CN102559681A - Poplar hypocotyl specific expression promoter ProWOX11b and application thereof - Google Patents
Poplar hypocotyl specific expression promoter ProWOX11b and application thereof Download PDFInfo
- Publication number
- CN102559681A CN102559681A CN2012100175666A CN201210017566A CN102559681A CN 102559681 A CN102559681 A CN 102559681A CN 2012100175666 A CN2012100175666 A CN 2012100175666A CN 201210017566 A CN201210017566 A CN 201210017566A CN 102559681 A CN102559681 A CN 102559681A
- Authority
- CN
- China
- Prior art keywords
- prowox11b
- promoter
- hypocotyl
- pcr
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a poplar hypocotyl specific expression promoter ProWOX11b and an application thereof. The nucleotide sequence of the promoter ProWOX11b is shown in SEQ NO.1. A preparation method of a poplar hypocotyl specific expression promoter ProWOX11b sequence comprises the steps of: with a south forest 898 poplar DNA (deoxyribonucleic acid) as a material, carrying out walking treatment for three times by adopting methods of anchored PCR (polymerase chain reaction), inverse PCR and TAIL-PCR (thermal asymmetric interlaced-PCR) gene cloning, and cloning to obtain the poplar hypocotyl specific expression promoter ProWOX11b sequence. A plant promoter expression vector pBGGUS-ProWOX11b is created by adopting a gateway cloning technology, the promoter is sequenced and connected with a GUS (glucuronidase) report gene, and the report gene GUS can be specifically expressed at the plant hypocotyl under an driving effect of the promoter ProWOX11b. Therefore, by means of the promoter provided by the invention, corresponding target genes can be induced to be specifically expressed at the hypocotyl in a plant gene project so as to improve good variety breeding process.
Description
Technical field
The invention belongs to the plant gene engineering technology field, be specifically related to a kind of willow hypocotyl specific expression promoter ProWOX11b and application thereof.
Background technology
Cuttage is as the vegetative important means of forest, and is not only simple, imitate high inexpensively, and can keep the good character of maternal plant, early flowering solid.Since the seventies in 20th century, along with the rise of Developing Clonal Forestry, the forest cuttage technique is increasingly mature, widespread use.
In forestry growth practice; Usually said cuttage; Refer generally to cuttage or epicormic branch cuttage, its key is the formation of adventive root: at first be that parenchyma cell or the dedifferentiation of vascular bundle cell form specific cells crowd, promptly mitogenetic point-Gen initial body; Then meristematic cell changes and begins division to active state gradually; The new cell mass that produces forms cone gradually and is divided into xylem and phloem, and the transfusion tissue with slotting fringe combines then, and the root original hase passes cortex and the outwards outstanding adventive root (Haissig 1974a) that forms of epidermis gradually.Some seeds adventive root initial body just produces the root initial body of promptly hiding when growth is exsomatized in early days.It is in dormant state always before the cuttage, after slotting fringe exsomatizes, under the adapt circumstance condition, continues to develop into the root original hase and produces adventive root.But it is after cuttage, just to differentiate the root initial body that some seeds are also arranged, and is called and brings out the root initial body.
The forest cuttage root-taking can be divided into skin zone's rooting type, callus rooting type and mix the rooting type three major types by time, position and the mechanism of its formation.Skin zone rooting type plant is before slotting fringe exsomatizes or through storage, and after the HORMONE TREATMENT, slotting fringe cortex, form layers etc. are organized just has the root initial body to form, and after the cuttage, just the continued growth of root initial body is grown.The callus rooting type is the regeneration vascular cambium in the lower cut callus after inserting the fringe cuttage, or when the former vascular cambium of incision produces callus, also produces the adventive root initial body, and then forms adventive root.Mix rooting types and be meant that existing skin zone takes root, have callus to take root again; After its process is cuttage; Skin zone took root and absorbed moisture and nutrient to earn a bare living before this, treat that the lower cut callus is taken root after, the decline very soon that the adventive root that skin zone produces has; Withdrawing to of having is less important, and develops into the main root system of plant by the adventive root that callus produces.
The forest cuttage root-taking is a very complicated biological procedures, and Chinese scholars has been carried out big quantity research to its mechanism, but these work all are confined to anatomy and physiology field, to the understanding of cuttage root-taking molecule mechanism with understand relatively shortage.Be that on the one hand the forest molecular genetics starts late; Moreover, because some biological characteristicses of forest self are accurately located the difficult point that once had been regarded as the genetics research field with clone's unknown gene in forest.The willow genome sequencing is accomplished, and clone and checking growth of poplar development related gene become possibility.Play important effect in the processes such as the WOX gene family is kept tip of a root stem cell, the startup of adventive root root original hase.Clone and evaluation adventive root specific expression promoter not only can enrich the molecular biological theoretical basis of root system of plant in willow, and have important use value aspect plant vegetative propagation and the isolated organ regeneration.
Promotor commonly used in the plant genetic engineering has 3 types: constitutive promoter, inducible promoter and tissue-specific promoter.Tissue-specific promoter is meant that under this type promoter regulation genetic transcription generally only occurs in some certain organs or the tissue.The element that generally has several kinds of control tissue specific expressions in this type promotor simultaneously, its expression specificity is by the common decision of kind, number and the relative position etc. of these elements.The relevant report that clone and evaluation adventive root specific expression promoter are not arranged in willow as yet.
Summary of the invention
Goal of the invention: the deficiency to existing in the prior art the purpose of this invention is to provide a kind of willow hypocotyl specific expression promoter ProWOX11b.Another object of the present invention provides the application of a kind of willow hypocotyl specific expression promoter ProWOX11b.
Technical scheme: in order to realize the foregoing invention purpose, the technical scheme that the present invention adopts is following:
A kind of willow hypocotyl specific expression promoter ProWOX11b, its aminoacid sequence is shown in SEQ NO1.
The carrier that contains willow hypocotyl specific expression promoter ProWOX11b.Said carrier is at 3 ' end assembling gus reporter gene of ProWOX11b promotor.Said carrier assembling Bial expression casette as the selection markers of transgenic plant, can carry out the screening of transfer-gen plant with weedicide.Said carrier assembling LB and RB sequence impel the ProWOX11b promoter expression framework and the selection markers gene Bial that are assembled in therebetween to be integrated in the plant recipient cell karyomit(e).
The host cell that contains willow hypocotyl specific expression promoter ProWOX11b.
Willow hypocotyl specific expression promoter ProWOX11b is in the application of regulatory gene in plant materials hypocotyl specifically expressing.
Woods 895 poplars on the south the present invention (Populus x euramericana cv. ' Nanlin895 ') DNA is a material; Adopt the method for anchor PCR, inverse PCR, TAIL-PCR gene clone; Move through three hyposynchronization, the clone obtains willow hypocotyl specific expression promoter ProWOX11b sequence.Adopt gateway cloning technique construction plant promoter expression vector pBGGUS-ProWOX11b, connect gus reporter gene behind this promoter sequence, under the driving of promotor ProWOX11b, reporter gene GUS can be at plant hypocotyl specifically expressing.
Beneficial effect: the present invention changes the ProWOX11b promotor over to Arabidopis thaliana through agriculture bacillus mediated, and the T2 that changes the ProWOX11b promoter vector shows that for Arabidopis thaliana plant GUS coloration result gus gene is at the hypocotyl specifically expressing.Therefore, use promotor provided by the invention, can be in plant genetic engineering, induction phase answers goal gene at the hypocotyl specifically expressing, improvement good variety selection process.
Description of drawings
Fig. 1 is the structural representation of plant expression vector pBGGUS;
Fig. 2 is a wild-type plant GUS colored graph;
Fig. 3 is a transfer-gen plant GUS colored graph.
Embodiment
Below in conjunction with specific embodiment the present invention is done further explanation.
Employed main agents box of following examples and medicine are: Plant Genomic DNA Kit (TIA NGEN), LR Clonase II enzyme Mix (Invitrogen), pCR
TM8/GW/TOPO
TMVect or (Invitrogen), TaKaRa LA Taq (TaKaRa), TaKaRa Taq (TaKaRa); PMD-19T (TaKaRa); H.Q.&Q.Gel Extraction kit II (Anhui excellent brilliant biotechnology ltd), terminal enzyme (DNA) (TaKaRa), Bgl II (NEB); BamH I (NEB), T4DNA Ligase (Fer mentas).All primers synthesize and examining order is accomplished by Invitrogen (Shanghai).Other are not made an explanation is conventional requirement.
Embodiment 1 extracts southern woods 895 poplar DNA
Can adopt ordinary method to extract southern woods 895 poplar DNA, also can adopt the plant genome DNA extraction test kit (Plant Genomic DNA Kit) of TIANGEN company to extract southern woods 895 poplar DNA, operation steps has improvement slightly:
Draw 1mL damping fluid GP1 in the 2mL centrifuge tube, 65 ℃ of preheatings; Simultaneously, getting Nan Lin 895 poplar tissue cultured seedling blade 100mg fully grinds in liquid nitrogen; 65 ℃ of preheating GP1 of packing damping fluid; With grinding in the 1mLGP1 damping fluid that meticulous sample powder transfers to preheating rapidly (in the 1mL of preheating damping fluid GP1, adding 10 μ L beta-mercaptoethanols before the application of sample), acutely put upside down 65 ℃ of water-bath 20min behind the mixing; Add the 1mL chloroform, fully mixing shifts in upper strata water to the new centrifuge tube behind the centrifugal 5min of 12000rmp; Repeat this step once; In the centrifuge tube that the upper strata water is housed, add 1mL damping fluid GP2, fully mixing; Mixed solution is changed among the adsorption column CB3, and the centrifugal 30sec of 12000rmp abandons filtrating; In adsorption column CB3, add 500 μ L protein liquid removal GD, the centrifugal 30sec of 12000rmp abandons filtrating; In adsorption column CB3, add 700 μ L rinsing liquid PW, the centrifugal 30sec of 12000rmp abandons filtrating; In adsorption column CB3, add 500 μ L rinsing liquid PW, the centrifugal 30sec of 12000rmp abandons filtrating; Change adsorption column CB3 over to new centrifuge tube, the centrifugal 2min of 12000rmp removes remaining rinsing liquid, and room temperature leaves standstill the dried adsorption column CB3 of gas; Adsorption column CB3 is changed in the new centrifuge tube, add 50 μ L sterilization Milli-Q water to the middle part of adsorption film, room temperature leaves standstill 2min, 12000 centrifugal 30sec; To filtrate changes among the adsorption column CB3 again, and room temperature leaves standstill 2min, 12000 centrifugal 2min, and filtrating is genomic dna.
Embodiment 2 clone ProWOX11a promotors
On the south woods 895 poplar DNA (embodiment 1 preparation) be material, adopt the method for anchor PCR, inverse PCR, TAIL-PCR gene clone, move through three hyposynchronization, clone and obtain the ProWOX11b promoter sequence, shown in SEQ NO1.Main process is following:
(1) anchor PCR
Single primer PCR amplification: with 2 μ g south woods 895 poplar genome DNA is template, adopts anchor PCR list primer to carry out single primer amplification, and anchor PCR list primer sequence is 5 ' ACACCACCGCTATCGTATGCCCGT 3 '.Reaction system is following: 10 * Ex PCR Buffer (Mg
2+Free) 5.0 μ L; 2.5mM dNTP Mixture 4.0 μ L; 25mM Mg
2+4.0 μ L; Ex Taq DNA Polymerase (5U/ μ L) 0.25 μ L; Anchor PCR list primer (10 μ M) 2 μ L; Template (895 poplar DNA, 1 μ g/ μ L) 2 μ L; Add aseptic ddH
2O supplies 50 μ L.Response procedures: sex change is 94 ℃ in advance, 7min; 94 ℃, 30s, 62 ℃, 30s, 72 ℃, 1.5min, 25 circulations, ordinary method reclaims product.
Add end reaction: in the recovery product of single primer PCR amplification, add 6 μ L tailing damping fluids (5 *), behind the 1 μ L 10mmol/L dCTP, add aseptic double-distilled water to 29 μ L again; Reaction mixture at 94 ℃ of insulation 2min, places on ice earlier immediately, add behind the 1 μ L terminal enzyme (DNA) at 37 ℃ of insulation 15min, again at 75 ℃ of insulation 10min with the deactivation terminal enzyme (DNA).
Nest-type PRC: adopt anchor primer AAP:5 ' GGCCACGCGTCGACTAGTAGTACGGGGGGGGG3 ' and nido gene-specific primer: 5 ' GCTTTGGAGTCCACCTTGACCTC 3 ' is to the amplification of tailing product.Reaction system is following: 10 * Ex PCR Buffer (Mg
2+Free) 5.0 μ L; 2.5mM dNTP Mixture 4.0 μ L; 25mM Mg
2+4.0 μ L; Ex Taq DNA Polymerase (5U/ μ L) 0.25 μ L; Anchor primer AAP (10 μ M) 2 μ L; Nido gene-specific primer (10 μ M) 2 μ L; Tailing product 1 μ L; Add aseptic ddH
2O supplies 50 μ L.Response procedures: sex change is 94 ℃ in advance, 5min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 2min, 35 circulations; 72 ℃, 10min.
Use the excellent brilliant biotechnology ltd's dna gel recovery test kit in Anhui (H.Q.&Q.Gel Extract ion kit II) to reclaim purified pcr product.Concrete operations: gel weight is reclaimed in weighing, approximate its volume of conversion; Add isopyknic NJ damping fluid, 60 ℃ of temperature are bathed 7min and are melted fully to gel; Change the DNA-agarose solution after melting over to Mu-Pu DNA and reclaim in the purification column, the centrifugal 1min of room temperature 12000rmp abandons filtrating; In purification column, add SPW (being the dilution of the equal-volume absolute ethyl alcohol) lavation buffer solution of 700 μ L working concentrations, leave standstill 2-3min, the centrifugal 1min of room temperature 13000rmp abandons filtrating; Repeat this step once; The centrifugal 1min of room temperature 13000rmp is with dry purification column; Purification column is transferred in the new 1.5mL centrifuge tube, adds 30-50 μ L sterilization Milli-Q water, leave standstill the centrifugal 1min of 13000rmp behind the 1min, filtrating is the PCR product of purifying; Get 2 μ L purified products, agarose gel electrophoresis detects, and judges that whether reclaim fragment contains assorted band, avoids non-specific PCR product to influence subsequent experimental.
The ligation of purifying fragment and cloning vector: the pMD19-T simple V etor clone target DNA molecule that adopts TaKaRa company; With reference to specification sheets; Ligation system and program have improvement slightly; Be specially: reaction system (5 μ L): the PCR product of 2.2 μ L purifying and recovering, 0.3 μ L pMD-19Simple Vector, 2.5 μ L Solution I.Reaction conditions: 16 ℃ of 30min; 4 ℃ are spent the night.
Intestinal bacteria transform: prepared fresh or-70 ℃ of frozen intestinal bacteria TOP10 competent cells are being melted on ice; Get the product that is connected of 5 μ L purifying fragments and cloning vector, join in the 100 μ L competent cells, and mixing gently, about ice bath 30min; Thermal shock 90sec in 42 ℃ of water-baths places 3-5min on ice rapidly; Add 800 μ L LB liquid nutrient mediums, 37 ℃, 100rmp shakes bacterium 1h; The centrifugal 3min of 4000rmp sops up upper strata 800 μ L substratum, mixing residue bacterium liquid; Bacterium liquid is applied on the LB screening and culturing plate that contains Amp, is inverted overnight cultures for 37 ℃.
Positive colony screening and sequencing analysis: select single colony inoculation in the LB liquid nutrient medium from the screening and culturing plate, 37 ℃, 250rmp shakes bacterium and spends the night; Directly the bacterium liquid with overnight cultures is the PCR detection that template is carried out recombinant conversion, and reaction system is as shown in table 3, and response procedures is: response procedures is: 94 ℃, and 3min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min, 28 circulations; 72 ℃, 7min.The clone of bacterium liquid PCR test positive send Ying Jun biotech company (Shanghai) order-checking to identify, get the anchor PCR sequence fragment, sequence is shown in SEQ NO2.
(2) inverse PCR
Adopt restriction enzyme that southern woods 895 poplar DNA are digested: to adopt Bgl II; BamH I carries out the double digestion complete digestion to 1 μ g south woods 895 poplar DNA, and reaction system is following: Bgl II 1.0 μ L, 10 * H buffer, 2.0 μ L; DNA 1.0 μ L add aseptic ddH
2O supplies 20 μ L.Response procedures: 37 ℃, 1h.The products therefrom purifying and recovering is cut through the second step enzyme again, and reaction system is following: BamH I 1.0 μ L, and 10 * K buf fer, 2.0 μ L, DNA 1.0 μ L add aseptic ddH
2O supplies 20 μ L.Response procedures: 30 ℃, 1h.After enzyme is cut postdigestive product and carried out purifying, be dissolved in the sterilized water.
Cyclization: adopt T4DNA Ligase to carry out the self-cyclisation ligation of linear DNA fragment, get cyclisation ligation product.Reaction system is following: linear DNA 10-50 μ g; 10 * T4DNA Ligas e buffer, 5 μ L; T4DNA Ligase (5U/ μ L) 1 μ L adds aseptic ddH
2O supplies 50 μ L.Response procedures: 22 ℃ of incubation 1h, again at 65 ℃ of insulation 10min fire extinguishing T4DNA Ligase.
The nest-type PRC amplification obtains promoter sequence: adopt nested primer to carry out inverse PCR amplification promoter fragment.Sequence with SEQ NO2 is reference, the design nested primer.The nido primer is: F1:3 ' CCCAAAATAACATTCCTTCCGGTTC 5 '; R1:3 ' TTTGACTGGACTTCGGTGCTTGA5 '; F2:3 ' CAAAATAACATTCCTTCCGGTTCAC 5 ', R2:3 ' GGACTTCGGTGCTTGAATTTACAAC 5 '.Reaction system is as shown in table 2.Response procedures: 94 ℃, 3min; 94 ℃, 30sec, 60 ℃, 30sec, 72 ℃, 2min, 35cycles; 72 ℃, 7min.The PCR product is reclaimed purifying, connection T carrier, transformed into escherichia coli, selected clone order-checking successively, and method is identical with the anchor PCR process.The final inverse PCR sequence fragment that gets, sequence is shown in SEQ NO3.
The amplification of table 2 nest-type PRC obtains the reaction system of promoter sequence
| Outer?Inverse?PCR?Component | Amount | Inner?Inverse?PCR?Component |
| 10×LA?PCR?Buffer(Mg2+Free) | 5.0μL | 10×LA?PCR?Buffer(Mg2+Free) |
| MgCl 2(25mM) | 5.0μL | MgCl 2(25mM) |
| dNTP?Mixture(each?2.5mM) | 8.0μL | dNTP?Mixture(each?2.5mM) |
| F1(10μM) | 2.0μL | F2(10μM) |
| R1(10μM) | 2.0μL | R2(10μM) |
| Cyclisation ligation product | 1μL | Outer?Inverse?PCR?product |
| TakaRa?LA?Taq(5U/μL) | 0.5μL | TakaRa?LA?Taq(5U/μL) |
| Nuclease-free?Water | 26.5μL | Nuclease-free?Water |
| Total?volume | 50μL | Total?volume |
(3)TAIL-PCR
With SEQ NO3 sequence is reference, and design TAIL-PCR primer comprises universal primer and Auele Specific Primer.Universal primer AD1:5 ' TGWGNAGWANCASAGA 3 '; AD2:5 ' CAWCGICNGAIASGAA 3 '; AD3:5 ' TCSTICGNACITWGGA 3 '; AD4:5 ' NTCGASTWTSGWGTT 3 '; AD5:5 ' NGTCGASWGANAWGAA 3 '; AD6:5 ' WGTGNAGWANCANAGA 3 '; AD7:5 ' AGWGNAGWANCAWAGG 3 '.And Auele Specific Primer TAIL-PCR1:5 ' AAAATTAAACAGCTTTCACTTGAGTAG 3 '; TAIL-PCR2:5 ' TCTAACAATTTAAATTATTAGGTTGAG 3 '; TAIL-PCR3:5 ' AAGATGCAATGTCTTTAAATTAT 3 '.
Reaction system is shown in table 3 and table 4, and response procedures comprises that the first round, second takes turns and third round.The first round: 94 ℃, 5min; 94 ℃, 10s, 64 ℃, 30s, 72 ℃, 3min, 10 circulations; 94 ℃, 10s; 25 ℃, 3min; 72 ℃, 2.5min; 94 ℃, 10s, 64 ℃, 3min, 72 ℃, 2.5min, 94 ℃, 10s, 64 ℃, 3min, 72 ℃, 2.5min, 94 ℃, 10s, 44 ℃, 1min, 72 ℃, 2.5min, 15 circulations.Second takes turns: 94 ℃, and 5min; 94 ℃, 10s, 60 ℃, 3min, 72 ℃, 2.5min, 94 ℃, 10s, 64 ℃, 3min, 72 ℃, 2.5min, 94 ℃, 10s, 44 ℃, 1min, 72 ℃, 2.5min, 12 circulations.Third round: 94 ℃, 5min; 94 ℃, 10s; 44 ℃, 1min; 72 ℃, 2.5min.The PCR product is reclaimed purifying, connection T carrier, transformed into escherichia coli, selected clone order-checking successively, and method is identical with the anchor PCR process.The final TAIL-PCR sequence fragment that gets, sequence is shown in SEQ NO4.
The reaction system of table 3-1TAIL-PCR
| 1 stTAIL-PCR?Component | Amount | 2 ndTAIL-PCR?Component |
| 10×LA?PCR?Buffer(Mg2+Free) | 5.0μL | 10×LA?PCR?Buffer(Mg2+Free) |
| MgCl 2(25mM) | 5.0μL | MgCl 2(25mM) |
| dNTP?Mixture(each?2.5mM) | 8.0μL | dNTP?Mixture(each?2.5mM) |
| AD*(10μM) | 2.0μL | AD*(10μM) |
| TAIL-PCR1(10μM) | 2.0μL | TAIL-PCR2(10μM) |
| South woods 895 poplar DNA | 1μL | 1 stTAIL-PCR?product |
| TakaRa?LA?Taq(5U/μL) | 0.5μL | TakaRa?LA?Taq(5U/μL) |
| Nuclease-free?Water | 26.5μL | Nuclease-free?Water |
| Total?volume | 50μL | Total?volume |
The reaction system of table 3-2TAIL-PCR
| 3 rd?TAIL-PCR?Component | Amount |
| 10×LA?PCR?Buffer(Mg2+Free) | 5.0μL |
| MgCl 2(25mM) | 5.0μL |
| dNTP?Mixture(each?2.5mM) | 8.0μL |
| AD*(10μM) | 2.0μL |
| TAIL-PCR3(10μM) | 2.0μL |
| 2 ndTAIL-PCR?product | 1μL |
| TakaRa?LA?Taq(5U/μL) | 0.5μL |
| Nuclease-free?Water | 26.5μL |
| Total?volume | 50μL |
Annotate: the * AD among the table 3-1,2 carries out TAIL-PCR respectively for using said AD1-AD7 primer.Adopt BioEdit software that three hyposynchronization are moved sequence (SEQ NO2, SEQ NO3, the SEQ NO4) splicing of comparing as a result, design specific primers: ProWOX11b forward primer: 5 ' TTAATGTTGATATAATTATATGGCT3 ' and ProWOX11b reverse primer: 5 ' TGGCTCACTTCTTTCAGTTC3 '.High-fidelity PCR reaction system is following: 10 * LA PCR Buffer (Mg
2+Free) 5.0 μ L; 2.5mM dNTP Mixture 8.0 μ L; 25mM Mg
2+5.0 μ L; LA Taq DNA Polymer ase (5U/ μ L) 0.5 μ L; ProWOX11b forward primer (10 μ M) 2 μ L; ProWOX11b reverse primer (10 μ M) 2 μ L; Template (895 poplar DNA, 1 μ g/ μ L) 1 μ L; Add aseptic ddH
2O supplies 50 μ L.Response procedures: sex change is 94 ℃ in advance, 3min; 94 ℃, 40s, 55 ℃, 30s, 72 ℃, 2min, 35 circulations; 72 ℃, 10min.To the amplified production order-checking, get the sequence of ProWOX11b promotor 1706bp, shown in SEQ NO1.
Embodiment 2ProWOX11b promoter expression vector makes up
Utilize the expression vector of gateway cloning technique construction ProWOX11b promotor.Use specific PCR primer (with embodiment 1 Auele Specific Primer), on the south woods 895 poplar DNA be template, carry out pcr amplification.High-fidelity PCR reaction system is following: 10 * LA PCR Buffer (Mg
2+Free) 5.0 μ L; 2.5mM dNTP Mixture 8.0 μ L; 25mM Mg
2+5.0 μ L; LA Taq DNA Polymerase (5U/ μ L) 0.5 μ L; ProWOX11b forward primer (10 μ M) 2 μ L; ProWOX11b reverse primer (10 μ M) 2 μ L; Template (895 poplar DNA, 1 μ g/ μ L) 1 μ L; Add aseptic ddH
2O supplies 50 μ L.Response procedures: sex change is 94 ℃ in advance, 3min; 94 ℃, 40s, 55 ℃, 30s, 72 ℃, 2min, 35 circulations; 72 ℃, 10min.And directed cloning is to entry vector, and entry vector is pCR
TM8/GW/TOPO
TMVector (Invitrogen).Reaction system is: Fresh PCR product (purified) 10-20ng; Salt solution 1 μ L; PCR
TM8/GW/TOPO
TMVector 1 μ L; Add aseptic ddH
2O supplies 6 μ L.Response procedures is: room temperature leaves standstill 30min.
Intestinal bacteria transform: prepared fresh or-70 ℃ of frozen intestinal bacteria TOP10 competent cells are being melted on ice; 6 μ L are connected product, join in the 100 μ L competent cells, and mixing gently, about ice bath 30min; Thermal shock 90sec in 42 ℃ of water-baths places 3-5min on ice rapidly; Add 800 μ L LB liquid nutrient mediums, 37 ℃, 100rmp shakes bacterium 1h; The centrifugal 3min of 4000rmp sops up upper strata 800 μ L substratum, mixing residue bacterium liquid; Bacterium liquid is applied on the LB screening and culturing plate that contains spc, is inverted overnight cultures for 37 ℃.
Positive colony screening and sequencing analysis: the picking positive colony carries out PCR and detects and sequence verification from the screening and culturing plate, and reaction system is as shown in table 3.
Table 3PCR detection reaction system
| 10×PCR?Buffer(Mg 2+free) | 2.0μL |
| MgCl 2(25mM) | 1.5μL |
| dNTP?Mixture(each?2.5mM) | 1.3μL |
| The ProWOX11b forward primer | 1.0μL |
| The ProWOX11b reverse primer | 1.0μL |
| Bacterium liquid | 0.1μL |
| TaKaRa?Taq | 1.0μL |
| Milli-Q?Water | 12.1μL |
| Total?volume | 20.0μL |
Response procedures is: 94 ℃, and 3min; 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 1min, 28 circulations; 72 ℃, 7min.It is correct that the clone of bacterium liquid PCR test positive send Ying Jun biotech company (Shanghai) order-checking to identify.
The entry vector and the plant expression vector pBGGUS (Invitrogen) that have ProWOX11b carry out the LR reaction.Reaction system is: linearized entry clone 100ng; Purified destination vector (100ng/ μ L) 1.5 μ L; LR Clonase II enzyme mix 2 μ L; Add TE (pH 8.0) and supply 10 μ L; Reaction conditions: 25 ℃ of 1h.Plant expression vector pBGGUS is as shown in Figure 1.The ProWOX11a promotor exchanges among the plant expression vector pBGGUS after the LR reaction; Detect and sequence verification through PCR, confirm that promoter vector makes up successfully called after pBGGUS-ProWOX11b; This carrier is at 3 ' end assembling gus reporter gene of ProWOX11b promotor; The GUSB of its coding can form undissolved 5,5 '-two bromo-4 by catalysis 5-bromo-4-chloro-3 indoles glucosiduronates (X-Gluc); The indigo material that 4 '-dichloro is dark makes that having the active position of GUS presents blueness.Assembling Bial expression casette as the selection markers of transgenic plant, can carry out the screening of transfer-gen plant with weedicide on carrier.Said carrier assembling LB and RB sequence impel the ProWOX11b promoter expression framework and the selection markers gene Bial that are assembled in therebetween to be integrated in the plant recipient cell karyomit(e).
Embodiment 3ProWOX11b promotor organizing specific expression is analyzed
Change constructed pBGGUS-ProWOX11b over to agrobacterium strains EHA105 (Invitrogen) through conventional frozen-thawed method, change the ProWOX11b promotor over to Arabidopis thaliana through agriculture bacillus mediated.The T2 that changes the ProWOX11b promoter vector is as shown in Figure 3 for Arabidopis thaliana plant GUS coloration result, contrasts through the wild-type plant GUS colored graph with Fig. 2, shows that gus gene is at the hypocotyl specifically expressing.Therefore, use promotor provided by the invention, can be in plant genetic engineering, induction phase answers goal gene at the hypocotyl specifically expressing, improvement good variety selection process.
SEQUENCE?LISTING
< 110>Nanjing Forestry University
< 120>a kind of willow hypocotyl specific expression promoter ProWOX11b and application thereof
<130> 100
<160> 23
<170> PatentIn?version?3.5
<210> 1
<211> 1706
<212> DNA
<213> Populus?x?euramericana?cv.?'Nanlin895'
<400> 1
ttaatgttga?tataattata?tggctattaa?ttaaccacaa?attaaggata?taattaagaa 60
tgatcattac?cctcgataat?tagcaatccc?attaatatat?atgtatgcat?atcaccagaa 120
tccctataaa?cgaaggaaaa?gcctacaggg?cggaggaaac?ctggtctgag?acagctgaag 180
cagtcggttc?cggttcctga?agctccgtta?catgtaaacg?cagtaataga?atatgaatat 240
aaaagcatga?catgttgcag?acattttgat?acacgtagaa?aagtgttcga?tgtatcagcc 300
aacttttgtc?accgctttcc?ttcctctctc?gtttaatata?aaaaagagag?gtcaggagag 360
gagaggagag?gagaggactc?agtgagtcag?ccatgtttcc?ttatacgtca?ttgttaataa 420
attattgcac?agtttcttga?ccgtctattt?ggatccttcc?tctcattttc?cgattaaata 480
attctccgga?ctcgacttcc?catgcatgcc?tgcacatgca?cttgccaagt?tgaaaaccct 540
agccaacttt?tcttgtctac?cattaacatt?accgttttga?ccactccttc?gagagatttt 600
cccatgcaac?catgtttatt?agttaatgta?tatgctctac?taatagaacg?ggaggatcaa 660
attatataat?tagtgatcat?gtgaatcgaa?agaatattca?aatacagatg?taatttaatt 720
aataaattta?attaaaagat?tgcaacttaa?atatattttt?tgaaaaacat?gagcacagaa 780
cgttataata?atttatacta?atgatttagt?tcaaggttat?ctcctcgtgt?agaatcagaa 840
ttacaaacaa?taccatttgt?gaggaaatac?ttatacaggt?tgattaatga?gcagcatttg 900
gggcgatttt?ccaaaattgt?catacaacat?ggaatatcaa?tattgattat?attttattaa 960
ataatgtgtt?ataattaata?aattaatgta?aacaattttt?gagatttatg?attataacca 1020
actatataat?aattaattta?aagatattgc?atcttgtgaa?agaaccttct?caacccaact 1080
atataataat?ttaaagacat?tgcatctttt?aaaaaaatca?tctcaaccta?ataatttaaa 1140
ttgttagatg?agatcttaat?atatgattaa?tattctttaa?tacatctact?caagtgaaag 1200
ctgtttaatt?tttatcaaat?aaataaaaat?tatgagattt?gaatttgtga?ccgcttagtt 1260
attaaaattc?taatatcata?ttaaataata?tctcaattta?ttaaataaaa?tatttcaaga 1320
tataatttaa?aatataattt?atattatttt?ataacaaatc?cactttttat?ctcattaaat 1380
cctacaatgg?agcactcttt?gactactgat?tatatgttcg?aataaactaa?gttgggcggt 1440
tgacttggaa?gagaaagatt?agcataacat?tttctaaacc?aggtaaagtt?gtaaattcaa 1500
gcaccgaagt?ccagtcaaac?caaggttgat?cacgtaaatt?cccaaaataa?cattccttcc 1560
ggttcaccgc?tttatatata?caacctcatc?tctctatgca?ttctgccttg?tgcatatgta 1620
ctttccttct?ctcccatatt?attgttaatt?tttttatttt?tttatttttt?atcgacaaac 1680
atttcttttc?ttcatttcaa?tacagt 1706
<210> 2
<211> 376
<212> DNA
<213> Populus?x?euramericana?cv.?'Nanlin895'
<400> 2
taagttgggc?ggttgacttg?gaagagaaag?attagcataa?cattttctaa?accaggtaaa 60
gttgtaaatt?caagcaccga?agtccagtca?aaccaaggtt?gatcacgtaa?attcccaaaa 120
taacattcct?tccggttcac?cgctttatat?atacaacctc?atctctctat?gcattctgcc 180
ttgtgcatat?gtactttcct?tctctcccat?attattgtta?atttttttat?ttttttattt 240
tttatcgaca?aacatttctt?ttcttcattt?caatacagta?tggaagataa?tcaaggccaa 300
gaccaagacc?ataacagtcc?aagcaaccat?ggaactgaaa?gaagtgagcc?agtgaggtca 360
aggtggactc?caaagc 376
<210> 3
<211> 653
<212> DNA
<213> Populus?x?euramericana?cv.?'Nanlin895'
<400> 3
aattgtcata?caacatggaa?tatcaatatt?gattatattt?tattaaataa?tgtgttataa 60
ttaataaatt?aatgtaaaca?atttttgaga?tttatgatta?taaccaacta?tataataatt 120
aatttaaaga?tattgcatct?tgtgaaagaa?ccttctcaac?ccaactatat?aataatttaa 180
agacattgca?tcttttaaaa?aaatcatctc?aacctaataa?tttaaattgt?tagatgagat 240
cttaatatat?gattaatatt?ctttaataca?tctactcaag?tgaaagctgt?ttaattttta 300
tcaaataaat?aaaaattatg?agatttgaat?ttgtgaccgc?ttagttatta?aaattctaat 360
atcatattaa?ataatatctc?aatttattaa?ataaaatatt?tcaagatata?atttaaaata 420
taatttatat?tattttataa?caaatccact?ttttatctca?ttaaatccta?caatggagca 480
ctctttgact?actgattata?tgttcgaata?aactaagttg?ggcggttgac?ttggaagaga 540
aagattagca?taacattttc?taaaccaggt?aaagttgtaa?attcaagcac?cgaagtccag 600
tcaaaccaag?gttgatcacg?taaattccca?aaataacatt?ccttccggtt?cac 653
<210> 4
<211> 1098
<212> DNA
<213> Populus?x?euramericana?cv.?'Nanlin895'
<400> 4
ttaatgttga?tataattata?tggctattaa?ttaaccacaa?attaaggata?taattaagaa 60
tgatcattac?cctcgataat?tagcaatccc?attaatatat?atgtatgcat?atcaccagaa 120
tccctataaa?cgaaggaaaa?gcctacaggg?cggaggaaac?ctggtctgag?acagctgaag 180
cagtcggttc?cggttcctga?agctccgtta?catgtaaacg?cagtaataga?atatgaatat 240
aaaagcatga?catgttgcag?acattttgat?acacgtagaa?aagtgttcga?tgtatcagcc 300
aacttttgtc?accgctttcc?ttcctctctc?gtttaatata?aaaaagagag?gtcaggagag 360
gagaggagag?gagaggactc?agtgagtcag?ccatgtttcc?ttatacgtca?ttgttaataa 420
attattgcac?agtttcttga?ccgtctattt?ggatccttcc?tctcattttc?cgattaaata 480
attctccgga?ctcgacttcc?catgcatgcc?tgcacatgca?cttgccaagt?tgaaaaccct 540
agccaacttt?tcttgtctac?cattaacatt?accgttttga?ccactccttc?gagagatttt 600
cccatgcaac?catgtttatt?agttaatgta?tatgctctac?taatagaacg?ggaggatcaa 660
attatataat?tagtgatcat?gtgaatcgaa?agaatattca?aatacagatg?taatttaatt 720
aataaattta?attaaaagat?tgcaacttaa?atatattttt?tgaaaaacat?gagcacagaa 780
cgttataata?atttatacta?atgatttagt?tcaaggttat?ctcctcgtgt?agaatcagaa 840
ttacaaacaa?taccatttgt?gaggaaatac?ttatacaggt?tgattaatga?gcagcatttg 900
gggcgatttt?ccaaaattgt?catacaacat?ggaatatcaa?tattgattat?attttattaa 960
ataatgtgtt?ataattaata?aattaatgta?aacaattttt?gagatttatg?attataacca 1020
actatataat?aattaattta?aagatattgc?atcttgtgaa?agaaccttct?caacccaact 1080
atataataat?ttaaagac 1098
<210> 5
<211> 24
<212> DNA
<213> Artificial?Sequence
<220>
< 223>anchor PCR list primer
<400> 5
acaccaccgc?tatcgtatgc?ccgt 24
<210> 6
<211> 32
<212> DNA
<213> Artificial?Sequence
<220>
< 223>anchor primer AAP
<400> 6
ggccacgcgt?cgactagtag?tacggggggg?gg 32
<210> 7
<211> 23
<212> DNA
<213> Artificial?Sequence
<220>
< 223>nido gene-specific primer
<400> 7
gctttggagt?ccaccttgac?ctc 23
<210> 8
<211> 25
<212> DNA
<213> Artificial?Sequence
<220>
<223> F1
<400> 8
cccaaaataa?cattccttcc?ggttc 25
<210> 9
<211> 23
<212> DNA
<213> Artificial?Sequence
<220>
<223> R1
<400> 9
tttgactgga?cttcggtgct?tga 23
<210> 10
<211> 25
<212> DNA
<213> Artificial?Sequence
<220>
<223> F2
<400> 10
caaaataaca?ttccttccgg?ttcac 25
<210> 11
<211> 25
<212> DNA
<213> Artificial?Sequence
<220>
<223> R2
<400> 11
ggacttcggt?gcttgaattt?acaac 25
<210> 12
<211> 16
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD1
<220>
<221> misc_feature
<222> (5)..(5)
<223> n?is?a,?c,?g,?or?t
<220>
<221> misc_feature
<222> (10)..(10)
<223> n?is?a,?c,?g,?or?t
<400> 12
tgwgnagwan?casaga 16
<210> 13
<211> 14
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD2
<220>
<221> misc_feature
<222> (7)..(7)
<223> n?is?a,?c,?g,?or?t
<400> 13
cawcgcngaa?sgaa 14
<210> 14
<211> 14
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD3
<220>
<221> misc_feature
<222> (7)..(7)
<223> n?is?a,?c,?g,?or?t
<400> 14
tcstcgnact?wgga 14
<210> 15
<211> 15
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD4
<220>
<221> misc_feature
<222> (1)..(1)
<223> n?is?a,?c,?g,?or?t
<400> 15
ntcgastwts?gwgtt 15
<210> 16
<211> 16
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD5
<220>
<221> misc_feature
<222> (1)..(1)
<223> n?is?a,?c,?g,?or?t
<220>
<221> misc_feature
<222> (11)..(11)
<223> n?is?a,?c,?g,?or?t
<400> 16
ngtcgaswga?nawgaa 16
<210> 17
<211> 16
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD6
<220>
<221> misc_feature
<222> (5)..(5)
<223> n?is?a,?c,?g,?or?t
<220>
<221> misc_feature
<222> (10)..(10)
<223> n?is?a,?c,?g,?or?t
<220>
<221> misc_feature
<222> (13)..(13)
<223> n?is?a,?c,?g,?or?t
<400> 17
wgtgnagwan?canaga 16
<210> 18
<211> 16
<212> DNA
<213> Artificial?Sequence
<220>
<223> AD7
<220>
<221> misc_feature
<222> (5)..(5)
<223> n?is?a,?c,?g,?or?t
<220>
<221> misc_feature
<222> (10)..(10)
<223> n?is?a,?c,?g,?or?t
<400> 18
agwgnagwan?cawagg 16
<210> 19
<211> 27
<212> DNA
<213> Artificial?Sequence
<220>
<223> TAIL-PCR1
<400> 19
aaaattaaac?agctttcact?tgagtag 27
<210> 20
<211> 27
<212> DNA
<213> Artificial?Sequence
<220>
<223> TAIL-PCR2
<400> 20
tctaacaatt?taaattatta?ggttgag 27
<210> 21
<211> 23
<212> DNA
<213> Artificial?Sequence
<220>
<223> TAIL-PCR3
<400> 21
aagatgcaat?gtctttaaat?tat 23
<210> 22
<211> 25
<212> DNA
<213> Artificial?Sequence
<220>
< 223>ProWOX11b forward primer
<400> 22
ttaatgttga?tataattata?tggct 25
<210> 23
<211> 20
<212> DNA
<213> Artificial?Sequence
<220>
< 223>ProWOX11b reverse primer
<400> 23
tggctcactt?ctttcagttc 20
Claims (7)
1. willow hypocotyl specific expression promoter ProWOX11b, its nucleotide sequence is shown in SEQ NO1.
2. the carrier that contains the described willow hypocotyl of claim 1 specific expression promoter ProWOX11b.
3. carrier according to claim 2 is characterized in that: said carrier is at 3 ' end assembling gus reporter gene of ProWOX11b promotor.
4. carrier according to claim 2 is characterized in that: said carrier assembling Bial expression casette, as the selection markers of transgenic plant, can carry out the screening of transfer-gen plant with weedicide.
5. carrier according to claim 2 is characterized in that: said carrier assembling LB and RB sequence, and impel the ProWOX11b promoter expression framework and the selection markers gene Bial that are assembled in therebetween to be integrated in the plant recipient cell karyomit(e).
6. the host cell that contains the described willow hypocotyl of claim 1 specific expression promoter ProWOX11b.
7. the described willow hypocotyl of claim 1 specific expression promoter ProWOX11b is in the application of regulatory gene in plant materials hypocotyl specifically expressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210017566 CN102559681B (en) | 2012-01-19 | 2012-01-19 | Poplar hypocotyl specific expression promoter ProWOX11b and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210017566 CN102559681B (en) | 2012-01-19 | 2012-01-19 | Poplar hypocotyl specific expression promoter ProWOX11b and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102559681A true CN102559681A (en) | 2012-07-11 |
| CN102559681B CN102559681B (en) | 2013-01-30 |
Family
ID=46406287
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210017566 Expired - Fee Related CN102559681B (en) | 2012-01-19 | 2012-01-19 | Poplar hypocotyl specific expression promoter ProWOX11b and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559681B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900281A (en) * | 2006-07-05 | 2007-01-24 | 江苏省农业科学院 | Cotton tissue specific and pathogenic bacterium inducing promoter and its use |
| CN101348791A (en) * | 2008-08-13 | 2009-01-21 | 北京林业大学 | Populus euphratica Oliv hydrotropic gene PeXET and promoter thereof |
| CN102154296A (en) * | 2011-02-22 | 2011-08-17 | 江苏省农业科学院 | Promoter efficiently expressing in cotton root and application thereof |
-
2012
- 2012-01-19 CN CN 201210017566 patent/CN102559681B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1900281A (en) * | 2006-07-05 | 2007-01-24 | 江苏省农业科学院 | Cotton tissue specific and pathogenic bacterium inducing promoter and its use |
| CN101348791A (en) * | 2008-08-13 | 2009-01-21 | 北京林业大学 | Populus euphratica Oliv hydrotropic gene PeXET and promoter thereof |
| CN102154296A (en) * | 2011-02-22 | 2011-08-17 | 江苏省农业科学院 | Promoter efficiently expressing in cotton root and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| CHEN-YI HUNG ET AL.: "A common position-dependent mechanism controls cell-type patterning and GLABRA2 regulation in the root and hypocotyl epidermis of Arabidopsis", 《PLANT PHYSIOLOGY》, vol. 117, no. 1, 31 December 1998 (1998-12-31), pages 73 - 84 * |
| MARK SPENSLEY ET AL.: "Evolutionarily conserved regulatory motifs in the promoter of the Arabidopsis clock gene LATE ELONGATED HYPOCOTYL", 《THE PLANT CELL》, vol. 21, no. 9, 30 September 2009 (2009-09-30), pages 2606 - 2623 * |
| THIERRY DESPREZ ET AL.: "Organization of cellulose synthase complexes involved in primary cell wall synthesis in Arabidopsis thaliana", 《PNAS》, vol. 104, no. 39, 25 September 2007 (2007-09-25), pages 15572 - 15577 * |
| 胥猛等: "杨树ARGONAUTE基因的克隆及序列分析", 《林业科学》, vol. 47, no. 3, 31 March 2011 (2011-03-31), pages 46 - 51 * |
| 胥猛等: "林木遗传改良中的分子生物学研究进展", 《林业科学》, vol. 45, no. 1, 31 January 2009 (2009-01-31), pages 136 - 143 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102559681B (en) | 2013-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| BRPI0609283A2 (en) | methods for identifying an intron with plant expression enhancing properties, to enrich the number of introns with plant expression enhancing properties, to isolate, supply or produce an intron with plant expression enhancing properties, to provide an expression cassette and to enhance expression of a nucleic acid sequence in a plant or a plant cell, computer algorithm, computer device or data storage device, recombinant DNA expression construct, expression vector, transgenic cell, or nonhuman organism transgenic material, cell culture, propagating parts or material, and, use of a transgenic organism or cell cultures, transgenic propagating material parts derived from these | |
| KR20200128129A (en) | Method for plant transformation | |
| TW201425580A (en) | Engineered transgene integration platform (ETIP) for gene targeting and trait stacking | |
| BRPI0719602B1 (en) | nucleic acid construction, and methods for increasing a plant's biomass, for increasing a plant's vigor, for increasing a plant's yield, for increasing a plant's tolerance to abiotic stress, for improving fiber quality and / or yield of a fiber producing plant and to produce cotton fibers | |
| BRPI0712398A2 (en) | artificial plant minichromosome, maize plant, isolated polynucleotide, recombinant construct, transgenic maize plant and method for producing a transgenic maize plant comprising an artificial plant minicromosome having functional centromere | |
| CN103865952B (en) | The auxin response factor gene PeARF17.1 of a kind of poplar adjusted and controlled growth promoter and application thereof | |
| CN109439671A (en) | It is a kind of to wheat low-temperature resistance, arid, ABA and relevant gene with high salt and its application | |
| Lapham et al. | Agrobacterium VirE2 protein modulates plant gene expression and mediates transformation from its location outside the nucleus | |
| CN102586273B (en) | Key gene PeWOX11a in development of adventitious roots of poplar and application of key gene PeWOX11a | |
| CN111087457B (en) | Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof | |
| CN109943575B (en) | Gene cloning, vector construction and application of baicalein anthocyanin transcription regulation factor SbMYB75 and SbDEL | |
| CN114231539B (en) | Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector thereof | |
| AU2014329590B2 (en) | Zea mays metallothionein-like regulatory elements and uses thereof | |
| CN114634941B (en) | Upland cotton GhPP2Cs gene and application thereof in plant dwarfing | |
| CN102559681B (en) | Poplar hypocotyl specific expression promoter ProWOX11b and application thereof | |
| Zhang et al. | Construction and analysis of a plant transformation binary vector pBDGG harboring a bi-directional promoter fusing dual visible reporter genes | |
| Reddy et al. | Genetic transformation of indica rice varieties involving Am-SOD gene for improved abiotic stress tolerance | |
| AU2014329590A1 (en) | Zea mays metallothionein-like regulatory elements and uses thereof | |
| CN102559682B (en) | Specific expression promoter ProWOX11a of poplar root primordium and application thereof | |
| CN107177596A (en) | A kind of paddy rice water logging induction type tissue specificity expression promoter Possub5 and its application | |
| CN107459566B (en) | L hWDR protein derived from lily and coding gene and application thereof | |
| CN105602954B (en) | A kind of plant abiotic stress-inducing expression promoter pTaPIP1A and its application | |
| CN117343156B (en) | Tartary buckwheat-derived bHLH transcription factor, coding gene and application thereof | |
| CN117535311B (en) | Upland cotton GhCRP21 gene and encoding protein and application thereof | |
| US11897923B2 (en) | Panicum virgatum SOSEKI protein SOK2, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120711 Assignee: Beijing Huamei Wanxiang Technology Co., Ltd. Assignor: Nanjing Forestry University Contract record no.: 2018320000235 Denomination of invention: Poplar hypocotyl specific expression promoter ProWOX11b and application thereof Granted publication date: 20130130 License type: Common License Record date: 20181024 Application publication date: 20120711 Assignee: Yangzhou little apple gardening Co., Ltd. Assignor: Nanjing Forestry University Contract record no.: 2018320000233 Denomination of invention: Poplar hypocotyl specific expression promoter ProWOX11b and application thereof Granted publication date: 20130130 License type: Common License Record date: 20181024 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120711 Assignee: Jiangsu Jing ancient environment construction Limited by Share Ltd Assignor: Nanjing Forestry University Contract record no.: 2018320000363 Denomination of invention: Poplar hypocotyl specific expression promoter ProWOX11b and application thereof Granted publication date: 20130130 License type: Common License Record date: 20181129 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130130 Termination date: 20200119 |