CN102559627B - Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase - Google Patents

Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase Download PDF

Info

Publication number
CN102559627B
CN102559627B CN201210031434.9A CN201210031434A CN102559627B CN 102559627 B CN102559627 B CN 102559627B CN 201210031434 A CN201210031434 A CN 201210031434A CN 102559627 B CN102559627 B CN 102559627B
Authority
CN
China
Prior art keywords
seq
sequence
acyltransferase
nucleotide sequence
host cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210031434.9A
Other languages
Chinese (zh)
Other versions
CN102559627A (en
Inventor
马克·科尔克曼
约恩·达尔高·米克尔森
里克·赫格·洛伦森
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DuPont Nutrition Biosciences ApS
Danisco US Inc
Original Assignee
Danisco US Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco US Inc filed Critical Danisco US Inc
Priority to CN201210031434.9A priority Critical patent/CN102559627B/en
Publication of CN102559627A publication Critical patent/CN102559627A/en
Application granted granted Critical
Publication of CN102559627B publication Critical patent/CN102559627B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The invention relates to a preparation method of fatty acyl transferase, comprising the following steps: providing Bacillus licheniformis cells; transforming Bacillus licheniformis cells by heterologous nucleotide sequence for coding fatty acyl transferase; and expressing fatty acyl transferase under the control of a promoter sequence. The invention also relates to the application of Bacillus licheniformis in expressing fatty acyl transferase, which involves Bacillus licheniformis host cell of heterologous fatty acyl transferase and a carrier with nucleotide sequence for coding fatty acyl transferase, wherein the nucleotide sequence can be operationally ligated with a promoter sequence homologous with Bacillus licheniformis.

Description

Prepare acyltransferase by transformed bacillus licheniformis cells
The application is that application number is 200780050429.X, and the applying date is on January 25th, 2007, the divisional application of the application for a patent for invention that denomination of invention is " preparing acyltransferase by transformed bacillus licheniformis cells ".
Quoting of related application
Quote following related application: the U. S. application the 60/764th that US 2002-0009518, US 2004-0091574, WO2004/064537, WO2004/064987, WO2005/066347, WO2005/066351, on February 2nd, 2006 submit to, No. 430 and WO2006/008508.Every section of document (" document that application is quoted ") of quoting in described each application and each application, in the document of quoting with application with reference to or every section of document quoting (being no matter to appear in the text of these applications or in checking process) and support the debate of advanced patentability in described examination, be all incorporated to by reference herein.Many parts of documents (" document of quoting ") are also quoted herein herein.Therefore, every section of document of being quoted herein and quote in citing document herein or every section of document of reference is all incorporated to herein by reference.
Technical field
The present invention relates to the preparation of acyltransferase (lipid acyltransferase).Particularly, the present invention relates to by express the method that acyltransferase is prepared acyltransferase in genus bacillus (Bacillus) host cell (preferably Bacillus licheniformis (Bacillus licheniformis) host cell).In addition; the invention still further relates to genus bacillus (being preferably Bacillus licheniformis) in the application of expressing on acyltransferase, also relate to the genus bacillus host cell (preferably Bacillus licheniformis host cell) of the gene that comprises the acyltransferase of encoding in its genome.
Background technology
Known acyltransferase has advantage in food applications.Have been found that acyltransferase has significant acyltransferase activity in food.This activity has surprising advantageous application in the preparation method of food.
For example, WO 2004/064537 discloses method and the relative advantage of preparing emulsifying agent by carry out original position with acyltransferase.
Therefore, need the business preparation method of acyltransferase.
But gene may be difficult to express in heterologous host conventionally, and in host cell, express acyltransferase and may have problem.
WO 2004/064537 discloses two kinds of Aeromonass of expression (Aeromonas) acyltransferase subtilis (Bacillus subtilis) and intestinal bacteria (Escherichia coli).But its expression in subtilis is very low, intestinal bacteria are not GRAS organism the host who is therefore not suitable as foodstuffs industry enzyme simultaneously.
US 6,255,076 discloses the method for preparing polypeptide in genus bacillus (Bacillus) host cell.But this kind of method need to be used the promotor of series connection, wherein each promoter sequence single copy nucleotide sequence of coding said polypeptide sequence that is operably connected.Therefore, in this area, need a kind of improving one's methods of acyltransferase of preparing.
Summary of the invention
All respects of the present invention are embodied in claims and following detailed description.
One aspect of the present invention relates to the preparation method of acyltransferase, said method comprising the steps of:
(i) provide host cell, be preferably genus bacillus host cell, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis cell;
(ii) the heterologous nucleotide sequence transformed host cell of use coding acyltransferase, described host cell is preferably genus bacillus host cell, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis cell; With
(iii) under the control of promoter sequence at cells acyltransferase.
On the other hand, the present invention relates to the genus bacillus host cell that comprises allos acyltransferase, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis host cell.
On the other hand, the present invention relates to the application of genus bacillus host cell in preparation allos acyltransferase, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis host cell.
Compatibly, compared with expression in subtilis, the expression in genus bacillus host can cause the increase of expression, and wherein said genus bacillus host is the one except subtilis, and preferred genus bacillus host is Bacillus licheniformis.
Again on the one hand; the present invention relates to comprise the expression vector of nucleotide sequence of acyltransferase of encoding; described nucleotide sequence one or more regulating and controlling sequences that are operably connected; make described regulating and controlling sequence can in applicable host or host cell, express the nucleotide sequence of coding acyltransferase; preferably at genus bacillus host (or cell); wherein said genus bacillus host (or cell) is for the one except subtilis, preferably at Bacillus licheniformis or Bacillus licheniformis cell.
Compatibly, described acyltransferase can be the acyltransferase of restructuring.
Embodiment
According to a first aspect of the invention, the invention provides the preparation method of acyltransferase, said method comprising the steps of:
(i) provide host cell, be preferably genus bacillus host cell, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis cell;
(ii) with the heterologous nucleotide sequence transformed host cell of coding acyltransferase, be preferably genus bacillus host cell, wherein said genus bacillus host cell is the one except subtilis, is preferably Bacillus licheniformis cell; With
(iii) under the control of promoter sequence at cells acyltransferase.
In addition, can make the be operably connected described heterologous nucleotide sequence of coding acyltransferase of the nucleotide sequence of coded signal peptide.
Compatibly, method of the present invention also comprises the additional step of separation/recovery acyltransferase.
On the other hand, the present invention relates to the Bacillus licheniformis host cell that comprises allos acyltransferase.
Compatibly, described acyltransferase can be the acyltransferase of restructuring.
Compatibly, in host cell of the present invention, carrier, method and/or purposes promoter sequence used can with host cell homology." with host cell homology " refers to and derives from host organisms; , described promoter sequence is naturally found in host organisms.Compatibly, described promoter sequence can select the group of the nucleotide sequence composition of the following promotor of freely encoding: α-amylase promotor, protease promoter, subtilisin promotor, glutamate specific protease promoter and levansucrase promotor.Compatibly, described promoter sequence can be the nucleotide sequence of the following promotor of coding: LAT is (as the α-amylase promotor from Bacillus licheniformis, also referred to as AmyL), AprL (as subtilisin Carlsberg promotor), EndoGluC (as the glutamate specific promotor from Bacillus licheniformis), AmyQ (Tathagata is from the α-amylase promotor of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) α-amylase promotor) and SacB (as the levansucrase promotor of subtilis).
In one embodiment of the invention, described promoter sequence is-35 to-10 sequences of α-amylase promotor, is preferably-35 to-10 sequences of bacillus licheniformis alpha-amylase promotor.Described " 35 to-10 sequence " described the position with respect to transcriptional start point." 35 " and " 10 " are frame (being multiple Nucleotide), and each frame comprises 6 Nucleotide, and these frames by 17 Nucleotide separately.These 17 Nucleotide are commonly called " introns ".Figure 55 is illustrated this, and wherein underscore place is-35 frames and-10 frames.For fear of obscuring, " 35 to-10 sequence " used herein refers to from the sequence of the initial termination to-10 frames of-35 frames, comprises that-35 frames, length are introns and-10 frames of 17 Nucleotide.
In some respects, can comprise GDSx motif and/or GANDY motif for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one.
Preferably, described acyltransferase is characterized by the enzyme that has acyltransferase activity and comprise aminoacid sequence motif GDSX, wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S.
Compatibly, be preferred for carrier of the present invention, host cell, in method and/or application, the nucleotide sequence of the coding acyltransferase of any one can obtain from the organism of following one or more genus: Aeromonas, streptomyces (Streptomyces), Saccharomycodes (Saccharomyces), lactococcus (Lactococcus), mycobacterium (Mycobacterium), streptococcus (Streptococcus), lactobacillus (Lactobacillus), desulfiting Pseudomonas (Desulfitobacterium), bacillus, Campylobacter (Campylobacter), vibrionaceae (Vibrionaceae), rod Pseudomonas (XyIeIIa), sulfolobus solfataricus belongs to (Sulfolobus), Aspergillus (Aspergillus), Schizosaccharomyces (Schizosaccharomyces), listeria (Listeria), neisseria (Neisseria), Autoinducer belongs to (Mesorhizobium), Lei Er Bordetella (Ralstonia), xanthomonas (Xanthomonas) and Candida (Candida).Preferably, described acyltransferase can obtain, and preferably from the organism of Aeromonas, obtains.
Aspect more of the present invention, on the N-80 position for the coded acyltransferase of the nucleotide sequence of the coding acyltransferase of carrier of the present invention, host cell, method and/or application any one in the aminoacid sequence of Aeromonas hydrophila (Aeromonas hydrophila) acyltransferase corresponding to shown in SEQ ID No.35, comprise asparagicacid residue.
In addition or alternatively; nucleotide sequence coded acyltransferase for the coding acyltransferase of carrier of the present invention, host cell, method and/or application any one comprises the aminoacid sequence shown in SEQ ID No.16, or has 75% or the aminoacid sequence of higher homology with it.Compatibly, the coded acyltransferase of nucleotide sequence of coding acyltransferase can comprise the aminoacid sequence shown in SEQ ID No.16.
Term used herein " allos " refers to the sequence of the genetic resources or the species that are derived from separation.Heterologous sequence is the sequence of non-host sequences, modification, from the sequence of different hosts cell strain or from the homologous sequence of the coloured differently body position of host cell.
" homology " sequence refers to the sequence of finding in same genetic resources or species, in its natural relative species that is present in host cell.
Term used herein " acyltransferase of restructuring " refers to the acyltransferase that prepared by the mode by genetic recombination.For example, the nucleotide sequence of coding acyltransferase is inserted to cloning vector, obtaining existing allos acyltransferase is the Bacillus licheniformis cell of feature.
Host cell
In one embodiment of the invention, be Bacillus licheniformis host cell for the host cell of the inventive method and/or application.
Have been found that with other organism as compared with subtilis, use Bacillus licheniformis host cell can make the expression of acyltransferase increase.
The acyltransferase that comes from aeromonas salmonicida (Aeromonas salmonicida) is inserted in multiple conventional expression vectors, described expression vector can have best expression respectively through design in subtilis, Hansenula polymorpha (Hansenula polymorpha), schizosaccharomyces pombe (Schizosaccharomyces pombe) and Tabin aspergillus (Aspergillus tubigensis).But, extremely low level in Hansenula polymorpha, schizosaccharomyces pombe and Tabin aspergillus, only detected.These expression levels, lower than 1 μ g/ml, therefore can not be selected and produce the cell (result do not show) of enough albumen with initial commercial production.On the contrary, Bacillus licheniformis can produce the attractive protein level of the feasibility of commercial production.
Particularly, while having been found that under the control of aprE promotor, high approximately 100 times of the expression of expression ratio in Bacillus licheniformis in subtilis, or while merging under the control of A4 promotor and with Mierocrystalline cellulose, than high approximately 100 times (result is not presented at herein) of the expression in muta lead mycillin (S.lividans).
In another embodiment, host cell can be any bacillus cell except subtilis.Preferably, described genus bacillus host cell can be the one in following species: Bacillus licheniformis, Alkaliphilic bacillus (B.alkalophilus), bacillus amyloliquefaciens, Bacillus circulans (B.circulans), Bacillus clausii (B.clausii), Bacillus coagulans (B.coagulans), bacillus firmus (B.firmus), B.lautus, slowly genus bacillus (B.lentus), bacillus megaterium (B.megaterium), bacillus pumilus (B.pumilus) or bacstearothermophilus (S.stearothermophilus).
The included any cell with following characteristics of term " host cell " the present invention relates to: the nucleotide sequence that comprises coding acyltransferase defined herein or expression vector as above, and for thering is the restructuring preparation of the acyltransferase of specific physique as herein defined.
Therefore, other embodiment of the present invention provides host cell, and it comprises (as through transforming or transfection) nucleotide sequence of the present invention, or comprises to express and have a nucleotide sequence of the polypeptide of specific physique as herein defined.
Compatibly, in some embodiments, host cell can be protease-deficient or without proteolytic enzyme type cell strain and/or α-amylase defective type or without α-amylase type cell strain.
Regulating and controlling sequence
In some applications, being operably connected for the acyltransferase sequence of host cell of the present invention, carrier, method and/or application any one can be by expressing the regulating and controlling sequence of nucleotide sequence as selected host cell (as Bacillus licheniformis cell).
For example, the carrier of the nucleotide sequence of the present invention that comprises this regulating and controlling sequence that is operably connected is contained in the present invention, and described carrier is expression vector.
Term " is operably connected " and refers to placement arranged side by side (juxtaposition), and the relation of wherein said assembly allows them to bring into play function in the mode of its hope.The regulating and controlling sequence of encoding sequence of " being operably connected " connects by this way, can under the condition compatible with control sequence, realize the expression of encoding sequence.
Term " regulating and controlling sequence " comprises promotor and enhanser and other expression regulation signal.
The general sense that term " promotor " used is this area, as RNA polymerase binding site.
The enhancing that coding has a nucleotide sequence of the enzyme of special properties is as herein defined expressed also can be by selecting control region (as promotor, secretion guiding and stop subarea) realize, and described termination subarea is not the control region of nucleotide sequence of described enzyme of encoding in essence.
Compatibly, the nucleotide sequence of the present invention promotor that at least can be operably connected.
Compatibly, the nucleotide sequence of the coding acyltransferase nucleotide sequence of coding terminator sequence that can be operably connected.For carrier of the present invention, host cell, in method and/or application, the example of the applicable terminator sequence of any one comprises: α-amylase terminator sequence (as, CGGGACTTACCGAAAGAAACCATCAATGATGGTTTCTTTTTTGTTCATAAA-SEQ ID No.64), Sumizyme MP terminator sequence (as, CAAGACTAAAGACCGTTCGCCCGTTTTTGCAATAAGCGGGCGAATCTTACATAAAA ATA-SEQ ID No.65), glutamate specific terminator sequence (as, ACGGCCGTTAGATGTGACAGCCCGTTCCAAAAGGAAGCGGGCTGTCTTCGTGTATT ATTGT-SEQ ID No.66), levanase terminator sequence (as, TCTTTTAAAGGAAAGGCTGGAATGCCCGGCATTCCAGCCACATGATCATCGTTT-S EQ ID No.67) and subtilisin E terminator sequence (as, GCTGACAAATAAAAAGAAGCAGGTATGGAGGAACCTGCTTCTTTTTACTATTATTG).Compatibly, the nucleotide sequence α-amylase terminator that can be operably connected of coding acyltransferase, as bacillus licheniformis alpha-amylase terminator.
Promotor
According to the present invention promoter sequence used and the sequence of coding acyltransferase can be allos or homology.
Described promoter sequence can be any promoter sequence that can instruct acyltransferase to express in selected host cell.
Compatibly, described promoter sequence can with genus bacillus (as Bacillus licheniformis) homology.Preferably, described promoter sequence and selected host cell are homologies.
Comprise for applicable promoter sequence of the present invention: the promotor of bacillus licheniformis alpha-amylase gene, the promotor of Bacillus licheniformis subtilisin gene, the promotor of subtilis subtilisin gene, the promotor of bacillus licheniformis alkali protease gene (subtilisin Carlsberg gene), the promotor of Bacillus licheniformis glutamate specific proteinase gene, the promotor of bacillus amyloliquefaciens alpha-amylase gene, the promotor of subtilis levansucrase and there is " having " promotor (-35 to-10 promotor) of " 35 " region sequence TTGACA He " 10 " region sequence TATAAT of alpha-amylase gene.
Be adapted at instructing in the inventive method other example of the promotor that nucleotide sequence transcribes to comprise: the slowly promotor of genus bacillus alkaline protease gene (aprH), the promotor of subtilis alpha-amylase gene (amyE), the promotor of bacstearothermophilus maltogenic amylase gene (amyM), the promotor of Bacillus licheniformis penicillinase gene (penP), the promotor of subtilis xylA and xylB gene, and/or the promotor of Bacillus thuringiensis subsp. tenebrionis (Bacillus thuringiensis subsp.tenebrionis) CryIIIA gene.
In preferred embodiments, described promoter sequence is α-amylase promotor (as bacillus licheniformis alpha-amylase promotor).Preferably, described promoter sequence comprises bacillus licheniformis alpha-amylase promotor-35 to-10 sequences (referring to Figure 53 and Figure 55).
Signal peptide
According to sequence used and/or carrier, host cell can be secreted or be included in cell by the expression acyltransferase that the nucleotide sequence of acyltransferase produces of encoding.
Signal sequence can be used for instructing encoding sequence secretion by specific cytolemma.Described signal sequence can be natural or external source concerning acyltransferase encoding sequence.For example, described signal coding sequence can be from bacillus species, the amylase preferably obtaining from Bacillus licheniformis or proteinase gene.
Can obtain applicable signal coding sequence by one or more following genes: maltose alpha-amylase gene, subtilisin gene, β-lactamase gene, neutral protease gene, prsA gene and/or acyl transferase gene.
Preferably; described signal peptide be the signal peptide of bacillus licheniformis alpha-amylase, the signal peptide of aeromonas acyltransferase (as; mkkwfvcllglialtvqa-SEQ ID No.21), the signal peptide of subtilis subtilisin (as; mrskklwisllfaltliftmafsnmsaqa-SEQ ID No.22) or the signal peptide of Bacillus licheniformis subtilisin (as, mmrkksfwfgmltafmlvftmefsdsasa-SEQ ID No.23).Compatibly, described signal peptide can be the signal peptide of bacillus licheniformis alpha-amylase.
But, can use any signal coding sequence that can instruct expressed acyltransferase to enter the Secretory Pathway of selected genus bacillus host cell (being preferably Bacillus licheniformis host cell).
In some embodiments of the present invention, the nucleotide sequence of coded signal peptide can be operably connected coding selected acyltransferase nucleotide sequence.
Selected acyltransferase can be as expressing fusion protein in host cell defined herein.
Expression vector
Term " expression vector " refers to can be in vivo or the construct of vivoexpression.
Preferably, described expression vector is introduced in organism as in Bacillus licheniformis host's genome.Stable being incorporated in genome preferably contained in term " introducing ".
The nucleotide sequence of acyltransferase of encoding as herein defined may reside in carrier; at the regulating and controlling sequence that is operably connected of nucleotide sequence described in this carrier; make described regulating and controlling sequence can express by applicable host organisms (as Bacillus licheniformis) as described in nucleotide sequence, described carrier is expression vector.
Carrier of the present invention can be transformed in above-mentioned applicable host cell, has the polypeptide of acyltransferase activity as herein defined to express.
Conventionally according to it, host cell being introduced into is selected to carrier (as plasmid, clay, virus or phage vector, genome inset).The present invention can be contained the expression vector with identical functions and known in the art or known other form.
Once be transformed in selected host cell, carrier can not rely on the genome of host cell and copy and bring into play function, or can be integrated into voluntarily genome.
Described carrier can comprise one or more selected markers, as the gene of antibiotics resistance is provided, as the gene of amicillin resistance, kalamycin resistance, chlorampenicol resistant or tetracyclin resistance.Or, can complete selection (described in WO91/17243) by cotransformation.
Carrier can use in vitro, for example, and for the preparation of RNA or for transfection or transformed host cell.
Therefore, in another embodiment, the invention provides for nucleotide sequence of the present invention or the coding of carrier of the present invention, host cell, other method and/or application any one and there is the preparation method of the nucleotide sequence of the polypeptide of special properties as herein defined, described method is by nucleotide sequence is introduced to replicable vector, described carrier is introduced to compatible host cell, and host cell is grown under the condition that carrier copies can carry out.
Described carrier can further comprise the nucleotide sequence that can make this carrier copy in described host cell.The example of described sequence is the replication orgin of plasmid pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.
Acyltransferase
For the nucleotide sequence of the coding acyltransferase of the inventive method, carrier and/or application any one can encode natural acyltransferase or acyltransferase variant.
For example, can be the one described in WO2004/064537, WO2004/064987, WO2005/066347 or WO2006/008508 for the nucleotide sequence of coding acyltransferase of the present invention.These documents are incorporated to herein by reference.
Term used herein " acyltransferase " preferably refers to that the enzyme with acyltransferase activity (is classified as E.C.2.3.1.x conventionally; as 2.3.1.43); wherein said enzyme can be transferred to one or more acceptors (acceptor) material from lipid by carboxyl groups; as following one or more: sterol (sterol), stanols (stanol), carbohydrate, albumen, protein protomer, sugar alcohol (as xitix and/or glycerine); preferably glycerine and/or sterol, as cholesterol.
Preferably; be used for the nucleotide sequence coded acyltransferase that carboxyl groups can be transferred to sugar alcohol (as xitix and/or glycerine, most preferably being glycerine) from phosphatide (as defined herein) of the coding acyltransferase of carrier of the present invention, host cell, method and/or application any one.
For some aspects, " acyl acceptor " of the present invention can be any compound that comprises oh group (OH), and the alcohol of for example multivalence, comprises glycerine, sterol, stanols, carbohydrate; Hydroxy acid, comprises tartaric acid, citric acid, tartrate, lactic acid and xitix; Albumen or its subunit, as amino acid, protein hydrolysate and peptide (albumen of partial hydrolysis); With its mixture and derivative.Preferably, " acyl acceptor " according to the present invention is not water.Preferably, " acyl acceptor " according to the present invention be sugar alcohol as polyvalent alcohol, most preferably be glycerine.For purposes of the present invention, xitix is also considered to sugar alcohol.
Preferably, described acyl acceptor is not monoglyceride.
Preferably, described acyl acceptor is not triglyceride.
On the one hand; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can and can be transferred to glycerine from lipid by carboxyl groups; in addition carboxyl groups can be transferred to one or more following materials from lipid: carbohydrate, albumen, protein protomer, sterol and/or stanols; preferably it can transfer to sugar alcohol (as xitix and/or glycerine, most preferably being sterol (as cholesterol)) and/or plant sterol/stanols.
Preferably, the lipid substrates of fatty acyl group effect is one or more in following lipid: phosphatide, and as Yelkin TTS, as phosphatidylcholine.
Described lipid substrates can be called as " fatty acyl group donor " in this article.Term Yelkin TTS used herein is contained phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositols, phosphatidylserine and phosphatidyl glycerol.
For some aspects, can not or substantially can not act on the acyltransferase of triglyceride level and/or 1-monoglyceride and/or 2-monoglyceride for the nucleotide sequence optimized encoding of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one.
For some aspects, for the nucleotide sequence coded acyltransferase that does not show triacylglycerol (triacylglycerol) lipase activity (E.C.3.1.1.3) or do not show significant triacylglycerol lipase activity (E.C.3.1.1.3) of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one.
The ability (E.C.3.1.1.3 activity) of hydrolyzing triglyceride can be by according to Food Chemical Codex (3rd Ed., 1981, pp 492-493) (being revised as Trisun Oil R 80, pH 5.5 to substitute sweet oil, pH 6.5) measure lipase activity measure.Lipase activity is measured with LUS (lipase unit of sunflower), wherein 1LUS is defined as under above test conditions per minute and can from Trisun Oil R 80, discharges the enzyme amount of 1 μ mol lipid acid.Or, also can use the LUT test as defined in WO9845453.This document is incorporated to herein by reference.
Can encode and substantially can not act on the acyltransferase of triglyceride level for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one; the LUS/mg of described acyltransferase can be less than 1000; as be less than 500, as being less than 300, be preferably and be less than 200, be more preferably less than 100, be more preferably less than 50, be more preferably less than 20, be more preferably less than 10, as be less than 5, be less than 2, be more preferably less than 1LUS/mg.Preferably, LUT/mg activity is less than 500, as is less than 300, is preferably and is less than 200, is more preferably less than 100, is more preferably less than 50, is more preferably less than 20, is more preferably less than 10, as is less than 5, is less than 2, is more preferably less than 1LUT/mg.
Can encode and substantially can not act on the acyltransferase of monoglyceride for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one, described acyltransferase can use monoleate (M77651-oleoyl-rac-glycerine 99%) to measure to substitute Trisun Oil R 80 in LUS test.1MGHU is defined as under described test conditions per minute and can from monoglyceride, discharges the enzyme amount of 1 μ mol lipid acid.
Can encode and substantially can not act on the acyltransferase of triglyceride level for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one; the MGHU/mg that described acyltransferase has can be less than 5000, as be less than 1000, as being less than 500, as being less than 300, be preferably and be less than 200, be more preferably less than 100, be more preferably less than 50, be more preferably less than 20, be more preferably less than 10 (as be less than 5, be less than 2), be more preferably less than 1MGHU/mg.
Compatibly, for the nucleotide sequence coded acyltransferase that can show one or more following phospholipase activity of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one: Phospholipase A2 activity (E.C.3.1.1.4) and/or phospholipase A1 activity (E.C.3.1.1.32).Described acyltransferase also can have phospholipase B activity (E.C 3.1.1.5).
Compatibly, for some aspects, described acyltransferase can be transferred to sugar alcohol (being preferably glycerine and/or xitix) from phosphatide by carboxyl groups.
For some aspects, the nucleotide sequence coded of coding acyltransferase that is preferably used for any one in host cell of the present invention, carrier, method and/or application can be transferred to sterol and/or stanols at least to form the acyltransferase of sterol ester and/or stanol ester from phosphatide by carboxyl groups.
Described acyltransferase can be transferred to polyvalent alcohol (as glycerine) and/or sterol (as cholesterol or plant sterol) and/or stanols from lipid by carboxyl groups.Therefore, in one embodiment, " acyl acceptor " of the present invention can be glycerine and/or cholesterol or plant sterol and/or stanols.
Preferably, described acyltransferase can use following standard to characterize:
Described enzyme has the acyltransferase activity that can be defined as transesterify activity, by this activity, the acyl moiety of the originally ester bond of fatty acyl group donor is transferred to acyl acceptor (being preferably glycerine or cholesterol) to form new ester; With
Described enzyme comprises aminoacid sequence motif GDSX, and wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S.
Preferably, the X of GDSX motif is L or Y.More preferably, the X of GDSX motif is L.Therefore, preferred enzyme of the present invention comprises aminoacid sequence motif GDSL.
GDSX motif is by four conservative Amino acid profiles.Preferably, the catalytic Serine that the Serine in this motif is described acyltransferase.Compatibly; the position of the Serine of GDSX motif is corresponding to Brumlik and Buckley (Journal of Bacteriology Apr.1996; Vol.178, No.7, p 2060-2064) in the Ser-16 of Aeromonas hydrophila acyltransferase of instruction.
Whether there is GDSX motif of the present invention in order to measure albumen, the method that preferably uses instruction in WO2004/064537 or WO2004/064987 (being all incorporated to by reference herein), compares the hidden Markov model order type of sequence and pfam database (hidden markov model profile) (HMM order type).
Preferably, described acyltransferase can use Pfam00657 consensus sequence compare (complete explanation can referring to WO2004/064537 or WO2004/064987).
Preferably, mate and represent to exist GDSL of the present invention or GDSX structural domain with the positive of the hidden Markov model order type (HMM order type) of pfam00657 structural domain family.
Preferably; in the time comparing with Pfam00657 consensus sequence, can there is at least one, be preferably more than one, be more preferably greater than the following part (block) of two for the acyltransferase of the inventive method and/or application: GDSx, GANDY, HPT.Compatibly, described acyltransferase can have GDSx part and GANDY part.Or described enzyme can have GDSx part and HPT part.Preferably, described enzyme at least comprises GDSx part.More details refer to WO2004/064537 or WO2004/064987.
Preferably, the residue of GANDY motif is selected from GANDY, GGNDA, GGNDL, most preferably is GANDY.
Preferably, in the time comparing with Pfam00657 consensus sequence, compared with Aeromonas hydrophila polypeptide reference sequences (SEQ ID No.1), the enzyme that is used for the inventive method and/or application has at least one of following amino-acid residue, be preferably greater than two, be preferably greater than three, be preferably greater than four, be preferably greater than five, be preferably greater than six, be preferably greater than seven, be preferably greater than eight, be preferably greater than nine, be preferably greater than ten, be preferably greater than 11, be preferably greater than 12, be preferably greater than 13, be preferably greater than 14: 28hid, 29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid, 130hid, 131Gly, 132Hid, 133Asn, 134Asp, 135hid, 309His.
Pfam00657GDSX structural domain is to distinguish to have the albumen of this structural domain and the uniqueness mark of other enzyme.
In table 3, show pfam00657 consensus sequence (SEQ ID No.2).It stems from the qualification of (also can be called in this article pfam00657.6) to the 6th edition database pfam family 00657.
Described consensus sequence can be upgraded (as referring to WO2004/064537 or WO2004/064987) by using compared with new edition pfam database.
In one embodiment, for the nucleotide sequence coded acyltransferase that can use following standard to characterize of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one:
(i) described enzyme has the acyltransferase activity that can be called as transesterify activity, by this activity, the acyl moiety of the originally ester bond of fatty acyl group donor is transferred to acyl acceptor (being preferably glycerine or cholesterol) to form new ester, be preferably respectively monoglyceride or cholesteryl ester;
(ii) described enzyme comprises aminoacid sequence motif GDSX, and wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S;
(iii) described enzyme comprises His-309 or in the Aeromonas hydrophila acyltransferase shown in (SEQ ID No.1 or SEQ ID No.3), on the correspondence position of His-309, comprise histidine residues in Fig. 2 and 4.
Preferably, the amino-acid residue of described GDSX motif is L.
In SEQ ID No.3 or SEQ ID No.1,18 initial amino-acid residues form signal sequence.His-309 in full length sequence (comprising the albumen of signal sequence) is equal to the His-291 in the maturing part (not containing the sequence of signal sequence) of albumen.
In one embodiment; the coded acyltransferase of nucleotide sequence for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one comprises following catalysis triplet: Ser-34, Asp-306 and His-309, or on the correspondence position of Ser-34, Asp-306 and His-309, comprise respectively serine residue, asparagicacid residue and histidine residues in the Aeromonas hydrophila acyltransferase shown in Fig. 4 (SEQ ID No.3) or Fig. 2 (SEQ ID No.1).As mentioned above, in the sequence shown in SEQ ID No.3 or SEQ ID No.1,18 initial amino-acid residues form signal sequence.Ser-34, Asp-306 in full length sequence (comprising the albumen of signal sequence) and His-309 are equal to Ser-16, Asp-288 and the His-291 in the maturing part (not containing the sequence of signal sequence) of albumen.In the pfam00657 consensus sequence shown in Fig. 3 (SEQ ID No.2), avtive spot residue is Ser-7, Asp-345 and His-348.
In one embodiment, for the nucleotide sequence coded acyltransferase that can use following standard to characterize of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one:
Described enzyme has the acyltransferase activity that can be called as transesterify activity, by this activity, the acyl moiety of the originally ester bond of the first fatty acyl group donor is transferred to acyl acceptor to form new ester; With
Described enzyme at least comprises Gly-32, Asp-33, Ser-34, Asp-134 and His-309, or on the correspondence position of Gly-32, Asp-33, Ser-34, Asp-306 and His-309, comprises respectively glycine residue, asparagicacid residue, serine residue, asparagicacid residue and histidine residues in the Aeromonas hydrophila acyltransferase shown in SEQ ID No.3 or SEQ ID No.1.
Compatibly, can be the one in following nucleotide sequence for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one:
(a) nucleotide sequence shown in SEQ ID No.36 (referring to Figure 29),
(b) nucleotide sequence shown in SEQ ID No.38 (referring to Figure 31),
(c) nucleotide sequence shown in SEQ ID No.39 (referring to Figure 32),
(d) nucleotide sequence shown in SEQ ID No.42 (referring to Figure 35),
(e) nucleotide sequence shown in SEQ ID No.44 (referring to Figure 37),
(f) nucleotide sequence shown in SEQ ID No.46 (referring to Figure 39),
(g) nucleotide sequence shown in SEQ ID No.48 (referring to Figure 41),
(h) nucleotide sequence shown in SEQ ID No.49 (referring to Figure 57),
(i) nucleotide sequence shown in SEQ ID No.50 (referring to Figure 58),
(j) nucleotide sequence shown in SEQ ID No.51 (referring to Figure 59),
(k) nucleotide sequence shown in SEQ ID No.52 (referring to Figure 60),
(l) nucleotide sequence shown in SEQ ID No.53 (referring to Figure 61),
(m) nucleotide sequence shown in SEQ ID No.54 (referring to Figure 62),
(n) nucleotide sequence shown in SEQ ID No.55 (referring to Figure 63),
(o) nucleotide sequence shown in SEQ ID No.56 (referring to Figure 64),
(p) nucleotide sequence shown in SEQ ID No.57 (referring to Figure 65),
(q) nucleotide sequence shown in SEQ ID No.58 (referring to Figure 66),
(r) nucleotide sequence shown in SEQ ID No.59 (referring to Figure 67),
(s) nucleotide sequence shown in SEQ ID No.60 (referring to Figure 68),
(t) nucleotide sequence shown in SEQ ID No.61 (referring to Figure 69),
(u) nucleotide sequence shown in SEQ ID No.62 (referring to Figure 70),
(v) nucleotide sequence shown in SEQ ID No.63 (referring to Figure 71) or
(w) with SEQ ID No.36, SEQ ID No.38, SEQ ID No.39, SEQ ID No.42, SEQ ID No.44, SEQ ID No.46, SEQ ID No.48, SEQ ID No.49, SEQ ID No.50, SEQ ID No.51, SEQ ID No.52, SEQ ID No.53, SEQ ID No.54, SEQ ID No.55, SEQ ID No.56, SEQ ID No.57, SEQ ID No.58, SEQ ID No.59, SEQ ID No.60, SEQ ID No.61, arbitrary sequence shown in SEQ ID No.62 or SEQ ID No.63 has 70% or higher, be preferably 75% or the nucleotide sequence of higher identity.
Compatibly, described nucleotide sequence can with SEQ ID No.36, SEQ ID No.38, SEQ ID No.39, SEQ ID No.42, SEQ ID No.44, SEQ ID No.46, SEQ ID No.48, SEQ ID No.49, SEQ ID No.50, SEQ ID No.51, SEQ ID No.52, SEQ ID No.53, SEQ ID No.54, SEQ ID No.55, SEQ ID No.56, SEQ ID No.57, SEQ ID No.58, SEQ ID No.59, SEQ ID No.60, SEQ ID No.61, arbitrary sequence shown in SEQ ID No.62 or SEQ ID No.63 has 80% or higher, be preferably 85% or higher, more preferably 90% or higher, and more preferably 95% or higher identity.
In one embodiment; classify as with the arbitrary sequence shown in SEQ ID No.49, SEQ ID No.50, SEQ ID No.51, SEQ ID No.62 and SEQ ID No.63 and have 70% or higher for the nucleotides sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one, be preferably 75% or the nucleotide sequence of higher identity.Compatibly, described nucleotide sequence can have 80% or higher with the arbitrary sequence shown in SEQ ID No.49, SEQ ID No.50, SEQ ID No.51, SEQ ID No.62 and SEQ ID No.63, be preferably 85% or higher, more preferably 90% or higher, and more preferably 95% or higher identity.
In one embodiment; classify as with the sequence shown in SEQ ID No.49 and have 70% or higher for the nucleotides sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one; 75% or higher; 80% or higher; be preferably 85% or higher; more preferably 90% or higher, and more preferably 95% or the nucleotide sequence of higher identity.
Compatibly, for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can encoded packets containing the acyltransferase of one or more following aminoacid sequences:
(i) aminoacid sequence shown in SEQ ID No.3,
(ii) aminoacid sequence shown in SEQ ID No.4,
(iii) aminoacid sequence shown in SEQ ID No.5,
(iv) aminoacid sequence shown in SEQ ID No.6,
(v) aminoacid sequence shown in SEQ ID No.7,
(vi) aminoacid sequence shown in SEQ ID No.8,
(vii) aminoacid sequence shown in SEQ ID No.9,
(viii) aminoacid sequence shown in SEQ ID No.10,
(ix) aminoacid sequence shown in SEQ ID No.11,
(x) aminoacid sequence shown in SEQ ID No.12,
(xi) aminoacid sequence shown in SEQ ID No.13,
(xii) aminoacid sequence shown in SEQ ID No.14,
(xiii) aminoacid sequence shown in SEQ ID No.1,
(xiv) aminoacid sequence shown in SEQ ID No.15 or
Have 75%, 80%, 85%, 90%, 95%, 98% or the aminoacid sequence of higher identity with the arbitrary sequence shown in SEQ ID No.1, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14 or SEQ ID No.15.
Compatibly, for host cell of the present invention, carrier, in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one can comprise the aminoacid sequence as shown in SEQ ID No.3 or SEQ ID No.4 or SEQ ID No.1 or SEQ ID No.15, or comprise with the aminoacid sequence shown in the aminoacid sequence shown in the aminoacid sequence shown in SEQ ID No.3 or SEQ ID No.4 or the aminoacid sequence shown in SEQ ID No.1 or SEQ ID No.15 and have 75% or higher, be preferably 80% or higher, be preferably 85% or higher, be preferably 90% or higher, be preferably 95% or the aminoacid sequence of higher identity.
Compatibly, for host cell of the present invention, carrier, in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one can comprise the No.3 with SEQ ID, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, arbitrary sequence shown in SEQ ID No.1 or SEQ ID No.15 has 80% or higher, be preferably 85% or higher, more preferably 90% or higher, and more preferably 95% or the aminoacid sequence of higher identity.
Compatibly, for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can encoded packets containing the acyltransferase of one or more following aminoacid sequences:
(a) aminoacid sequence shown in the amino-acid residue 1-100 of SEQ ID No.3 or SEQ ID No.1;
(b) aminoacid sequence shown in the amino-acid residue 101-200 of SEQ ID No.3 or SEQ ID No.1;
(c) aminoacid sequence shown in the amino-acid residue 201-300 of SEQ ID No.3 or SEQ ID No.1; Or
(d) with above (a) to (c) in defined aminoacid sequence arbitrary sequence have 75% or higher, be preferably 85% or higher, more preferably 90% or higher and more preferably 95% or the aminoacid sequence of higher identity.
Compatibly, can comprise one or more following aminoacid sequences for the acyltransferase of the inventive method and/or application:
(a) aminoacid sequence shown in the amino-acid residue 28-39 of SEQ ID No.3 or SEQ ID No.1;
(b) aminoacid sequence shown in the amino-acid residue 77-88 of SEQ ID No.3 or SEQ ID No.1;
(c) aminoacid sequence shown in the amino-acid residue 126-136 of SEQ ID No.3 or SEQ ID No.1;
(d) aminoacid sequence shown in the amino-acid residue 163-175 of SEQ ID No.3 or SEQ ID No.1;
(e) aminoacid sequence shown in the amino-acid residue 304-311 of SEQ ID No.3 or SEQ ID No.1; Or
(f) with above (a) to (e) in defined aminoacid sequence arbitrary sequence have 75% or higher, be preferably 85% or higher, more preferably 90% or higher and more preferably 95% or the aminoacid sequence of higher identity.
On the one hand, can be as the acyltransferase that comes from Candida parapsilosis (Candidaparapsilosis) of instruction in EP 1275711 for the coded acyltransferase of nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one.Therefore, on the one hand, can be for comprising the acyltransferase of a kind of aminoacid sequence that SEQ ID No.17 or SEQ ID No.18 instruct for the acyltransferase of the inventive method and application.
Preferably; the coded acyltransferase of nucleotide sequence for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can be the acyltransferase that comprises the aminoacid sequence shown in SEQ ID No.16, or comprise with SEQ ID No.16 have 75% or higher, be preferably 85% or higher, more preferably 90% or higher, more preferably 95% or higher, more preferably 98% or higher or more preferably 99% or the acyltransferase of the aminoacid sequence of higher identity.Described enzyme can be considered to the variant of enzyme.
On the one hand, can be Yelkin TTS for the coded acyltransferase of nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one: cholesterol acyltransferase (LCAT) or its variant (as the variant being produced by molecular evolution).
Applicable LCAT is known in the art, and can obtain from one or more following organisms, as: mammals, rat, mouse, chicken, drosophila melanogaster (Drosophila melanogaster), plant (comprising Arabidopis thaliana (Arabidopsis) and paddy rice (Oryza sativa)), nematode, fungi and yeast.
In one embodiment, for host cell of the present invention, carrier, in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one can be obtainable, the acyltransferase preferably obtaining from the e. coli strains TOP 10 with pPet12aAhydro and pPet12aASalmo, described e. coli strains TOP 10 is by Danisco A/S of Langebrogade 1, DK-1001Copenhagen K, Denmark is deposited in National Collection of Industrial according to international recognition for the microbial preservation budapest treaty of patented procedure, Marine and Food Bacteria (NCIMB) 23 St.Machar Street, Aberdeen Scotland, GB, preservation day is on December 22nd, 2003, preserving number is respectively NCIMB 41204 and NCIMB41205.
For the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or the application any one phosphatide glyceroyl transferring enzyme of can encoding.Phosphatide glyceroyl transferring enzyme comprises that separation, from aeromonas, is preferably Aeromonas hydrophila or aeromonas salmonicida, most preferably is those phosphatide glyceroyl transferring enzymes of aeromonas salmonicida or its variant.Can be by SEQ ID No.1,3,4,15 and 16 coded for most preferred acyltransferase of the present invention.The signal peptide that it will be understood by those skilled in the art that preferred acyltransferase is cut in the expression process of transferring enzyme.SEQ ID No.1,3,4,15 and 16 signal peptide are amino acid/11-18.Therefore, most preferred region is the amino acid/11 9-335 in SEQ ID No.1 and SEQ ID No.3 (Aeromonas hydrophila), and amino acid/11 9-336 in SEQ ID No.4, SEQ ID No.15 and SEQ ID No.16 (aeromonas salmonicida).In the time of the identity for measuring aminoacid sequence or homology, preferably use mature sequence to carry out comparison as herein described.
Therefore, the most preferred region that is used for measuring homology (identity) is the amino acid/11 9-335 of SEQ ID No.1 and 3 (Aeromonas hydrophila), and amino acid/11 9-336 in SEQ ID No.4,15 and 16 (aeromonas salmonicidas).SEQ ID 34 and 35 is respectively the maturation protein sequence from the acyltransferase of Aeromonas hydrophila and aeromonas salmonicida.
The coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one also can separate from happiness hot tearing spore bacterium (Thermobifida); be preferably brown happiness hot tearing spore bacterium (T.fusca), most preferably it is encoded by SEQ ID No.28.
The coded nucleotide sequence of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one also can separate from streptomyces; be preferably Avid kyowamycin (S.avermitis), most preferably it is encoded by SEQ ID No.32.Comprise by SEQ ID No.5,6,9,10,11,12,13,14,31 and 33 coded those enzymes for other possible enzyme from streptomycete of the present invention.
Also can separate from corynebacterium (Corynebacterium) for enzyme of the present invention, be preferably C.efficiens, most preferably it is encoded by SEQ ID No.29.
Compatibly, for host cell of the present invention, carrier, in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one can comprise SEQ ID No.37, 38, 40, 41, 43, arbitrary aminoacid sequence shown in 45 or 47, or have at least 70% with it, 75%, 80%, 85%, 90%, 95%, 96%, the aminoacid sequence of 97% or 98% identity, or by SEQ ID No.36, 39, 42, 44, arbitrary nucleotide sequence shown in 46 or 48 is coded, or by having at least 70% with it, 75%, 80%, 85%, 90%, 95%, 96%, the nucleotide sequence of 97% or 98% identity is coded.
In one embodiment, for the freely group of following composition of nucleotide sequence choosing of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one:
A) nucleic acid that comprises the nucleotide sequence shown in SEQ ID No.36;
B) nucleic acid relevant to the nucleotide sequence of SEQ ID No.36 due to genetic code degeneration; With
C) comprise the nucleic acid with the nucleotide sequence shown in SEQ ID No.36 with the nucleotide sequence of at least 70% identity.
In one embodiment, comprise the aminoacid sequence shown in SEQ ID No.37 for the coded acyltransferase of nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one or there is the aminoacid sequence of at least 60% identity with it.
In another embodiment, for host cell of the present invention, carrier, in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one can comprise SEQ ID No.37, 38, 40, 41, 43, arbitrary aminoacid sequence shown in 45 or 47, or have at least 70% with it, 75%, 80%, 85%, 90%, 95%, 96%, the aminoacid sequence of 97% or 98% identity, or by SEQ ID No.39, 42, 44, arbitrary nucleotide sequence shown in 46 or 48 is coded, or by having at least 70% with it, 75%, 80%, 85%, 90%, 95%, 96%, the nucleotide sequence of 97% or 98% identity is coded.
In another embodiment; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise the arbitrary aminoacid sequence shown in SEQ ID No.38,40,41,45 or 47; or there is the aminoacid sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity with it, for the present invention.
In another embodiment; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise the arbitrary aminoacid sequence shown in SEQ ID No.38,40 or 47; or there is the aminoacid sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity with it, for the present invention.
More preferably; in one embodiment; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise the aminoacid sequence shown in SEQ ID No.47, or has the aminoacid sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity with it.
In another embodiment; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise the aminoacid sequence shown in SEQ ID No.43 or 44, or has the aminoacid sequence of at least 80%, 85%, 90%, 95%, 96%, 97% or 98% identity with it.
In another embodiment; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise the aminoacid sequence shown in SEQ ID No.41, or has the aminoacid sequence of at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 98% identity with it.
In one embodiment, for the freely group of following composition of nucleotide sequence choosing of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one:
A) nucleic acid that comprises the nucleotide sequence shown in SEQ ID No.36;
B) nucleic acid relevant to the nucleotide sequence of SEQ ID No.36 due to genetic code degeneration; With
C) comprise the nucleic acid with the nucleotide sequence shown in SEQ ID No.36 with the nucleotide sequence of at least 70% identity.
In one embodiment, can be obtainable according to acyltransferase of the present invention, the acyltransferase preferably obtaining from streptomyces strain L130 or L131, described streptomyces strain L130 or L131 are by Danisco A/S of Langebrogade 1, DK-1001Copenhagen K, Denmark is deposited in National Collection of Industrial according to international recognition for the microbial preservation budapest treaty of patented procedure, Marine and Food Bacteria (NCIMB) 23St.Machar Street, Aberdeen Scotland, GB, preservation day is on June 25th, 2004, preserving number is respectively NCIMB 41226 and NCIMB 41227.
For the applicable nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or the application any one acyltransferase (SEQ ID No.16) of can encoding, the aminoacid sequence (SEQ ID No.17) of the acyltransferase of maybe can encoding.
Be used for the applicable nucleotide sequence codified aminoacid sequence as described below of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one, this aminoacid sequence can use Align X (using the paired alignment algorithm of Clustal W of the VectorNTI of default setting) by identifying with the comparison of L131 (SEQ ID No.37) sequence.
L131 and the comparison of the homologue from streptomyces griseus (S.avermitilis) and brown happiness hot tearing spore bacterium can show the conservative property that GDSx motif (being GDSY in L131 and streptomyces griseus and brown happiness hot tearing spore bacterium), GANDY frame (it is GGNDA or GGNDL) and HPT partly (are considered to conservative catalytic Histidine).These three outstanding being marked in Figure 42 of conservative part.
During with pfam Pfam00657 consensus sequence (described in WO04/064987) and/or L131 sequence disclosed herein (SEQ ID No.37) comparison, can identify three conserved regions, GDSx part, GANDY part and HTP part (describing in detail referring to WO04/064987).
During with pfam Pfam00657 consensus sequence (described in WO04/064987) and/or L131 sequence disclosed herein (SEQ ID No.37) comparison,
I) can encode and there is GDSx motif for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one, more preferably be selected from the acyltransferase of the GDSx motif of GDSL or GDSY motif; And/or
Ii) can encode and there is GANDY part for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one, more preferably comprise the GANDY part of amino GGNDx, more preferably the acyltransferase of GGNDA or GGNDL; And/or
Iii) can encode and preferably there is the acyltransferase of HTP part for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one; Preferably,
Iv) can encode and preferably there is GDSx or GDSY motif for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one; with the GANDY part that comprises amino GGNDx (being preferably GGNDA or GGNDL), and the acyltransferase of HTP part (conservative Histidine).
Acyltransferase variant
In preferred embodiments, be acyltransferase variant for the coded acyltransferase of nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one.
Can use the variant that the activity of phosphatide is increased, as the variant that the hydrolytic activity to phosphatide increases and/or transferase active increases, be preferably the variant that the transferase active of phosphatide is increased.
Preferably, prepare described acyltransferase variant by acyltransferase as defined above one or more amino acid modified.
Compatibly, when for host cell of the present invention, carrier, when in method and/or application, the coded acyltransferase of nucleotide sequence of the coding acyltransferase of any one is acyltransferase variant, in this case, the described enzyme that is characterized as of described enzyme comprises aminoacid sequence motif GDSX, wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S, and wherein said enzyme variants with respect to parental array at the 2nd group, the 4th group, one or more amino-acid residues place that the 6th group or the 7th group limit comprises one or more amino acid modified (as WO2005/066347 and below define).
For example, acyltransferase variant can be characterized as being described enzyme and comprise aminoacid sequence motif GDSX, wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S, and wherein enzyme variants with respect to parental array at the 2nd group, the 4th group, one or more amino-acid residues place that the 6th group or the 7th group limit comprises one or more amino acid modified (as WO2005/066347 and below define), structurally compare and identify out by described parental array and P10480 structural models defined herein for described group, its preferably by P10480 crystalline structure equivalent (crystal structure coordinates) with as WO2005/066347 and below the structure alignment of defined 1IVN.PDB and/or 1DEO.PDB obtain.
In other embodiments, for host cell of the present invention, carrier, the nucleotide sequence of coding acyltransferase of any one acyltransferase variant of can encoding in method and/or application, it can be characterized as being described enzyme and comprise aminoacid sequence motif GDSX, wherein X is one or more in following amino-acid residue: L, A, V, I, F, Y, H, Q, T, N, M or S, and wherein enzyme variants comprises one or more amino acid modified with respect to parental array at the 2nd group of one or more amino-acid residues place instructing, described the 2nd group out identified when by the comparison of described parental array and pfam consensus sequence (SEQ ID No.2-Fig. 3), and according to the structural models of P10480 modify to guarantee as WO2005/066347 and below defined the best meet overlapping (best fit overlap).
Compatibly, when for host cell of the present invention, carrier, in method and/or application, the nucleotide sequence of the coding acyltransferase of any one can be encoded and can be comprised the acyltransferase variant of following aminoacid sequence, and wherein said aminoacid sequence is as SEQ ID No.34, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.19, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.1, SEQ ID No.15, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, shown in SEQ ID No.32 or SEQ ID No.33, and at the 2nd group, the 4th group, one or more amino-acid residues place that the 6th group or the 7th group limit has one or more amino acid modified (as WO2005/066347 and below define), and described group is by identifying out with the sequence alignment of SEQ ID No.34.
Or, the nucleotide sequence of coding acyltransferase can encoded packets containing the acyltransferase variant of following aminoacid sequence, wherein said aminoacid sequence is as SEQ ID No.34, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.19, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.1, SEQ ID No.15, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, shown in SEQ ID No.32 or SEQ ID No.33, and at the 2nd group, the 4th group, one or more amino-acid residues place that the 6th group or the 7th group limit has one or more amino acid modified (as WO2005/066347 and below define), described group be structurally to be compared and identify out by the structural models of described parental array and P10480 defined herein, its preferably by P10480 crystalline structure equivalent with as WO2005/066347 and the structure alignment of the 1IVN.PDB below being instructed and/or 1DEO.PDB obtain.
Or, the nucleotide sequence of coding acyltransferase can encoded packets containing the acyltransferase variant of following aminoacid sequence, wherein said aminoacid sequence is as SEQ ID No.34, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.19, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.1, SEQ ID No.15, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, shown in SEQ ID No.32 or SEQ ID No.33, and have one or more amino acid modified at the 2nd group of one or more amino-acid residues place instructing, described the 2nd group out identified when by the comparison of described parental array and pfam consensus sequence (SEQ ID No.2), and modify to guarantee as WO2005/066347 and the best of below being instructed meets overlapping according to the structural models of P10480.
Preferably, described parent enzyme is to comprise aminoacid sequence shown in SEQ ID No.34 and/or SEQ ID No.15 and/or SEQ ID No.35 or the enzyme with their homologies.
Preferably; the nucleotide sequence of coding acyltransferase can encoded packets containing the acyltransferase variant of following aminoacid sequence; wherein said aminoacid sequence as shown in SEQ ID No.34 or SEQ ID No.35, and as WO2005/066347 and one or more amino-acid residues place that below defined the 2nd group, the 4th group, the 6th group or the 7th group limit having one or more amino acid modified.
The definition of group
The 1st group of amino acid:
The 1st group of amino acid (noticing that these are the amino acid in the 1IVN of Figure 53 and Figure 54)
Gly8、Asp9、Ser10、Leu11、Ser12、Tyr15、Gly44、Asp45、Thr46、Glu69、Leu70、 Gly71、Gly72、 Asn73、Asp74、Gly75、Leu76、Gln106、Ile107、Arg108、Leu109、Pro110、Tyr113、Phe121、Phe139、Phe140、Met141、Tyr145、Met151、 Asp154、His157、Gly155、Ile156、Pro158
From the 1st group, do not comprise the motif of high conservative, as GDSx and catalytic residue (indicating the residue of underscore).For fear of dispute, the 1st group has defined the central carbon atom at glycerine in 1IVN model avtive spot with interior amino-acid residue.
The 2nd group of amino acid:
The 2nd group of amino acid (noticing that amino acid whose numbering refers to the amino acid in P10480 mature sequence)
Leu17, Lys22, Met23, Gly40, Asn80, Pro81, Lys82, Asn87, Asn88, Trp111, Val112, Ala114, Tyr117, Leu118, Pro156, Gly159, Gln160, Asn161, Pro162, Ser163, Ala164, Arg165, Ser166, Gln167, Lys168, Val169, Val170, Glu171, Ala172, Tyr179, His180, Asn181, Met209, Leu210, Arg211, Asn215, Lys284, Met285, Gln289 and Val290.
The comparison sheet of selected residue in the 1st group and the 2nd group
The 3rd group of amino acid:
The 3rd group of amino acid is identical with the 2nd group, but refer to the encoding sequence of aeromonas salmonicida (SEQ ID No.4), the numbering of the amino-acid residue in the 3rd group wants large 18, the difference of amino acid between numbering in this albumen (SEQ ID No.25) that has reflected maturation protein (SEQ ID No.34) and comprised signal sequence.
Aeromonas salmonicida GDSX (SEQ ID No.4) has five amino acid different with the maturation protein of Aeromonas hydrophila GDSX (SEQ ID No.34).They are Thr3Ser, Gln182Lys, Glu309Ala, Ser310Asn and Gly318-, before wherein the residue of aeromonas salmonicida is listed in, and after the residue of Aeromonas hydrophila is listed in.The length of Aeromonas hydrophila albumen only has 317 amino acid, and lacks residue on the 318th.Compared with Aeromonas hydrophila albumen, aeromonas salmonicida GDSX has quite high activity to polar lipid (as galactolipid substrate).Site scanning has been carried out in whole five amino acids position.
The 4th group of amino acid:
The 4th group of amino acid is S3, Q182, E309, S310 and-318.
The 5th group of amino acid:
F13S、D15N、S18G、S18V、Y30F、D116N、D116E、D157N、Y226F、D228N、Y230F。
The 6th group of amino acid:
The 6th group of amino acid is Ser3, Leu17, Lys22, Met23, Gly40, Asn80, Pro81, Lys82, Asn87, Asn88, Trp111, Val112, Ala114, Tyr117, Leu118, Pro156, Gly159, Gln160, Asn161, Pro162, Ser163, Ala164, Arg165, Ser166, Gln167, Lys168, Val169, Val170, Glu171, Ala172, Tyr179, His180, Asn181, Gln182, Met209, Leu210, Arg211, Asn215, Lys284, Met285, Gln289, Val290, Glu309, Ser310,-318.
Amino acid whose numbering in the 6th group refers to the amino-acid residue in P10480 (SEQ ID No.25), and the corresponding amino acid on other sequence main chain can be by comparing with the homology of P10480 and/or 1IVN and/or structure alignment is determined.
The 7th group of amino acid:
The 7th group of amino acid is Ser3, Leu17, Lys22, Met23, Gly40, Asn80, Pro81, Lys82, Asn87, Asn88, Trp111, Val112, Ala114, Tyr117, Leu118, Pro156, Gly159, Gln160, Asn161, Pro162, Ser163, Ala164, Arg165, Ser166, Gln167, Lys168, Val169, Val170, Glu171, Ala172, Tyr179, His180, Asn181, Gln182, Met209, Leu210, Arg211, Asn215, Lys284, Met285, Gln289, Val290, Glu309, Ser310,-318, (wherein X is selected from A to Y30X, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W), (wherein X is selected from A to Y226X, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W), (wherein X is selected from A to Y230X, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W), (wherein X is selected from A to S18X, C, D, E, F, H, I, K, L, M, N, P, Q, R, T, W or Y), (wherein X is selected from A to D157X, C, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y).
In the 7th group, amino acid whose numbering refers to the amino-acid residue in P10480 (SEQ ID No.25), and the corresponding amino acid on other sequence main chain can be by comparing with the homology of P10480 and/or 1IVN and/or structure alignment is determined.
Compatibly, compared with parent enzyme, described enzyme variants comprises below one or more amino acid modified:
S3E, A, G, K, M, Y, R, P, N, T or G
E309Q, R or A, be preferably Q or R
-318Y, H, S or Y, be preferably Y.
Preferably, the X of GDSX motif is L.Therefore, preferred described parent enzyme comprises amino acid motif GDSL.
Compatibly, described first parent's acyltransferase can comprise any following aminoacid sequence: SEQ ID No.34, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.19, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.1, SEQ ID No.15, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, SEQ ID No.32 or SEQ ID No.33.
Compatibly, the described second relevant acyltransferase can comprise any following aminoacid sequence: SEQ ID No.3, SEQ ID No.34, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.19, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.1, SEQ ID No.15, SEQ ID No.25, SEQ ID No.26, SEQ ID No.27, SEQ ID No.28, SEQ ID No.29, SEQ ID No.30, SEQ ID No.32 or SEQ ID No.33.
Compared with described parent enzyme, described enzyme variants must comprise that at least one is amino acid modified.In some embodiments, compared with parent enzyme, described enzyme variants can comprise at least 2, be preferably at least 3, be preferably at least 4, be preferably at least 5, be preferably at least 6, be preferably at least 7, be preferably at least 8, be preferably at least 9, be preferably at least 10 amino acid modified.
In the time mentioning in this article concrete amino-acid residue, can obtain numbering from the comparing of reference sequences shown in sequence variants and SEQ ID No.34 or SEQ ID No.35.
On the one hand, preferred enzyme variant comprises one or more following aminoacid replacement:
S3A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y; And/or
L17A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W or Y; And/or
S18A, C, D, E, F, H, I, K, L, M, N, P, Q, R, T, W or Y; And/or
K22A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W or Y; And/or
M23A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y; And/or
Y30A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; And/or
G40A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
N80A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
P81A, C, D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W or Y; And/or
K82A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W or Y; And/or
N87A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
N88A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
W111A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
V112A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W or Y; And/or
A114C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
Y117A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; And/or
L118A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W or Y; And/or
P156A, C, D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W or Y; And/or
D157A, C, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
G159A, C, D, E, F, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
Q160A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W or Y; And/or
N161A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
P162A, C, D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W or Y; And/or
S163A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y; And/or
A164C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
R165A, C, D, E, F, G, H, I, K, L, M, N, P, Q, S, T, V, W or Y; And/or
S166A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y; And/or
Q167A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W or Y; And/or
K168A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W or Y; And/or
V169A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W or Y; And/or
V170A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W or Y; And/or
E171A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
A172C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
Y179A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; And/or
H180A, C, D, E, F, G, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
N181A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; And/or
Q182A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W or Y, be preferably K; And/or
M209A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y; And/or
L210A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W or Y; And/or
R211A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
N215A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
Y226A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; And/or
Y230A, C, D, E, G, H, I, K, L, M, N, P, Q, R, S, T, V or W; And/or
K284A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W or Y; And/or
M285A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y; And/or
Q289A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W or Y; And/or
V290A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W or Y; And/or
E309A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y; And/or
S310A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y.
In addition or alternatively, can there be one or more C-terminal to extend.Preferably, described additional C-terminal prolongation is made up of one or more aliphatic amino acids, is preferably nonpolar amino acid, more preferably I, L, V or G.Therefore, the present invention further provides the one or more enzyme variants comprising in following C-terminal prolongation: 318I, 318L, 318V, 318G.
Preferred enzyme variants can reduce phosphatide as the hydrolytic activity of phosphatidylcholine (PC), and the transferase active that can raise to phosphatide.
Preferred enzyme variants can raise to phosphatide as the transferase active of phosphatidylcholine (PC), the hydrolytic activity that also can raise to phosphatide.
The modification of one or more following residues can produce enzyme variants phosphatide to the absolute branch enzymic activity of rising: S3, D157, S310, E309, Y179, N215, K22, Q289, M23, H180, M209, L210, R211, P81, V112, N80, L82, N88, N87.
Can provide the preferably concrete modification that phosphatide is had to an enzyme variants of improved transferase active can be selected from following one or more:
S3A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y, be preferably N, E, K, R, A, P or M, most preferably is S3A;
D157A, C, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y, be preferably D157S, R, E, N, G, T, V, Q, K or C;
S310A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y, be preferably S310T ,-318E;
E309A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, T, V, W or Y, be preferably E309R, E, L, R or A;
Y179A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V or W, be preferably Y179D, T, E, R, N, V, K, Q or S, more preferably E, R, N, V, K or Q;
N215A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y, be preferably N215S, L, R or Y;
K22A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W or Y, be preferably K22E, R, C or A;
Q289A, C, D, E, F, G, H, I, K, L, M, N, P, R, S, T, V, W or Y, be preferably Q289R, E, G, P or N;
M23A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, be preferably M23K, Q, L, G, T or S;
H180A, C, D, E, F, G, I, K, L, M, P, Q, R, S, T, V, W or Y, be preferably H180Q, R or K;
M209A, C, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, be preferably M209Q, S, R, A, N, Y, E, V or L;
L210A, C, D, E, F, G, H, I, K, M, N, P, Q, R, S, T, V, W or Y, be preferably L210R, A, V, S, T, I, W or M;
R211A, C, D, E, F, G, H, I, K, L, M, N, P, Q, S, T, V, W or Y, be preferably R211T;
P81A, C, D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W or Y, be preferably P81G;
V112A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, W or Y, be preferably V112C;
N80A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y; Be preferably N80R, G, N, D, P, T, E, V, A or G
L82A, C, D, E, F, G, H, I, M, N, P, Q, R, S, T, V, W or Y, be preferably L82N, S or E;
N88A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y, be preferably N88C;
N87A, C, D, E, F, G, H, I, K, L, M, P, Q, R, S, T, V, W or Y, be preferably N87M or G;
The preferred modification of one or more following residues produces enzyme variants phosphatide to the absolute branch enzymic activity of rising:
S3N、R、A、G
M23K、Q、L、G、T、S
H180R
L82G
Y179E, R, N, V, K or Q
E309R, S, L or A
A preferred modification is N80D.Especially all the more so in the time using reference sequences SEQ ID No.35 as skeleton.Therefore, reference sequences can be SEQ ID No.16.Described modification can be modified combination with one or more other.Therefore; in a preferred embodiment of the invention; the coded acyltransferase of nucleotide sequence for the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can comprise SEQ ID No.35, or with SEQ ID No.35 have 75% or higher, be preferably 85% or higher, more preferably 90% or higher, more preferably 95% or higher, more preferably 98% or higher or more preferably 99% or the aminoacid sequence of higher identity.
As noted above, in the time mentioning concrete amino-acid residue in this article, numbering is the acquisition of comparing by the reference sequences shown in sequence variants and SEQ ID No.34 or SEQ ID No.35.
Preferably; for the nucleotide sequence of the coding acyltransferase of host cell of the present invention, carrier, method and/or application any one can encoded packets containing the fat of the aminoacid sequence shown in SEQ ID No.16, with SEQ ID No.16 have 75% or higher, be preferably 85% or higher, more preferably 90% or higher, more preferably 95% or higher, more preferably 98% or higher or more preferably 99% or the fat of the aminoacid sequence of higher identity.Described enzyme can be considered to enzyme variants.
For purposes of the present invention, the degree of identity is the number based on identical sequence element (sequence elements).According to the present invention, can suitably determine by the method for computer program known in the art (as Vector NTI 10 (Invitrogen Corp.)) the identity degree of aminoacid sequence.For paired comparison, scoring used is preferably that the open point penalty in room is 10.0, the BLOSUM62 that point penalty is 0.1 is extended in room.
Compatibly, about the identity degree of aminoacid sequence, at least 20 continuous amino acid, be preferably at least 30 continuous amino acid, be preferably at least 40 continuous amino acid, be preferably at least 50 continuous amino acid, be preferably at least 60 continuous amino acid and measure.
Compatibly, can in complete sequence, measure the identity degree of aminoacid sequence.
Compatibly, the nucleotide sequence of code book invention acyltransferase can obtain, preferably obtain the organism with subordinate from one or more: Aeromonas, streptomyces, Saccharomycodes, lactococcus, mycobacterium, streptococcus, lactobacillus, desulfiting Pseudomonas, genus bacillus, Campylobacter, vibrionaceae, rod Pseudomonas, sulfolobus solfataricus belongs to, Aspergillus, Schizosaccharomyces, listeria, neisseria, Autoinducer belongs to, Lei Er Bordetella, xanthomonas, Candida, happiness hot tearing spore Pseudomonas and corynebacterium.
Compatibly, the nucleotide sequence of code book invention acyltransferase can obtain, and preferably from one or more following organisms, obtains: Aeromonas hydrophila, aeromonas salmonicida, streptomyces coelicolor (Streptomyces coelicolor), streptomyces rimosus (Streptomyces rimosus), mycobacterium, streptococcus pyogenes (Streptococcus pyogenes), Lactococcus lactis (Lactococcus lactis), streptococcus pyogenes, thermophilus streptococcus (Streptococcus thermophilus), Streptomyces thermosacchari, streptomyces griseus, lactobacterium helveticus (Lactobacillus helveticus), dehalogenation desulfiting bacterium (Desulfitobacterium dehalogenans), genus bacillus, campylobacter jejuni (Campylobacter jejuni), vibrionaceae (Vibrionaceae), xyllela fastidiosa (Xylella fastidiosa), sulfolobus solfataricus (Sulfolobus solfataricus), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), soil mould (Aspergillus terreus), schizosaccharomyces pombe (Schizosaccharomycespombe), listera innocua (Listeria innocua), Listeria monocytogenes (Listeria monocytogenes), Neisseria meningitidis (Neisseria meningitidis), Root or stem of Littleleaf Indianmulberry Autoinducer (Mesorhizobium loti), Ralstonia solanacearum (Ralstonia solanacearum), xanthomonas campestris (Xanthomonas campestris), Xanthomonas axonopodis (Xanthomonas axonopodis), Candida parapsilosis, brown happiness hot tearing spore bacterium and Corynebacterium efficiens.
On the one hand; the coded acyltransferase of nucleotide sequence that is preferred for the code book invention acyltransferase of any one in host cell of the present invention, carrier, method and/or application can obtain, preferably obtain from or from one or more of Aeromonas, Aeromonas hydrophila or aeromonas salmonicida.
The enzyme that can use the test of instructing in the embodiment 12 of WO2004/064537 to have acyltransferase function to the present invention carries out routine qualification.Described test is used very high water-content (approximately 95%); acyltransferase of the present invention is to have at least 2% acyltransferase activity (transferase active relatively); be preferably at least 5% relative transferase active; be preferably at least 10% relative transferase active, be preferably at least 15%, 20%, 25%, 26%, 28%, 30%, 40%, 50%, 60% or 75% relative transferase active.
Phospholipid hydrolase can play acyltransferase in low water surrounding.Therefore, when carry out the modification of fatty edible oil in low water surrounding time, can consider to use Phospholipid hydrolase to substitute phosphoacylase, or except phosphoacylase, can use Phospholipid hydrolase simultaneously.
Term used herein " Gao Shui " refers to that water-content is greater than 3%, is preferably more than 4%, is greater than 5%, is greater than 6%, is greater than 7%, is greater than 8%, is greater than 9%, is greater than 10%, is greater than 20%, is greater than 30%, is greater than 40%, is greater than 50%, is greater than 60%, is greater than 70%, is greater than 80% or be greater than 90% any substrate or food.
Term used herein " low water " refers to that water-content water-content is less than 3%, is preferably and is less than 2%, is less than 1% or be less than 0.5%, be less than 0.3%, be less than 0.2, be less than 0.1, be less than 0.05 or be less than 0.01% any substrate or food.
For fear of dispute, milk is high water surrounding, and butterfat (butterfat) is low water surrounding.
Comprise phospholipase A1, Phospholipase A2 or phospholipase B for applicable Phospholipid hydrolase of the present invention.Also can be by phospholipase A1, Phospholipase A2 or phospholipase B and active collaborative use of acyltransferase.Also can be by Phospholipase C and/or D and active collaborative use of acyltransferase activity/phospholipase A1, A2 and/or B, this is similar to WO2005/089562.Preferred Phospholipid hydrolase can comprise Phospholipase A2, as LecitaseTM or the Phospholipid hydrolase of the disclosed fusarium of WO2004/97012 (Novozymes/Chr.Hansen) (Fusarium venenatum) and the Phospholipid hydrolase of Tuber albidum.The fusarium Phospholipid hydrolase MAX YIELD by name that Novozymes sells tM.
Separate
On the one hand, method of the present invention comprises the additional step of recovered/separated acyltransferase.Therefore, prepared acyltransferase can be the form separating.
On the other hand, can be the form separating for the nucleotide sequence of coding acyltransferase of the present invention.
Term " (or separate) of separation " refers to that sequence or albumen do not comprise other at least one composition at least substantially, and described composition with this sequence or albumen is natural is connected, and is found in nature with this connection state in nature.
Purifying
On the one hand, method of the present invention comprises the additional step that described acyltransferase is carried out to purifying.
On the other hand, can be the form of purifying for the nucleotide sequence of coding acyltransferase of the present invention.
Term " purifying " refers to that sequence is in relatively pure state, as pure or pure or pure or pure or pure or pure at least about 98% at least about 95% at least about 90% at least about 80% at least about 75% at least about 51%.
The nucleotide sequence of clones coding polypeptide of the present invention
The nucleotide sequence that coding has the polypeptide of special properties as herein defined or is applicable to the polypeptide of modifying can separate and obtain from produce any cell of described polypeptide or organism.The whole bag of tricks separating for nucleotide sequence is all well known in the art.
For example, can build genomic dna and/or cDNA library with chromosomal DNA or the messenger RNA(mRNA) of the organism that produces described polypeptide.If the aminoacid sequence of described polypeptide is known, can synthesizes the oligonucleotide probe through mark, and use it for the clone of identification code polypeptide the genomic library from being prepared by this organism.Or, also can be with comprising and the clone who carrys out identification code polypeptide through labeled oligonucleotide probe of the sequence of another known peptide DNA homolog.Under latter event, use lower hybridization and the cleaning condition of preciseness.
Or, the clone of identification code polypeptide in the following way: the fragment of genomic dna is inserted in expression vector (as plasmid), use the negative bacterium of genome dna library saccharase of gained, and subsequently the bacterium of conversion is coated on containing on the agar by the enzyme that can be suppressed by described polypeptide, can identify thus the clone of express polypeptide.
Moreover, also can be by the standard method of having set up by synthesizing to prepare the nucleotide sequence of coding said polypeptide, as (1981) Tetrahedron Letters 22 such as Beucage S.L., the phosphoramidite method that p 1859-1869 describes, or (1984) EMBO such as Matthes is J.3, the method that p 801-805 describes.In phosphoramidite method, synthetic oligonucleotide on as automatic dna synthesizer, is then purified, anneals, connects and be cloned in suitable carrier.
Described nucleotide sequence can be the connector that is derived from genomic fragment and synthetic fragment, be derived from the connector of synthetic fragment and cDNA fragment or be derived from genomic fragment and the connector of cDNA fragment, and it is derived from synthetic, fragment (as required) genomic or cDNA according to standard technique by connection and makes.The fragment of each connection is corresponding to the different piece of whole nucleotide sequence.Described DNA sequence dna also can use specific primer to pass through polymerase chain reaction (PCR) to prepare, as US4,683,202 or Saiki R K etc. (Science (1988) 239, pp 487-491) described in.
Nucleotide sequence
The present invention is also contained coding and is had the nucleotide sequence of the polypeptide of special properties as herein defined.Term used herein " nucleotide sequence " refers to oligonucleotide sequence or polynucleotide sequence and its variant, homologue, fragment and derivative (as its part).Described nucleotide sequence can be derived from genome or synthetics or restructuring thing, and it can be (no matter it represents positive-sense strand or antisense strand) double-stranded or strand.
Term of the present invention " nucleotide sequence " comprises genomic dna, cDNA, synthetic DNA and RNA.Preferably, it refers to DNA, more preferably the cDNA of encoding sequence.
In preferred embodiments, coding has the nucleotide sequence of the polypeptide of special properties as herein defined and is not encompassed in the natural nucleus glycoside acid sequence existing in natural surroundings and be connected with its natural connected sequence (being in together in its natural surroundings).For ease of reference, we are called this preferred embodiment " non-natural nucleoside acid sequence ".Thus, term " natural nucleus glycoside acid sequence " refers to the complete core nucleotide sequence (being in together in its natural surroundings) being operably connected with its natural complete promotor being connected (being in together in its natural surroundings).Therefore, polypeptide of the present invention can utilize nucleotides sequence to be listed in its natural biological body and express, but wherein said nucleotide sequence is not subject to the control of the promotor of combination natural with it in described organism.
Preferably, described polypeptide is not natural polypeptides.Thus, term " natural polypeptides " refers in its natural surroundings and the whole polypeptide of having been expressed by its natural nucleotide sequence.
Conventionally, use recombinant DNA technology preparation coding to there is the nucleotide sequence of the polypeptide of special properties (i.e. the DNA of restructuring) as herein defined.But, in another specific embodiments of the present invention, can synthesize all or part of nucleotide sequence (referring to (1980) Nuc Acids Res Symp Ser 225-232 such as (1980) Nuc Acids Res Symp Ser 215-23 and Horn T such as Caruthers MH) by chemical process known in the art.
Molecular evolution
Isolate the nucleotide sequence of codase or identify coding and infer after the nucleotide sequence of enzyme, just may need selected nucleotide sequence to modify, for example, need described sequence to suddenly change to prepare enzyme of the present invention.
Can introduce sudden change with synthetic oligonucleotide.The nucleotide sequence that these oligonucleotide comprise targeted mutagenesis site flank.
Applicable method is disclosed in (Biotechnology (1984) 2, p646-649) such as Morinaga.Another kind of be described in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151) to the method for introducing sudden change in the nucleotide sequence of codase.
Except site-directed mutagenesis as described above, can introduce at random sudden change, as commodity in use test kit, as the GeneMorph PCR mutagenesis kit from Stratagene or from the Diversify PCR random mutagenesis test kit of Clontech.EP 0583265 mentions the optimization method of the mutagenesis of PCR-based, and it also can be combined with DNA mutation analogue, those described in EP 0866796.Fallibility round pcr is also applicable to prepare the acyltransferase variant with preferred character.WO0206457 has mentioned the molecular evolution of lipase.
The third method that obtains novel sequences is with any amount of Restriction Enzyme or if the enzyme of Dnase I is by different nucleotide sequence fragments, and is reassembled into the full length nucleotide sequence of encoding function albumen.Or, can use one or more different nucleotide sequences, and introduce sudden change in the time re-assemblying full length nucleotide sequence.DNA reorganization (shuffling) and family's shuffling technology are applicable to prepare the acyltransferase variant with preferred property.The method that is applicable to carrying out " reorganization " can be referring to EP0752008, EP1138763, EP1103606.Reorganization also can with as US6,180,406 and WO 01/34835 described in the DNA mutagenesis of other form combine.
Therefore, likely make in vivo or in vitro to produce in nucleotide sequence a large amount of rite-directed mutagenesises or random mutation the coded polypeptide being improved by multiple means screening function subsequently.The recombination method (referring to WO 00/58517, US 6,344,328, US6,361,974) that uses for example in silico and exo mediation, can carry out molecular evolution, and the variant that wherein produced has retained the very low homology with known enzyme or albumen.Thus obtained described variant can have significant structural similarity with known transferring enzyme, but has very low amino acid sequence homology.
In addition,, as in indefiniteness embodiment, the sudden change of polynucleotide sequence or natural variant also can recombinate to produce new variant with wild-type or other sudden change or natural variant.Also can screen described new variant to obtain the functional coded polypeptide being improved.
Apply above and similar molecular evolution method and can in any existing acquainted situation about protein structure or function, not identify and select to there is the enzyme variants of the present invention of preferred characteristics, and can produce uncertain but useful sudden change or variant.Apply in the art molecular evolution and optimize or change the example of enzymic activity and have a lot, described example includes but not limited to following one or more: optimize in host cell or external expression and/or activity, increase enzymic activity, change substrate and/or product specificity, increase or reduce enzyme stability or the activity/specificity of structural stability, change enzyme in preferred ambient condition (as temperature, pH, substrate).
Use molecular evolution instrument to change to improve the functional of this enzyme to enzyme, this is apparent for a person skilled in the art.
Compatibly, for the nucleotide sequence of the coding acyltransferase of the present invention acyltransferase variant of can encoding, when with parent enzyme relatively time, described acyltransferase can comprise at least one amino acid whose replacement, lacks or add.Variant enzyme and parent enzyme keep at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% homology.Applicable parent enzyme can comprise any enzyme with esterase or lipase activity.Preferably, parent enzyme is corresponding to pfam00657 consensus sequence.
In preferred embodiments, acyltransferase variant retains or mixed at least one or more pfam00657 consensus sequence amino-acid residue of finding in GDSx, GANDY and HPT part.
Can use molecular evolution instrument make enzyme (as in aqueous environment not or there is the lipase of low fat acyltransferase activity) sudden change; to introduce or to strengthen transferase active, there is this production to be suitable for the acyltransferase with remarkable transferase active of the compositions and methods of the invention.
Compatibly; the coded acyltransferase of nucleotide sequence that is used for the coding acyltransferase of carrier of the present invention, host cell, method and/or application any one can be variant; compared with parent enzyme, this variant has the enzymic activity of enhancing to polar lipid (being preferably phosphatide and/or glycolipid).Preferably, described variant can also have low activity or non-activity to solubility polar lipid (lyso polar lipids).The activity of the enhancing to polar lipid, phosphatide and/or glycolipid may be the result due to hydrolysis and/or transferase active or the two combination.
Compared with parent enzyme, described acyltransferase variant can reduce the activity of triglyceride level and/or monoglyceride and/or triglyceride.
Compatibly, described enzyme variants can not have activity to triglyceride level and/or monoglyceride and/or triglyceride.
Or, described enzyme variants can increase the activity of triglyceride level, and/or also can increase the activity of following one or more: polar lipid, phosphatide, Yelkin TTS, phosphatidylcholine, glycolipid, digalactosyl monoglyceride, single galactosyl monoglyceride.
Acyltransferase variant is known, and described in one or more, variant goes for methods and applications of the present invention, and/or enzyme composition of the present invention.Only for instance, can use the acyltransferase variant to set forth in Publication about Document according to the present invention: Hilton & Buckley J Biol.Chem.1991Jan 15:266 (2): 997-1000; The J.Biol.Chem.1994Jan such as Robertson 21; 269 (3): 2146-50; The J.Bacteriol 1996Apr such as Brumlik; 178 (7): 2060-4; The Protein Sci.1998Mar such as Peelman; 7 (3): 587-99.
Aminoacid sequence
The coded aminoacid sequence of nucleotide sequence by the coding acyltransferase for carrier of the present invention, host cell, method and/or application any one is also contained in the present invention.
Term as used herein " aminoacid sequence " and term " polypeptide " and/or term " albumen " synonym.In some instances, term " aminoacid sequence " and term " peptide " synonym.
Described aminoacid sequence can be from applicable source preparation/separation, or it can use recombinant DNA technology preparation by synthetic preparation or its.
Compatibly, described aminoacid sequence can obtain by standard technique from the isolated polypeptide of instruction herein.
A kind of method of aminoacid sequence of applicable mensuration isolated polypeptide is as follows:
Can be by the polypeptide freeze-drying of purifying, and by the freeze-drying material dissolution of 100 μ g in 50 μ l mixtures (pH 8.4) of 8M urea and 0.4M bicarbonate of ammonia.Covering nitrogen adding after 5 μ l 45mM dithiothreitol (DTT), can be by the albumen of dissolving 50 DEG C of sex change and reduce 15 minutes.Be cooled to after room temperature, can add 5 μ l100mM iodo-acid amides, thereby make cysteine residues derive 15 minutes under room temperature, lucifuge and nitrogen.
Can in above reaction mixture, add 135 μ l water and the 5 μ l aqueous solution containing 5 μ g endo-protease Lys-C, and carry out digestion in 24 hours at 37 DEG C under nitrogen.
Can use solvent orange 2 A (aqueous solution of 0.1%TFA) and solvent B (acetonitrile solution of 0.1%TFA) at VYDAC C18 post (0.46x15cm; 10 μ m; The Separation Group, California, USA) upper by the peptide of reverse hplc resulting separation.Before N-terminal order-checking, can use identical solvent system, on Develosil C18 post, selected peptide is carried out to chromatography again.Can use Applied Biosystems 476A sequenator, complete order-checking according to manufacturer's specification sheets (Applied Biosystems, California, USA) with the liquid Rapid Circulation of pulse.
Sequence identity or sequence homology
At this, term " homologue " refers to the entity with subject amino acid sequence and theme nucleotide sequence with certain homology.At this, term " homology " can be equal to " identity ".
Described homologous amino acid sequence and/or nucleotide sequence can provide and/or encode and retain the functionally active of described enzyme and/or strengthen the active polypeptide of described enzyme.
In this article, think that homologous sequence comprises and can have at least 75,85 or 90% identity with subject nucleotide sequence, be preferably at least 95 or the aminoacid sequence of 98% identity.Conventionally, homologue will comprise the avtive spot identical with subject amino acid sequence etc.Although homology also can be looked at as similarity (being that amino-acid residue has similar chemical property/function), in content of the present invention, is preferably expressing by homology aspect sequence identity.
In this article, think that homologous sequence comprises and can have at least 75,85 or the nucleotide sequence of 90% identity with the nucleotide sequence of code book invention polypeptide (subject nucleotide sequence), be preferably at least 95 or the nucleotide sequence of 98% identity.Conventionally, homologue will comprise the avtive spot encoding sequence identical with subject nucleotide sequence etc.Although homology also can be looked at as similarity (being that amino-acid residue has similar chemical property/function), in content of the present invention, is preferably expressing by homology aspect sequence identity.
Can carry out homology comparison by range estimation, or more generally carry out homology comparison by the sequence comparison program that is easy to obtain.These commercial computer programs can calculate the homology % between two or more sequences.
Can in continuous sequence, calculate homology %, i.e. a sequence and other sequence alignment, and the corresponding amino acid in the each amino acid in a sequence and other sequence is directly compared to often next residue.Comparison of this being called " non-notch ".Common described non-notch comparison is only carried out in the relatively few residue of quantity.
Although this is very simple and reliable method, but it fails to consider as in the identical paired sequence of other side, one is inserted or disappearance will cause that amino-acid residue subsequently cannot compare, and therefore may in the time carrying out entirety comparison, cause the reduction greatly of homology %.Therefore, most of sequence alignment method is designed to possible insertion and disappearance, produce best comparison in the case of considering, and not excessively punishes the score of overall homology.This can maximize local homology to realize managing by insert " breach " in sequence.
But, these more complicated methods give " breach point penalty " to the each breach occurring in comparison, make the same amino acid for similar number, thering is the sequence alignment of breach as far as possible less (having reflected higher dependency between the sequence of two comparisons) and will there is higher score than the sequence alignment with more breach.Conventionally use " affine breach cost " (Affine gap costs), the existence of breach is sentenced to higher cost, and the each follow-up residue in breach is sentenced to less point penalty.This is the most frequently used breach points-scoring system.High breach point penalty will have generation the still less optimization comparison of breach undoubtedly.Most of comparison programs allow to revise breach point penalty.But, in the time using described software to carry out sequence comparison, preferably Use Defaults.
Therefore, first the calculating of maximum homology % need to consider to produce best comparison under breach point penalty.The computer program that is suitable for carrying out described comparison is Vector NTI (Invitrogen Corp.).The example that can carry out other software of sequence comparison include but not limited to BLAST software package (referring to 1999Short Protocols in Molecular Biology such as Ausubel, 4 thed, Chapter18) and FASTA (1990J.Mol.Biol.403-410 such as Altschul).BLAST and FASTA all can carry out off-line and on-line search (referring to Ausubel etc. 1999,7-58 page is to 7-60 page).But, for some application, preferably use Vector NTI program.Also can be by the new tool that is called BLAST 2Sequences for comparing albumen and nucleotide sequence (referring to FEMS Microbiol Lett 1999174 (2): 247-50; FEMS Microbiol Lett 1999177 (1): 187-8 and tatiana@ncbi.nlm.nih.gov).
Although measure final homology % according to identity, comparison method itself is not based on being entirely or complete non-paired comparison conventionally.But, conventionally use extensive similarity rating matrix (scaled similarity score matrix), based on chemical similarity or evolutionary distance, every pair is relatively marked.Conventionally the example of this matrix used is BLOSUM62 matrix (default matrix of blast program cover).Vector NTI program is used disclosed default value conventionally, or the self-defining symbol comparison sheet (referring to user manual) that also may provide.For some application, preferably use the default value of Vector NTI software package.
Or, also can use based on CLUSTAL (Higgins DG & SharpPM (1988), Gene 73 (1), 237-244) similarly the multiple ratio in the Vector NTI (Invitrogen Corp.) of algorithm feature is calculated to homology %.
Once Software Create best comparison, just can calculate homology %, be preferably sequence identity %.Software conventionally sets it as a part for sequence comparison and carries out, and generates numerical result.
If use breach point penalty in the time measuring sequence identity, preferably use subsequently following parameter to compare in pairs:
BLAST
Gap opened 0
Breach extends 0
CLUSTAL DNA Albumen
Word length (WORD SIZE) 2 1 K triplet
Breach point penalty 15 10
Breach extends 6.66 0.1
In one embodiment, preferably measure the sequence identity of nucleotide sequence with the CLUSTAL with breach point penalty defined above and breach extension value.
Compatibly, at least 20 continuous Nucleotide, be preferably at least 30 continuous Nucleotide, be preferably at least 40 continuous Nucleotide, be preferably at least 50 continuous Nucleotide, be preferably at least 60 continuous Nucleotide, be preferably the identity degree of measuring nucleotide sequence at least 100 continuous Nucleotide.
Compatibly, in complete sequence, measure the identity degree in nucleotide sequence.
In one embodiment, the identity degree of aminoacid sequence of the present invention can be by the method for computer program known in the art, as Vector NTI 10 (Invitrogen Corp.) suitably measures.For paired comparison, it is 10.0 and breach to extend point penalty be 0.1 BLOSUM62 that matrix used is preferably gap opened point penalty.
Compatibly, at least 20 continuous amino acid, be preferably at least 30 continuous amino acid, be preferably at least 40 continuous amino acid, be preferably at least 50 continuous amino acid, be preferably the identity degree of measuring aminoacid sequence at least 60 continuous amino acid.
Compatibly, in complete sequence, measure the identity degree of aminoacid sequence.
Described sequence also can have the disappearance, insertion or the replacement that produce reticent change and produce the amino-acid residue of function equivalent.Can the similarity on polarity, electric charge, solvability, hydrophobicity, wetting ability and/or amphipathic characteristic carry out careful aminoacid replacement according to residue, as long as keep the less important combination of this material active.For example, electronegative amino acid comprises aspartic acid and L-glutamic acid; Positively charged amino acid comprises Methionin and arginine; The amino acid with uncharged polar head group (polar head groups) of similar hydrophilicity value comprises leucine, Isoleucine, α-amino-isovaleric acid, glycine, L-Ala, l-asparagine, glutamine, Serine, Threonine, phenylalanine and tyrosine.
For example can guard replacement according to following table.Amino acid in secondary series in identical hurdle, the amino acid being preferably in going together mutually in the 3rd row can replace mutually:
The present invention is also contained the homology that can occur and is replaced (exchange that replacement used herein and replacement all refer to existing amino-acid residue and alternative residue), be similar replacement, as basic aminoacids replaces basic aminoacids, acidic amino acid replacing acid acidic amino acid, polare Aminosaeren replacement polare Aminosaeren etc.Also can there is non-homogeneous replacement, become another kind of residue from a class residue, or relate to alpha-non-natural amino acid, as ornithine (hereinafter referred to as Z), DAB ornithine (hereinafter referred to as B), nor-leucine ornithine (hereinafter referred to as O), pyrazoleahtnine, thienylalanine, naphthylalanine and phenylglycine.
Also can use alpha-non-natural amino acid to replace.
Amino acid variant sequence can comprise the applicable introns group that can insert between any two amino-acid residues of sequence, except amino acid introns are as glycine or Beta-alanine residue, also comprises that alkyl group is as methyl, ethyl or propyl group.It should be appreciated by those skilled in the art that the variation of other form, it relates to the one or more amino-acid residues that exist with class peptide (peptoid) form.For fear of dispute, " class peptide form " is used to refer to the amino-acid residue variant of alpha-carbon substituting group group on the nitrogen-atoms of residue but not on alpha-carbon.The method of the peptide of preparation class peptide form is known in the art, as Simon RJ etc., PNAS (1992) 89 (20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13 (4), 132-134.
The nucleotide sequence that used in the present invention or coding has the polypeptide of special properties defined herein can comprise Nucleotide synthetic or that modify therein.The known many dissimilar modification to oligonucleotide in this area.These modifications comprise methylphosphonate and thiophosphatephosphorothioate main chain and/or add acridine or PL200 chain at 3 ' end and/or the 5 ' end of molecule.For purposes of the present invention, should be appreciated that and can modify nucleotide sequence as herein described by any method in this area.Can carry out described modification to strengthen activity in vivo or the life-span of nucleotide sequence.
The application with the nucleotide sequence of sequence discussed in this article or its any derivative, fragment or derivative complementation is also contained in the present invention.As infructescence and its fragment complementation, this sequence can be used as identifying the probe of similar encoding sequence etc. in other organism.
Can obtain in many ways and not 100% homology but fall into the polynucleotide of the scope of the invention of sequence of the present invention.Can obtain by for example detecting the DNA library of being prepared by a series of individualities (as the individuality from different population) other variant of sequence described herein.In addition, can obtain the homologue of other virus/bacterium or cell, particularly be found in the cell homologue in cells of mamma animals (as rat, mouse, ox and primate cell), and described homologue or its fragment are by conventionally can be optionally and the sequence hybridization shown in this paper sequence table.Can be by detecting cDNA library or the genome dna library prepared from other animal species, and detect described library to highly rigorous condition with all or part of probe of any one sequence in comprising appended sequence table in moderate and obtain described sequence.Similarly consider species homologue and the allele variant for obtaining polypeptide of the present invention or nucleotide sequence.
Also can obtain variant and strain/species homologue with degenerate pcr, described degenerate pcr is designed to use the sequence of the conserved amino acid sequence in code book invention sequence in target variant and homologue.For example can predict conserved sequence from the aminoacid sequence of multiple variant/homologues by comparison.Can use computer software known in the art to carry out sequence alignment.For example be widely used GCG Wisconsin PileUp program.
In degenerate pcr, primer used will comprise one or more degeneracys site, and the preciseness of its working conditions is by those conditions of the unique sequence primer cloned sequence lower than by for known array.
Or, also can obtain described polynucleotide by characterizing the site-directed mutagenesis of sequence.For example, in the time need to changing reticent codon sequence with optimizing codon preferences in the particular host cell of expressing polynucleotide sequence, this may be useful.May need other sequence to change, to introduce restricted polypeptide recognition site, or character or the function of the polypeptide of change polynucleotide encoding.
Can use polynucleotide of the present invention (nucleotide sequence) to prepare primer, as PCR primer, for the primer of optional amplified reaction; Probe, as used radioactivity or non-radioactive marker to use the probe that manifests marker mark by ordinary method; Maybe polynucleotide can be cloned in carrier.Described primer, probe and other fragment in length will at least 15, be preferably at least 20, as at least 25,30 or 40 Nucleotide, and it is also contained by term polynucleotide of the present invention as used herein.
Can recombinate, synthesize or prepare according to polynucleotide of the present invention (as DNA polynucleotide) and probe by the available any method of those skilled in the art.They also can be cloned by standard technique.
Conventionally, will prepare primer by synthetic method, the method comprises in the mode of every next Nucleotide progressively prepares needed nucleotide sequence.The technology that realizes this point by automatic technology is in this area, to be easy to obtain.
Conventionally use recombination method, as used PCR (polymerase chain reaction) clone technology to prepare longer polynucleotide.This comprises the pair of primers (15 to 30 Nucleotide according to appointment) of the lipid targeted sequence area flank of preparing required clone, make primer contact the mRNA or the cDNA that obtain from animal or human's cell, under the condition that can make desired zone amplification, carry out polymerase chain reaction, separate the fragment (as by purification reaction mixture on sepharose) of amplification, and reclaim the DNA of amplification.Can design introducing and make it comprise applicable Restriction Enzyme recognition site, so that can be by the DNA clone of amplification in applicable cloning vector.
Hybridization
The sequence with sequence complementation of the present invention is also contained in the present invention, or can with sequence hybridization of the present invention or with the sequence of its complementary sequence hybridization.
Term used herein " hybridization " comprises " process that nucleic acid chains is combined with complementary strand by base pairing ", and the process increasing in the technology of polymerase chain reaction (PCR).
The application of described nucleotide sequence is also contained in the present invention, described nucleotide sequence can with the sequence hybridization of subject nucleotide sequence discussed in this article or its any derivative, fragment or derivative complementation.
The present invention also contain can with the complementary sequence of the sequence of nucleotide sequence hybridization discussed in this article.
Hybridization conditions is the melting temperature (Tm) (Tm) in conjunction with mixture based on Nucleotide, as Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.152, Academic Press, San Diego CA) in institute instruct, and given " preciseness " of the definition below explained.
The highest preciseness appears at about Tm-5 DEG C (lower 5 DEG C than the Tm of probe) conventionally; High preciseness appears at lower approximately 5 DEG C to 10 DEG C than Tm; Medium preciseness appears at lower approximately 10 DEG C to 20 DEG C than Tm; And low preciseness appears at lower approximately 20 DEG C to 25 DEG C than Tm.As understood by one of ordinary skill in the art, the hybridization of the highest preciseness can for the identification of or detect identical nucleotide sequence, and the hybridization of medium (or low) preciseness can for the identification of or detect similar or relevant polynucleotide sequence.
Preferably, the present invention is contained and can be under the medium preciseness condition of high preciseness conditioned disjunction be had the complementary sequence of the sequence of nucleotide sequence hybridization of the polypeptide of special properties as defined herein with coding.
More preferably, the complementary sequence that the sequence of hybridizing can occur at the lower nucleotide sequence that has a polypeptide of special properties as defined herein with coding of high preciseness condition (as 65 DEG C and 0.1xSSC{1xSSC=0.15M NaCl, 0.015M Trisodium Citrate, pH 7.0}) is contained in the present invention.
The invention still further relates to the nucleotide sequence that can hybridize with the nucleotide sequence of discussing (comprising the complementary sequence of those sequences of discussing herein) herein.
The invention still further relates to the complementary nucleotide sequence of the sequence that can hybridize with the nucleotide sequence of discussing (comprising the complementary sequence of those sequences of discussing herein) herein.
Scope of the present invention be also included in medium under the highest preciseness condition can with the polynucleotide sequence of nucleotide sequence hybridization discussed in this article.
Aspect preferred, the present invention be encompassed under preciseness condition (as 50 DEG C and 0.2xSSC) can with the nucleotide sequence of nucleotide sequence discussed in this article or its complementary sequence hybridization.
Aspect preferred, the present invention be encompassed under high preciseness condition (as 65 DEG C and 0.1xSSC) can with the nucleotide sequence of nucleotide sequence discussed in this article or its complementary sequence hybridization.
The expression of polypeptide
Can the replicating vector of restructuring will be introduced for nucleotide sequence of the present invention or there is the polypeptide of special properties as herein defined for encoding.Carrier can be for copying and express nucleotide sequence with polypeptide form in compatible host cell and/or from compatible host cell.Can control expression in interior control sequence with comprising promotor/enhanser and other expression regulation signal.Can use procaryotic promotor and in eukaryotic cell, have the promotor of function.Can using-system special or stimulate specificity promoter.Also can use the chimeric promoters comprising from the sequential element of above-mentioned two or more different promoters.
According to sequence used and/or carrier, the polypeptide being produced by expression nucleotide sequence by host's reconstitution cell can be secreted, or be comprised in cell.Encoding sequence can have signal sequence through design, and this signal sequence can instruct the encoding sequence secretion of material by specific prokaryotic organism or eukaryotic cell membrane.
Construct
Term " construct ", with term as " binding substances (or connector) ", " box (cassette) " and " heterozygote (hybrid) " synonym, it comprises the nucleotide sequence according to the coding of the present invention's use with the polypeptide of special properties defined herein, and it is connected with promotor directly or indirectly.The example indirectly connecting be between promotor and nucleotide sequence of the present invention, provide applicable spacer as intron sequences, as Sh1 intron or ADH intron.Term " fusion " is also that so it comprises direct or indirect connection in this article.In some cases, the natural combination of the wild type gene promotor that the nucleotide sequence of encoding said proteins is connected conventionally with it does not contained in these terms, and now the two all in its natural surroundings.
Described construct even can comprise or express the marker that allows Select gene construct.
For some application, preferably construct at least comprises nucleotide sequence of the present invention, or the nucleotide sequence that has the polypeptide of special properties as defined herein and be operationally connected with promotor of encoding.
Organism
The term " organism " relevant with the present invention comprise any comprise nucleotide sequence of the present invention or coding have special properties as defined herein polypeptide nucleotide sequence and/or by the organism of the product of its acquisition.
The term " transgenic organism " relevant with the present invention comprise any comprise coding have special properties as defined herein polypeptide nucleotide sequence and/or by the organism of the product of its acquisition, and/or the nucleotides sequence that wherein promotor can allow coding to have the polypeptide of special properties is as defined herein listed in described biological expression in vivo.Preferred nucleotide sequence is introduced in the genome of organism.
Term " transgenic organism " is not encompassed in self natural surroundings and is subject to simultaneously it and be in together the natural nucleotide encoding sequence of the natural promoter control in self natural surroundings.
Therefore, transgenic organism of the present invention comprises the organism that comprises following any or combination: coding has the nucleotide sequence, construct defined herein, carrier defined herein, plasmid defined herein of the polypeptide of special properties as defined herein, fixed cell or its product herein.For example, described transgenic organism can also comprise the nucleotide sequence that coding has the polypeptide of special properties as defined herein and is subject to promotor control, and wherein said promotor is not natural being connected with acyltransferase encoding gene.
The conversion of host cell/organism
Being converted into of prokaryotic organism body host is well known in the art, for example, referring to (Molecular Cloning:A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press) such as Sambrook.If use prokaryotic organism body host, before conversion, need by carrying out suitably modified nucleotide sequence as removed intron.
The whole bag of tricks that known bacillus species transforms.
Secretion
Conventionally, expect that polypeptide is secreted into substratum from expressive host, can more easily reclaim thus enzyme.According to the present invention, can select to secrete leader sequence by the expressive host based on required.In the present invention, also can use hybridization signal sequence.
The representative instance of the secretion leader sequence not being connected with the nucleotide sequence of natural coding acyltransferase comes from amylomycin glucuroide (AG) gene (glaA-18 amino acid and two kinds of forms of 24 amino acid for those; as from Eurotium), the sequence of a-factor gene (yeast, as yeast belong (saccharomyces), kluyveromyces (Kluyveromyces) and debaryomyces hansenii (Hansenula)) or alpha-amylase gene (genus bacillus).
Detect
Known in the art multiple for detection of with measure aminoacid sequence express method.Example comprises the cell sorting (FACS) of Enzyme Linked Immunoadsorbent Assay (ELISA), radioimmunoassay (RIA) and fluorescent activation.
The known multiple marker of those skilled in the art and coupling technology, and they can be used in various nucleic acid and amino acid analysis.
Many companies provide business test kit and method for these steps as Pharmacia Biotech (Piscataway, NJ), Promega (Madison, WI) and US Biochemical Corp (Cleveland, OH).
Applicable reporter molecules or marker comprise those radionuclides, enzyme, fluorescent agent, chemoluminescence agent or developer, and substrate, cofactor, inhibitor, magnetic particle etc.Instruct the patent of these markers application to comprise US-A-3,817,837, US-A-3,850,752, US-A-3,939,350, US-A-3,996,345, US-A-4,277,437, US-A-4,275,149 and US-A-4,366,241.
In addition, can, as US-A-4, shown in 816,567, prepare recombination immunoglobulin.
Fusion rotein
In the method for the invention, acyltransferase can be used as fusion rotein to be prepared, as to contribute to its extraction and purifying.The example of fusion rotein mating partner (partners) comprises glutathione-S-transferase (GST), 6xHis, GAL4 (DNA combination and/or transcriptional activation domain) and beta-galactosidase enzymes.Between fusion rotein mating partner and target protein sequence, also can comprise proteolysis cleavage site so that remove fusion rotein sequence.Preferably, fusion rotein will can not hinder the activity of protein sequence.
Curr.Opin.Biotechnol. (1995) 6 (5): 501-6 summarizes the gene fusion expression system in intestinal bacteria.
In another embodiment of the present invention, the aminoacid sequence with the polypeptide of special properties as defined herein can be connected with encoding fusion protein with non-natural sequence.For example, the peptide library selection carrying out for the reagent that can affect essence activity for obtaining, such block polymer of encoding may be useful, i.e. the non-natural epi-position that its expression can be purchased antibody to be identified.
Hereinafter with reference to drawings and Examples, the present invention is only described by way of example.
Brief description of the drawings
Fig. 1 has shown the aminoacid sequence of the ripe acyltransferase mutant of aeromonas salmonicida (GCAT), and this mutant has Asn80Asp sudden change (note, the 80th amino acids refers in mature sequence) (SEQ ID 16);
Fig. 2 has shown from the aminoacid sequence of the acyltransferase of Aeromonas hydrophila (ATCC#7965) (SEQ ID No.1);
Fig. 3 has shown from the pfam00657 consensus sequence of the 6th edition database (SEQ ID No.2);
Fig. 4 has shown aminoacid sequence (SEQ ID the No.3) (P10480 obtaining from organism Aeromonas hydrophila; GI:121051);
Fig. 5 has shown aminoacid sequence (SEQ ID the No.4) (AAG098404 obtaining from organism aeromonas salmonicida; GI:9964017);
Fig. 6 has shown the aminoacid sequence (SEQ ID No.5) (Genbank accession number NP_631558) obtaining from organism streptomyces coelicolor A3 (2);
Fig. 7 has shown the aminoacid sequence (SEQ ID No.6) (Genbank accession number CAC42140) obtaining from organism streptomyces coelicolor A3 (2);
Fig. 8 has shown the aminoacid sequence (SEQ ID No.7) (Genbank accession number P41734) obtaining from organism yeast saccharomyces cerevisiae;
Fig. 9 has shown the aminoacid sequence (SEQ ID No.8) (Genbank accession number AL646052) obtaining from organism Lei Er Bordetella;
Figure 10 has shown SEQ ID No.9.Scoe1 is the conservative putative protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB39707.1GI:4539178;
Figure 11 has shown the amino acid as shown in SEQ ID No.10.Scoe2 is the conservative putative protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAC01477.1GI:9716139;
Figure 12 has shown aminoacid sequence (SEQ ID No.11).Scoe3 is the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB88833.1GI:7635996;
Figure 13 has shown aminoacid sequence (SEQ ID No.12).Scoe4 is the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB89450.1GI:7672261;
Figure 14 has shown aminoacid sequence (SEQ ID No.13).Scoe5 is the known lipoprotein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB62724.1GI:6562793;
Figure 15 has shown aminoacid sequence (SEQ ID No.14).Srim1 is the GDSL-lipase [streptomyces rimosus] of NCBI albumen accession number AAK84028.1GI:15082088;
Figure 16 has shown the aminoacid sequence (SEQ ID No.15) that kills salmon subspecies (Aeromonas salmonicida subsp.Salmonicida) acyltransferase (ATCC#14174) from aeromonas salmonicida;
Figure 17 has shown SEQ ID No.19.Scoe1 is the conservative putative protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB39707.1GI:4539178;
Figure 18 has shown for the aminoacid sequence of the fusion constructs of Aeromonas hydrophila acyltransferase Mutagenesis (SEQ ID No.25).The amino acid of underscore is zytase signal peptide;
Figure 19 has shown from the peptide sequence of the acyltransferase of streptomyces (SEQ ID No.26);
Figure 20 has shown the peptide sequence (SEQ ID No.27) from the acyltransferase of happiness hot tearing spore Pseudomonas;
Figure 21 has shown the peptide sequence (SEQ ID No.28) from the acyltransferase of happiness hot tearing spore Pseudomonas;
Figure 22 has shown from the peptide sequence of Corynebacterium efficiens GDSx 300 amino acid whose acyltransferases (SEQ ID No.29);
Figure 23 has shown from the polypeptide of Novosphingobium aromaticivorans GDSx 284 amino acid whose acyltransferases (SEQ ID No.30);
Figure 24 has shown from the polypeptide of streptomyces coelicolor GDSx 269 amino acid whose acyltransferases (SEQ ID No.31);
Figure 25 has shown from the polypeptide of streptomyces griseus/GDSx 269 amino acid whose acyltransferases (SEQ ID No.32);
Figure 26 has shown from the polypeptide of the acyltransferase of streptomyces (SEQ ID No.33);
Figure 27 has shown aminoacid sequence (SEQ ID the No.34) (P10480 obtaining from organism Aeromonas hydrophila; GI:121051) (note, it is mature sequence);
Figure 28 has shown the aminoacid sequence (SEQ ID 35) (note, it is mature sequence) of the ripe acyltransferase mutant of aeromonas salmonicida (GCAT);
Figure 29 has shown from the nucleotide sequence of Streptomyces thermosacchari (SEQ ID No.36);
Figure 30 has shown from the nucleotide sequence of Streptomyces thermosacchari (SEQ ID No.37);
Figure 31 has shown from brown happiness hot tearing spore bacterium/GDSx 548 amino acid whose aminoacid sequences (SEQ ID No.38);
Figure 32 has shown the nucleotide sequence (SEQ ID No.39) from brown happiness hot tearing spore bacterium;
Figure 33 has shown the aminoacid sequence (SEQ ID No.40) from brown happiness hot tearing spore bacterium/GDSx;
Figure 34 has shown from the amino acid whose aminoacid sequence of Corynebacterium efficiens/GDSx 300 (SEQ ID No.41);
Figure 35 has shown from the nucleotide sequence of Corynebacterium efficiens (SEQ ID No.42);
Figure 36 has shown from the amino acid whose aminoacid sequence of streptomyces coelicolor/GDSx 268 (SEQ ID No.43);
Figure 37 has shown the nucleotide sequence (SEQ ID No.44) from streptomyces coelicolor;
Figure 38 has shown the aminoacid sequence (SEQ ID No.45) from streptomyces griseus;
Figure 39 has shown the nucleotide sequence (SEQ ID No.46) from streptomyces griseus;
Figure 40 has shown the aminoacid sequence (SEQ ID No.47) from brown happiness hot tearing spore bacterium/GDSx;
Figure 41 has shown the nucleotide sequence (SEQ ID No.48) from brown happiness hot tearing spore bacterium/GDSx;
Figure 42 has shown L131 and the comparison from the homologue of streptomyces griseus and brown happiness hot tearing spore bacterium, and GDSx motif (being GDSY in L131 and streptomyces griseus and brown happiness hot tearing spore bacterium), GANDY frame (it is GGNDA or GGNDL) and the partly conservative property of (being considered to conservative catalysis Histidine) of HPT have been described.These three conservative parts have outstanding mark;
Figure 43 has shown from the aminoacid sequence of Candida parapsilosis acyltransferase (SEQ ID No.17);
Figure 44 has shown from the aminoacid sequence of Candida parapsilosis acyltransferase (SEQ ID No.18);
Figure 45 has shown the band shape demonstration figure of the 1IVN.PDB crystalline structure in avtive spot with glycerine.This figure uses Deep View Swiss-PDB viewer to make.
Figure 46 has shown the side-view (use Deep View Swiss-PDB viewer) of the 1IVN.PDB crystalline structure in avtive spot with glycerine, and black part is divided at avtive spot glycerine interior residue.
Figure 47 has shown the vertical view (use Deep View Swiss-PDB viewer) of the 1IVN.PDB crystalline structure in avtive spot with glycerine, and black part is divided at avtive spot glycerine interior residue.
Figure 48 has shown comparison 1;
Figure 49 has shown comparison 2;
Figure 50 and 51 has shown compare (P10480 is Aeromonas hydrophila enzyme database sequence) of 1IVN and P10480, and this comparison obtains and is used in model construction process from PFAM database; With
Figure 52 has shown comparison, and wherein P10480 is Aeromonas hydrophila database sequence.This sequence is selected for model construction and site.Note having drawn out complete albumen (SEQ ID No.25), maturation protein (being equivalent to SEQ ID No.34) originates in the 19th residue.A.sal is the GDSX lipase (SEQ ID No.4) of aeromonas salmonicida, the GDSX lipase (SEQ ID No.34) that A.hyd is Aeromonas hydrophila.Difference position between listed sequence represents with * in consensus sequence.
Figure 53 has shown the gene construct being used in embodiment 1;
Figure 54 has shown the codon optimized gene construct (no.052907) being used in embodiment 1; With
Figure 55 has shown the sequence of the XhoI inset that comprises LAT-KLM3 ' precursor-gene, and underscore place is-35 and-10 frames;
Figure 56 has shown on tributyrin agar in 37 DEG C of growths the BML780-KLM3 ' CAP50 (comprising the bacterium colony above SEQ ID No.16-) after 48 hours and BML780 (empty host strain-below bacterium colony).
Figure 57 has shown the nucleotide sequence (SEQ ID No.49) that comprises signal sequence (front LAT-is from the 1st to the 87th) from aeromonas salmonicida;
Figure 58 has shown the nucleotide sequence (SEQ ID No.50) of the coding acyltransferase of the present invention obtaining from organism Aeromonas hydrophila;
Figure 59 has shown the nucleotide sequence (SEQ ID No.50) of the coding acyltransferase of the present invention obtaining from organism aeromonas salmonicida;
Figure 60 has shown the nucleotide sequence (SEQ ID No.52) (Genbank accession number NC_003888.1:8327480..8328367) of the coding acyltransferase of the present invention obtaining from organism streptomyces coelicolor A3 (2);
Figure 61 has shown the nucleotide sequence (SEQ ID No.53) (Genbank accession number AL939131.1:265480..266367) of the coding acyltransferase of the present invention obtaining from organism streptomyces coelicolor A3 (2);
Figure 62 has shown the nucleotide sequence (SEQ ID No.54) (Genbank accession number Z75034) of the coding acyltransferase of the present invention obtaining from organism streptomyces griseus;
Figure 63 has shown the nucleotide sequence (SEQ ID No.55) of the coding acyltransferase of the present invention obtaining from organism Lei Er Bordetella;
Figure 64 has shown the nucleotide sequence as shown in SEQ ID No.56, the conservative putative protein [streptomyces coelicolor A3 (2)] of its coding NCBI albumen accession number CAB39707.1GI:4539178;
Figure 65 has shown the nucleotide sequence as shown in SEQ ID No.57, its Scoe2 that encodes, the conservative putative protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAC01477.1GI:9716139;
Figure 66 has shown the nucleotide sequence as shown in SEQ ID No.58, its Scoe3 that encodes, the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB88833.1GI:7635996;
Figure 67 has shown the nucleotide sequence as shown in SEQ ID No.59, its Scoe4 that encodes, the known secreted protein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB89450.1GI:7672261;
Figure 68 has shown the nucleotide sequence as shown in SEQ ID No.60, its Scoe5 that encodes, the known lipoprotein [streptomyces coelicolor A3 (2)] of NCBI albumen accession number CAB62724.1GI:6562793;
Figure 69 has shown the nucleotide sequence as shown in SEQ ID No.61, its Srim1 that encodes, NCBI albumen accession number AAK84028.1GI:15082088GDSL-lipase [streptomyces rimosus];
Figure 70 has shown from the nucleotide sequence of the coding acyltransferase of Aeromonas hydrophila (ATCC#7965) (SEQ ID No.62);
Figure 71 has shown the nucleotide sequence (SEQ ID No.63) that kills the coding acyltransferase of salmon subspecies (ATCC#14174) from aeromonas salmonicida; With
Figure 72 has shown the nucleotide sequence (SEQ ID No.24) that contains the enzyme of zytase signal peptide from the encoded packets of Aeromonas hydrophila.
Embodiment 1
The expression of KLM3 ' in Bacillus licheniformis
Coding acyltransferase (SEQ.ID No.16; hereinafter referred to as KLM3 ') nucleotide sequence (SEQ ID No.49) in Bacillus licheniformis, be expressed as fusion rotein, described fusion rotein has the signal peptide (referring to Figure 53 and 54) of bacillus licheniformis alpha-amylase (LAT).In order to optimize the expression in genus bacillus, order codon optimized gene construct (no.052907) from Geneart (Geneart AG, Regensburg, Germany).
Construct no.052907 comprises the incomplete LAT promotor (only-10 sequence) that is positioned at before LAT-KLM3 ' precursor-gene and the LAT transcript (Tlat) (participating in Figure 53 and 55) in LAT-KLM3 ' precursor-gene downstream.In order to build the XhoI fragment that comprises 5 ' end flank and there is complete LAT promotor, 3 ' end flank and have the LAT-KLM3 ' precursor-gene of LAT terminator, Plat5XhoI_FW and EBS2XhoI_RV are primer, and gene construct 052907 carries out PCR (polymerase chain reaction) amplification as template.
Plat5XhoI_FW：
ccccg ctcgaggcttttcttttggaagaaaatatagggaaaatggtacttgttaaaaattcggaatatttatacaatatcatatgtttcacattgaaagggg
EBS2XhoI_RV：tggaat ctcgaggttttatcctttaccttgtctcc
On thermal cycler, use Phusion high frequency high fidelity archaeal dna polymerase (Finnzymes OY, Espoo, Finland) to carry out PCR according to manufacturer's specification sheets (55 DEG C of annealing temperatures).
According to manufacturer's specification sheets (Invitrogen, Carlsbad, Calif.USA), Restriction Enzyme XhoI digestion for gained PCR fragment, and use T4DNA ligase enzyme to be connected in the pICatH that XhoI digested.
As described in U.S. Patent application US20020182734 (international publication WO 02/14490), connection mixture is transformed in bacillus subtilis strain SC6.1.Determine the sequence (BaseClear of the XhoI inset that comprises LAT-KLM3 ' precursor-gene by DNA sequencing, Leiden, The Netherlands), and by one of them (ori1) (Figure 53) of correct plasmid clone called after pICatH-KLM3 '.At the temperature (37 DEG C) of license, pICatH-KLM3 ' (ori1) is transformed in lichem bacillus strain BML780 (derivative of BRA7 and BML612, referring to WO2005111203).
Select the transformant of a neomycin resistance (neoR) and chlorampenicol resistant (CmR) and by its called after BML780 (plCatH-KLM3 ' (ori1)).By under non-permissive temperature (50 DEG C), cultivate bacterial strain in the substratum that contains 5 μ g/ml paraxin, make plasmid integration in BML780 (plCatH-KLM3 ' (ori1)) in the genomic catH of Bacillus licheniformis district.Select a CmR resistance clone called after BML780-plCatH-KLM3 ' (ori1).Again in permissive temperature, there is no to cultivate BML780-plCatH-KLM3 ' in antibiotic situation and (ori1) count generation, so that carrier sequence ring goes out (loop-out), and select subsequently the CmR of a Liu Suanyan NEOMYCIN SULPHATE sensitivity (neoS) to clone.In this clone, the plCatH carrier sequence cut (comprising neomycin resistance gene) on karyomit(e), and be only left catH-LATKLM3 ' box.Subsequently, by making in substratum that bacterial strain increases at chloramphenicol concentration/on the catH-LATKLM3 ' box that increases on karyomit(e) of growth.After amplification number wheel, select a clone (anti-50 μ g/ml paraxin), and by its called after BML780-KLM3 ' CAP50.In order to determine that KLM3 ' expresses, and cultivates 48 hours BML780-KLM3 ' CAP50 and BML780 (empty host strain) on Heart Infusion (Bacto) the agar culture plate that is added with 1% tributyrin at 37 DEG C.Region (instruction acyltransferase activity) is in BML780-KLM3 ' CAP50 periphery of bacterial colonies but not high-visible around host strain BML780 (referring to Figure 56) clearly.This result show KLM3 ' in lichem bacillus strain BML780-KLM3 ' CAP50 by a large amount of expression, and these KLM3 ' molecules have function.
Comparative example 1
Vector construction body
Described plasmid construction body is pCS32new N80D; it is the pCCmini derivative (KLM3 ') that carries the 80th amino acids and be replaced to by Asn the encoding sequence of the natural aeromonas salmonicida glycerophosphate-cholesterol acyltransferase of the mature form of Asp, and it is under the control of p32 promotor and have a CGTase signal sequence.
Be subtilis OS21 Δ aprE bacterial strain for the host strain of expressing.
To carry out calculation expression level with the transferase active that the percentage ratio of esterified cholesterol represents, at PC (T pC) in the reaction that is acceptor molecule of donor and cholesterol, calculate from the difference of free cholesterol in cholesterol and enzyme sample according to reference sample middle reaches.
Culture condition
Single colony inoculation is being added with to LB broth culture (casease digestion promoting thing, the 10g/l of 5ml of 50mg/l kantlex; Low sodium yeast extract, 5g/l; Sodium-chlor, 5g/l; Inertia sheet auxiliary agent (Inert tableting aids), 2g/l) in, and by LB broth culture under 205rpm, 30 DEG C hatch 6 hours.This culture of 0.7ml is inoculated into the 50ml SAS substratum (K2HPO4, the 10g/l that are added with 50mg/l kantlex and high malt sugar starch hydrolyzates solution (60g/l); MOPS (3-morpholine propane sulfonic acid), 40g/l; Sodium-chlor, 5g/l; Defoamer (Sin 260), 5/l; Defatted soy flour, 20g/l; Biospringer 106 (100%dw YE), 20g/l) in.Under 30 DEG C and 180rmp, continue to hatch 40 hours, within centrifugal 30 minutes, take separation and Culture thing supernatant liquor with 19000rpm subsequently.Supernatant liquor is transferred to clean tube and be directly used in transferase active and measure.
The preparation of substrate and enzymatic reaction
Weigh PC (Avanti Polar Lipids#441601) and cholesterol (Sigma C8503) with the ratios of 9: 1, be dissolved in chloroform, and be evaporated to dry.
By 3%PC and cholesterol (9: 1) are distributed in 50mM Hepes damping fluid (pH 7) and prepare substrate.
0.250ml substrate solution is transferred in the 3ml glass test tube that is threaded lid.Add 0.025ml culture supernatants and mixture is hatched 2 hours at 40 DEG C.Water replaces enzyme to prepare reference sample.Reaction mixture is heated in boiling water bath and within 10 minutes, stop enzyme reaction.Carry out adding in cholesterol analysis of experiments forward reaction mixture the ethanol of 2ml 99%.
Cholesterol test
100 μ l substrates are hatched 5 minutes at 37 DEG C, add subsequently 5 μ l enzyme reaction samples and mix, 0.1M Tris-HCl (pH 6.6) and 0.5%Triton X-100 (Sigma X-100) solution of wherein said substrate for containing 1.4U/ml rCO (SERVA Electrophoresis GmbH cat.No 17109), 0.4mg/ml ABTS (SigmaA-1888), 6U/ml peroxidase (Sigma6782).Reaction mixture is continued to hatch 5 minutes and measures OD 405.According to the content of the analytical calculation cholesterol to cholesterol standardized solution, described cholesterol standardized solution is the 99%EtOH solution that contains 0.4mg/ml, 0.3mg/ml, 0.20mg/ml, 0.1mg/ml, 0.05mg/ml and 0mg/ml cholesterol.
Result
This table has shown the mean value of 8 single expression cultures
Whole publications that above specification sheets is mentioned are all incorporated to herein by reference.The various amendments of the method for the invention and system and change are all apparent to one skilled in the art, do not depart from the scope of the present invention and spirit.Although the present invention is described according to concrete preferred embodiment, should be appreciated that advocated invention is not limited only to described specific embodiments.In fact, for biological chemistry and biotechnology or those skilled in the relevant art, be all apparent for the various amendments of implementing described pattern of the present invention, all should fall into the scope of the claims in the present invention book.

Claims (5)

1. for the preparation of the method for acyltransferase, comprise the following steps:
(i) genus bacillus (Bacillus) cell is provided, and wherein said bacillus cell is Bacillus licheniformis (Bacillus licheniformis);
(ii) transform described bacillus cell by the heterologous nucleotide sequence of the coding acyltransferase shown in SEQ ID No.49, wherein said bacillus cell is Bacillus licheniformis cell; With
(iii) under the control of promoter sequence, at described cells acyltransferase.
2. the method for claim 1, wherein described promoter sequence is not natural connection with the nucleotide sequence of described coding acyltransferase.
3. method as claimed in claim 1 or 2, wherein, described method also comprises the step of acyltransferase described in separation/recovery.
4. method as claimed in claim 1 or 2, wherein, described promoter sequence and host cell are homologies.
5. method as claimed in claim 1 or 2, wherein, described promoter sequence is selected from the group of following composition: α-amylase promoter sequence, protease promoter sequence, subtilisin promoter sequence, glutamate specific protease promoter sequence and levansucrase promoter sequence.
CN201210031434.9A 2007-01-25 2007-01-25 Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase Expired - Fee Related CN102559627B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210031434.9A CN102559627B (en) 2007-01-25 2007-01-25 Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210031434.9A CN102559627B (en) 2007-01-25 2007-01-25 Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN200780050429XA Division CN101652474B (en) 2007-01-25 2007-01-25 Production of a lipid acyltransferase from transformed bacillus licheniformis cells

Publications (2)

Publication Number Publication Date
CN102559627A CN102559627A (en) 2012-07-11
CN102559627B true CN102559627B (en) 2014-09-10

Family

ID=46406236

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210031434.9A Expired - Fee Related CN102559627B (en) 2007-01-25 2007-01-25 Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase

Country Status (1)

Country Link
CN (1) CN102559627B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005111203A2 (en) * 2004-04-08 2005-11-24 Genencor International, Inc. MUTANT α ΑMYLASES
WO2006008508A1 (en) * 2004-07-16 2006-01-26 Danisco A/S Enzymatic oil-degumming method
CN1898391A (en) * 2003-12-24 2007-01-17 丹尼斯科公司 Enzymatic treatment of oils

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1898391A (en) * 2003-12-24 2007-01-17 丹尼斯科公司 Enzymatic treatment of oils
WO2005111203A2 (en) * 2004-04-08 2005-11-24 Genencor International, Inc. MUTANT α ΑMYLASES
WO2006008508A1 (en) * 2004-07-16 2006-01-26 Danisco A/S Enzymatic oil-degumming method

Also Published As

Publication number Publication date
CN102559627A (en) 2012-07-11

Similar Documents

Publication Publication Date Title
CN101652474B (en) Production of a lipid acyltransferase from transformed bacillus licheniformis cells
ES2449474T3 (en) Production of a lipid acyltransferase from Bacillus licheniformis cells
CN101978037B (en) Process for edible oil refining using a lipid acyltransferase
JP5697294B2 (en) Glycolipid acyltransferase mutant and method for producing the same
AU2005263954B2 (en) Enzymatic oil-degumming method
US7906307B2 (en) Variant lipid acyltransferases and methods of making
US8652809B2 (en) Method for producing ultra-heat treatment milk
JP2007516717A6 (en) protein
CN102365031A (en) Method for producing phytosterol / phytostanol phospholipid esters
AU2010320548B2 (en) Method
CN102559627B (en) Method for utilizing Bacillus licheniformis transformed cell to prepare fatty acyl transferase
CN103275944B (en) Protein

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C53 Correction of patent for invention or patent application
CB02 Change of applicant information

Address after: Copenhagen

Applicant after: Danisco

Address before: Copenhagen

Applicant before: Danisco A/S

COR Change of bibliographic data

Free format text: CORRECT: APPLICANT; FROM: DANISCO A/S TO: DUPONT NUTRITION BIOSCIENCES APS

C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140910

Termination date: 20170125

CF01 Termination of patent right due to non-payment of annual fee