic lancelet; Carry out the expression study of crossing in the growth course on the space-time; The period of inquiring into its function and playing a role; Can for research lancelet gene function a strong instrument be provided in a word as the research of gene non-coding region function in addition.
Figure IDA0000138024380000011
Figure IDA0000138024380000021

Claims (4)

1. the basic promotor of Bai Shi lancelet actin gene is characterized in that its nucleotides sequence classifies as:
gccctagatt?gtttcacatc?tggtgtagct?acaccaatat?tgggcttgcc?cagtacacgc 60
catgagtaag?caatgctgcc?attgtgtaaa?catgggggca?tccctccaca?ggaccatatt 120
tggcaagcaa?aattgtgtct?cacctgagca?agggctgctg?atattgtgat?aagcctggat 180
ttgcatacta?taggatgggt?gtggccacat?attctgtgct?aatgaatagt?aaatactagc 240
tgccttttct?tttgtgcatt?gtcattgtgc?atttgatttg?gatttttcct?aaactttcct 300
ttatctacta?aactttgtga?ttttggtgct?tgcatgctca?ttagttttgt?gtaaatttgt 360
tgtgcttagg?gaagtcatat?ttgagtgtag?ggaagtcttt?tcctgcagaa?aactaggttg 420
tgtggatgtt?cctgaaaatg?tggggggaag?acttcctcat?tcctaactgc?tgtgagtcat 480
ggctggctgc?ctggttgata?tgtcagaaga?ggaagtggct?agtaagtggg?ggcaggaagg 540
gcttcccctg?acacctgatg?tccaaatatg?gccctggctc?cttgccctat?aaggctttgg 600
gtgtgtcctt?atatgggcat?cagcctctgt?ctgattggtg?agtcagggaa?gtgacatcat 660
ccaaccactc?accatatcca?gtgcttataa?gcagtgctct?ctggcttctt?tcattcattc 720
ggtgctcttg?cattttgctg?ctcca 745。
2. the application of the basic promotor of Bai Shi lancelet actin gene in the genetic expression of regulation and control Bai Shi lancelet according to claim 1.
3. Bai Shi lancelet actin gene minimal promoter is characterized in that its nucleotides sequence classifies as:
gcatcagcct?ctgtctgatt?ggtgagtcag?ggaagtgaca?tcatccaacc?actcaccata 60
tccagtgctt?ataagcagtg?ctctctggct?tctttcattc?attcggtgct?cttgcatttt 120
gctgctcca 129。
4. like the application of the said Bai Shi lancelet of claim 3 actin gene minimal promoter in the genetic expression of regulation and control Bai Shi lancelet.
CN 201210043564 2012-02-24 2012-02-24 Branchiostoma belcheri actin gene promoter and application thereof Expired - Fee Related CN102559684B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201210043564 CN102559684B (en) 2012-02-24 2012-02-24 Branchiostoma belcheri actin gene promoter and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201210043564 CN102559684B (en) 2012-02-24 2012-02-24 Branchiostoma belcheri actin gene promoter and application thereof

Publications (2)

Publication Number Publication Date
CN102559684A true CN102559684A (en) 2012-07-11
CN102559684B CN102559684B (en) 2013-06-05

Family

ID=46406290

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201210043564 Expired - Fee Related CN102559684B (en) 2012-02-24 2012-02-24 Branchiostoma belcheri actin gene promoter and application thereof

Country Status (1)

Country Link
CN (1) CN102559684B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102199604A (en) * 2011-03-21 2011-09-28 厦门大学 Branchiostoma belcheri heat shock protein 70 gene promoter and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102199604A (en) * 2011-03-21 2011-09-28 厦门大学 Branchiostoma belcheri heat shock protein 70 gene promoter and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
牟东珍等: "肝癌组织特异性P_(afp)IRES2-EGFP表达载体的构建及表达", 《潍坊医学院学报》 *
王华等: "文昌鱼Pax1/9基因上游调控区的克隆及分析", 《厦门大学学报(自然科学版)》 *

Also Published As

Publication number Publication date
CN102559684B (en) 2013-06-05

Similar Documents

Publication Publication Date Title
Dahm et al. Learning from small fry: the zebrafish as a genetic model organism for aquaculture fish species
Handler et al. Prospects for gene transformation in insects
CN106434748A (en) Development and applications of heat shock induced Cas9 enzyme transgene danio rerio
EP2877585B1 (en) Protein with recombinase activity for site-specific dna-recombination
Yoda et al. The transcription factor Apontic-like controls diverse colouration pattern in caterpillars
Roche et al. Trans-silencing by P elements inserted in subtelomeric heterochromatin involves the Drosophila Polycomb group gene, Enhancer of zeste
CN109734798B (en) Migratory locust serine protease inhibitor 7, and coding gene and application thereof
Ferguson et al. Genetic transformation of the codling moth, Cydia pomonella L., with piggyBac EGFP
Awazu et al. An enhancer trap in the ascidian Ciona intestinalis identifies enhancers of its Musashi orthologous gene
Li et al. A detailed procedure for CRISPR/Cas9-mediated gene editing in tilapia
Hiruta et al. Targeted gene disruption by use of transcription activator-like effector nuclease (TALEN) in the water flea Daphnia pulex
Matsuoka et al. Establishment of CRISPR/Cas9-based knock-in in a hemimetabolous insect: targeted gene tagging in the cricket Gryllus bimaculatus
Kontarakis et al. Transgenesis in non-model organisms: the case of Parhyale
Zimowska et al. The β2-tubulin gene from three tephritid fruit fly species and use of its promoter for sperm marking
Sasakura et al. Transposon mediated transgenesis in a marine invertebrate chordate: Ciona intestinalis
Zhong et al. Comparison of transformation efficiency of piggyBac transposon among three different silkworm Bombyx mori strains
Feng et al. Functional analysis of the promoter region of amphioxus β-actin gene: a useful tool for driving gene expression in vivo
CN108998455B (en) Bombyx mori nuclear polyhedrosis virus inducible 39K promoter, recombinant vector and application thereof
CN102199604B (en) Branchiostoma belcheri heat shock protein 70 gene promoter and application thereof
Liu et al. TALEN-mediated Drosophila genome editing: protocols and applications
Raphael et al. Bactrocera tryoni and closely related pest tephritids—molecular analysis and prospects for transgenic control strategies
CN102559684B (en) Branchiostoma belcheri actin gene promoter and application thereof
Khan et al. The β2Tubulin, Rad50-ATPase and enolase cis-regulatory regions mediate male germline expression in Tribolium castaneum
Ma et al. High-throughput and genome-scale targeted mutagenesis using CRISPR in a nonmodel multicellular organism, Bombyx mori
Koga et al. Transposable elements in medaka fish

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20130605

Termination date: 20190224

CF01 Termination of patent right due to non-payment of annual fee