CN102558336A - PRR11 gene and coded protein and application thereof - Google Patents

PRR11 gene and coded protein and application thereof Download PDF

Info

Publication number
CN102558336A
CN102558336A CN2012100114554A CN201210011455A CN102558336A CN 102558336 A CN102558336 A CN 102558336A CN 2012100114554 A CN2012100114554 A CN 2012100114554A CN 201210011455 A CN201210011455 A CN 201210011455A CN 102558336 A CN102558336 A CN 102558336A
Authority
CN
China
Prior art keywords
sequence
gene
prr11
cell
albumen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2012100114554A
Other languages
Chinese (zh)
Other versions
CN102558336B (en
Inventor
卜友泉
吉颖
谢濛宇
兰欢
杨正梅
宋方洲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chongqing Medical University
Original Assignee
Chongqing Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chongqing Medical University filed Critical Chongqing Medical University
Priority to CN201210011455.4A priority Critical patent/CN102558336B/en
Publication of CN102558336A publication Critical patent/CN102558336A/en
Application granted granted Critical
Publication of CN102558336B publication Critical patent/CN102558336B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a PRR11 (Proline-rich protein 11, PRR11) gene, a coded protein and the application of the gene and the protein in diagnosis and treatment of tumor.

Description

PRR11 gene and encoded protein thereof and application
Technical field
The present invention relates to PRR11 (Proline-rich protein11, PRR11) gene and encoded protein thereof, and said gene and the application of albumen in diagnosing tumor and treatment, the especially application in pulmonary cancer diagnosis and treatment.
Background technology
In the world, malignant tumour becomes the main killer who threatens the human life healthy.Chinese Development of Health Service situation statistical communique according to Ministry of Health's issue in 2006 has shown that in China, since the nineties in last century, malignant tumour is in the first place of city resident's the cause of death always; In urban residents' cause of death also in the position that leaps to the first in 2006.Therefore, carry out the correlative study of malignant tumour, develop basic theory and applied research and all have important theory and realistic meaning for sickness rate mortality ratio of the mechanism of illustrating tumor development, treatment and prevention of tumour, reduction malignant tumour etc.
Malignant tumour be the extremely complicated biological phenomena that a multifactor effect, polygene are participated in, just finally formed through a plurality of stages, wherein the expression of oncogene and cancer suppressor gene imbalance and then the cell that brings out are grown and out of controlly in the incidence and development of tumour, are played crucial effects.At present, still have a large amount of new tumor-related genes to remain to be discovered, illustrating of its function not only directly helped the illustrating of tumour mechanism, and possibly be used for the exploitation of novel tumor diagnostic method, antitumor drug as effective biological targets.
PRR11 (Proline-rich protein11; PRR11) gene be our laboratory recently the malignant tumour relative new gene excavate with screening study in a new tumor-related gene finding, our laboratory takes the lead in carrying out correlative studys such as biological function and the expression and regulation mechanism of this gene at home and abroad.Biological function about this gene; Our preliminary study result shows; This gene is participated in regulate several biological processes such as cell proliferation, cell cycle and cell carcinogenesis; Especially the incidence and development process that takes place in lung cancer plays a significant role, and in the diagnosis of tumour especially lung cancer and treatment, has significant application value.
Summary of the invention
The present invention has found a kind of gene of participating in growth and proliferation of cell and cell cycle regulating; Cloned its full length cDNA sequence, and found, compared with related normal tissue; No matter this gene all significantly raises at mRNA and protein level expression level in kinds of tumors tissues such as lung cancer; Suppress growing multiplication that this expression of gene can significantly suppress tumour cell and become the knurl ability,, accomplished the present invention based on above discovery.
An object of the present invention is to provide the albumen of participating in growth of tumour cell, propagation and cell cycle regulating; This albumen has the aminoacid sequence shown in the sequence 2 in the sequence table, the aminoacid sequence that perhaps obtains through one or more amino acid whose disappearance, replacement or increase in the said aminoacid sequence.
Another object of the present invention has provided the above-mentioned proteic gene of coding, it be have the base sequence shown in the sequence 1 DNA or with the DNA of said DNA hybridize under stringent condition.
Another purpose of the present invention provides to above-mentioned proteic antibody, the specific antibody that it is to use above-mentioned albumen to produce as immunogen.It can be mono-clonal or polyclonal antibody.
A further object of the present invention provides and detects above-mentioned proteic test kit, and it contains above-mentioned specific antibody, can carry out antigen-antibody reaction, is used to detect have the albumen shown in the sequence 2.
Also have, another object of the present invention provides the diagnostic kit that is used to detect the nucleotide sequence shown in the sequence 1, it contain with nucleotide sequence 1 in partial nucleotide sequence complementary nucleotide sequence.
In addition, the present invention provides siRNA or the antisense oligonucleotide to the nucleotide sequence shown in the sequence 1, it contain with nucleotide sequence 1 in partial nucleotide sequence complementary nucleotide sequence.
The present invention also provides the application in the medicine of preparation treatment tumour of said gene, above-mentioned albumen or antibody.
The present invention also provides the application in pulmonary cancer diagnosis and treatment of said gene, above-mentioned albumen or antibody.
Description of drawings
Fig. 1 be the PRR11 gene the kinds of tumors tissue with in the express spectra of corresponding normal lung tissue
Fig. 2 is the express spectra of PRR11 gene in cancerous lung tissue and corresponding normal lung tissue
Fig. 3 is PRR11 gene expression dose and stages of lung cancer
Fig. 4 is PRR11 gene expression dose and lung cancer differentiation degree
Fig. 5 is the express spectra of PRR11 albumen in cancerous lung tissue and corresponding normal lung tissue
Fig. 6 is for adopting the inhibition effect of RNAi technology to PRR11 genetic expression
Fig. 7 expresses the influence of back to the lung carcinoma cell growing multiplication for suppressing PRR11
Fig. 8 expresses the back forms ability to the lung carcinoma cell soft-agar cloning influence for suppressing PRR11
Fig. 9 expresses the back to the lung cancer growth of nude mice transplantation tumor for suppressing PRR11
Embodiment
(Proline-rich protein11, PRR11) gene is the new tumor-related gene that our laboratory is found in excavation of malignant tumour relative new gene and screening study recently to the PRR11 that the present invention relates to.On the basis of est sequence splicing; (rapid amplification of cDNA ends RACE) has cloned the full length cDNA sequence of this gene, finds that this gene has a plurality of different spliceosomes on the mRNA level to utilize the terminal rapid amplifying technology of cDNA; Wherein the sequence total length of long mRNA spliceosome is 2408bp; (open reading frame ORF) is 1083bp to its ORFs, 360 amino acid of encoding.The sequence of the longer mRNA spliceosome of PRR11 gene is shown in sequence 1.The aminoacid sequence of proteins encoded is shown in sequence 2.
Bioinformatic analysis shows that the PRR11 assignment of genes gene mapping contains 10 exons in human chromosome 17q23.Proteins encoded contains 360 amino-acid residues, and pI is about 10.0.Protein structure prediction analysis revealed, PRR11 gene coded protein contain a nuclear localization signal sequence, two proline rich districts and a Zinc finger domain.
The human normal tissue expression pattern analysis shows that the PRR11 gene all has expression in multiple human normal tissue, and wherein expression level is the highest in ovary and parathyroid tissue, and expression level is minimum in Skelettmuskel and heart tissue.The expression of tumor tissue spectrum analysis shows: compare with related normal tissue, the PRR11 gene is expressed in kinds of tumors tissues such as lung cancer, colorectal carcinoma significantly and is raise, and sees Fig. 1.
Adopt quantifying PCR method to analyze the expression level of PRR11 gene in 40 routine cancerous lung tissues and 8 routine corresponding normal lung tissues, further conclusive evidence: compare with corresponding normal lung tissue, PRR11mRNA expression level in cancerous lung tissue significantly raises, and sees Fig. 2.Find also that simultaneously PRR11mRNA expression level height is closely related with differentiation degree, clinical stages, transfer and the histology pathology somatotype of its lung cancer.Specifically: the PRR11mRNA expression level increased and increases along with clinical stages, saw Fig. 3; Along with differentiation degree increases and increases, see Fig. 4; Compare with the original position cancerous lung tissue, the PRR11mRNA expression level significantly raises in the lung cancer metastasis tissue; Compare with adenocarcinoma of lung, the PRR11mRNA expression level significantly raises in the squama cancer.
Adopt immunohistochemical method to analyze the expression level of PRR11 albumen in 32 routine cancerous lung tissues and 8 routine corresponding normal lung tissues, find: compare with corresponding normal lung tissue, PRR11 albumen expression level in cancerous lung tissue significantly raises, and sees Fig. 5.Find also that in addition compare with adenocarcinoma of lung, the PRR11 protein expression level significantly raises in the squama cancer.
(RNA interference, RNAi) technology have suppressed many strains lung cancer cell line PRR11 expression of gene effectively, see Fig. 6 to adopt the RNA interference.Find: suppress to cause lung carcinoma cell cell-cycle arrest to occur after the PRR11 genetic expression and growing multiplication is suppressed, see Fig. 7.
Soft-agar cloning forms analysis revealed, and after employing RNAi suppressed PRR11 genetic expression, the soft-agar cloning that has also significantly suppressed lung carcinoma cell formed ability, sees Fig. 8.Transplanted tumor in nude mice becomes the knurl analysis revealed, after employing RNAi suppresses PRR11 genetic expression, has also significantly suppressed the growth of lung cancer transplanted tumor in nude mice, sees Fig. 9.
The polypeptide of equivalence can obtain its antibody on albumen of the application of the invention or the immunology, and antibody is used for said proteic detection and purifying.Can use albumen of the present invention or its partial amino-acid series to produce antibody originally as immunity.Can produce polyclonal antibody through immunogen being inoculated to host animal and the ordinary method that reclaims serum.Can also produce monoclonal antibody through conventional hybridization knurl method.Through using above-mentioned antibody, utilize antigen-antibody reaction, detect the proteic expression of PRR11, be used for the diagnosis and the prognostic analysis of tumours such as lung cancer.
Can use the nucleotide sequence of said gene provided by the invention, design corresponding primer and/or probe, be used to detect said expression of gene, be used for the diagnosis and the prognostic analysis of tumours such as lung cancer.
Through suppressing said protein expression, or, the growth and the propagation of tumour cell can be suppressed, thereby the purpose of treatment tumour can be reached through utilizing to said proteic antibody.Also can use materials such as micromolecular compound or polypeptide,, suppress growth of tumor and propagation, thereby reach the purpose of treatment tumour through suppressing said proteic function.Also can use to nucleic acid drugs such as the siRNA of the nucleotide sequence shown in the sequence 1 or antisense oligonucleotides,, suppress growth of tumor and propagation, thereby reach the purpose of treatment tumour through suppressing said expression of gene.
Embodiment 1: quantifying PCR method detects the expression of PRR11 gene in the kinds of tumors tissue
Multiple healthy tissues and tumor tissues cDNA are available from OriGene company (product article No.: CSRT101).Amount to 96 routine samples, comprise from mammary gland, colon, kidney, liver, lung, ovary, prostate gland, each 12 example of thyroid sample, wherein various organizing comprises cancerous tissue 8 example and related normal tissue 4 examples respectively.
Adopt real time fluorescence quantifying PCR method to detect the expression level of PRR11 gene in the kinds of tumors tissue.Quantitative PCR reagent
Figure BSA00000657961600041
Premix Ex Taq TM(Perfect Real Time TAKARA) available from precious biotechnology (Dalian) ltd, specifically carries out with reference to product description, slightly changes.As the confidential reference items contrast, detect the mRNA expression level of PRR11 gene with β-actin (ACTB).The upstream and downstream primer of β-actin is respectively upstream primer: 5 '-CAGCCATGTACGTTGCTATCCAGG-3 ', downstream primer: 5 '-AGGTCCAGACGCAGGATGGCATG-3 '.The upstream and downstream primer of PRR11 is respectively upstream primer: 5 '-GACTTCCAAAGCTGTGCTTCC-3 ', downstream primer: 5 '-CTGCATGGGTCCATCCTTTTT-3 '.The quantitative pcr amplification reaction system consists of: 10 μ L
Figure BSA00000657961600042
Premix Ex Taq TM(2 *), 10 μ mol/L upstream and downstream primer mixed solutions, 0.4 μ L, cDNA template 2 μ L, distilled water complements to 20 μ L.Quantitative pcr amplification carries out on Bio-Rad MiniOpticon quantitative PCR appearance, and amplification program is 95 ℃ of sex change 10sec, then with progressively 95 ℃ of 5sec of program, 58 ℃ of 15sec, 72 ℃ of 15sec read the Ct value after accomplishing 40 circulations.The method of calculation of the relative quantification expression level of PRR11 gene are 2 -Δ Δ CtMethod.
The result shows: compare with related normal tissue, the PRR11 gene is expressed in kinds of tumors tissues such as lung cancer, colorectal carcinoma significantly and is raise, and sees Fig. 1.
Embodiment 2: quantifying PCR method detects the expression of PRR11 gene in cancerous lung tissue
Cancerous lung tissue cDNA is available from OriGene company (product article No.: HLRT103).Amount to 48 routine samples, comprise 40 routine cancers and 8 routine corresponding normal lung tissues.
Adopt real time fluorescence quantifying PCR method to detect the expression level of PRR11 gene in cancerous lung tissue.
Real time fluorescence quantifying PCR method is referring to embodiment 1.
The result shows: compare with corresponding normal lung tissue, PRR11mRNA expression level in cancerous lung tissue significantly raises, and sees Fig. 2.Find that simultaneously PRR11mRNA expression level height is closely related with differentiation degree, clinical stages, transfer and the histology pathology somatotype of its lung cancer, the PRR11mRNA expression level increases along with increase by stages, sees Fig. 3.Along with differentiation degree increases and increases, see Fig. 4.
Embodiment 3: the immunohistochemical methods method detects the expression of PRR11 albumen in cancerous lung tissue
Adopt the EliVision of immunohistochemical methods (IHC) TMMethod detects the expression of PRR11 in lung cancer, metastatic carcinoma and edge tissues combined chip.The other healthy tissues tissue micro-array of lung cancer and cancer chip is available from Xi'an Ai Lina bio tech ltd (PIN: LC951), amount to 40 examples, 95 points; Comprise 30 routine cancers; 8 examples contain the metastatic carcinoma tissue of coupling, 2 examples do not match metastatic carcinoma and 8 routine healthy tissuess, every routine 2 points.PRR11 antibody is available from Sigma company (PIN: HPA023923), be rabbit source polyclonal antibody.Instant immunohistochemical methods EliVisionTMplus test kit (mouse/rabbit) steps true tumor technology ltd (specification sheets numbering: 40405a, PIN: KIT-9902) available from Foochow.Test kit is made up of reagent A (toughener) and reagent B (enzyme mark sheep anti mouse/rabbit igg polymkeric substance).DAB Color Appearance System (liquid D AB chromogenic enzyme substrate test kit) steps true tumor technology ltd available from Foochow, and its PIN is DAB-0031/1031, and lot number is 1009309902.Concrete grammar reference reagent box working instructions are slightly changed.Grope experiment condition with preliminary experiment, comprise selection, the restorative procedure of antigen retrieval liquid, the time of reparation, the condition of antibody incubation and time, the method for colour developing and time and to the control of process color etc.Detection lug and negative control are established in experiment, and the negative control sheet is identical with the detection lug working method, and one resists and to use IgG of the same race instead, and remaining condition all is the same.
The result shows: compare with corresponding normal lung tissue, PRR11 albumen expression level in cancerous lung tissue significantly raises, and sees Fig. 5.Find also that in addition compare with adenocarcinoma of lung, the PRR11 protein expression level significantly raises in the squama cancer.
Embodiment 4:RNAi technology suppresses the influence of PRR11 genetic expression to the lung carcinoma cell growing multiplication
1, siRNA's is synthetic
Obtain the cDNA sequence of PRR11 from public free gene database GenBank; From the cDNA sequence of PRR11, choose candidate siRNA sequence according to the siRNA sequences Design principle of generally acknowledging then, get rid of the candidate siRNA sequence of some poor specificity again through the comparison of BLAST homology.
The selected at last PRR11siRNA sequence of using is:
Positive-sense strand: 5 '-ACGCAGGCCUUAAGGAGAATT-3 ',
Antisense strand: 5 '-UUCUCCUUAAGGCCUGCGUTT-3 '.
The siRNA sequence of confidential reference items contrast is:
5′-UUCUCCGAACGUGUCACGU-3′
5′-TTCTCCGAACGTGTCACGT-3′
Entrust Shanghai JiMa pharmacy Technology Co., Ltd with the external synthetic above-mentioned siRNA sequence of chemical synthesis.
2, transfection experiment
Collect H1299, HCC827 and the A549 cell of logarithmic phase, with about 1.0~1.2 * 10 5The density in individual/hole is seeded to 6 well culture plates; Negative control siRNA transfection group, PRR11siRNA transfection group are set respectively; Adopt the capable siRNA transfection of the trans infection protocol of Lipofectamine RNAiMax reagent of Invitrogen company, concrete grammar reference reagent working instructions carry out.
3, total RNA extracts and quantitative PCR
(1) total RNA extracts: 72h after the transfection, collect and respectively organize cell.Use the Total RNA Kit I test kit of Omega Bio-Tek company to extract cell total rna; Concrete grammar reference reagent box working instructions carry out, and each is organized total RNA sample and utilizes quantitative and quality and the integrity of agarose gel electrophoresis detection to guarantee total RNA of ultraviolet spectrophotometer.
(2) reverse transcription: adopt the PrimeScript 1st Strand cDNA Synthesis Kit test kit of TAKARA company, concrete grammar reference reagent box working instructions carry out.
(3) quantitative PCR: contrast as confidential reference items with GAPDH, the mRNA expression level that detects the PRR11 gene changes.The upstream and downstream primer of GAPDH is respectively upstream primer: 5 '-ACCTGACCTGCCGTCTAGAA-3 ', downstream primer: 5 '-TCCACCACCCTGTTGCTGTA-3 '.The concrete grammar of quantitative PCR is with reference to embodiment 1.
(4) result: see Fig. 6 A, the result shows, 72h after transfection compares with control group, and the PRR11mRNA level of PRR11siRNA transfection group significantly reduces, and explains that PRR11siRNA can effectively suppress the PRR11 expression of gene.
4, preparation of cell protein lysate and Western trace
(1) cell protein lysate preparation: inhale and remove the substratum in the petridish, with cell washing 2 times, scrape collecting cell with cell with PBS; Be suspended in the RACK1 lysis buffer (25mM Tris-HCl, pH 8.0,137mM NaCl; 2.7mMKCl, 1%Triton X-100, an amount of proteinase inhibitor of interim interpolation before using); Place 30min on ice, further smudge cells of supersound process and DNA.4 ℃ of centrifugal 10min of 14000rpm collect supernatant as cell pyrolysis liquid.Adopt the Bradford method to detect the protein concn in the cell pyrolysis liquid, concrete grammar is referring to the Bio-Rad Protein Assay test kit operation instruction of Bio-Rad company.
(2) Western trace: get an amount of cell pyrolysis liquid, add SDS sample-loading buffer (62.5mM Tris-HCl, pH 6.8,2% beta-mercaptoethanols, 0.01% tetrabromophenol sulfonphthalein) and handle 5min in 100 ℃ of heat denatured.Each protein in the 10%SDS-PAGE sample separation.Adopt the Tank method to change film, concrete grammar is referring to the ImmobilonTM-P film operation instruction of Millipore company.Liquid (TBS-T that contains 5% milk) is blockaded the protein film after the transfer printing to spend the night in blockade 1h or 4 ℃ of room temperature with blockading.TBS-T washes film three times, each 5min; One anti-(PRR11 antibody is available from Abcam company, and GAPDH antibody is virtuous in company available from Hangzhou) that adds an amount of dilution, room temperature incubation 1h; TBS-T washes film three times; Two anti-(available from the Cell Signaling companies) that add the coupling horseradish peroxidase of dilution in 1: 2000, room temperature incubation 1h; TBS-T washes film three times.Adopt chemoluminescence method to detect at last, concrete operations are referring to the ECL Western blotting detection reagents and analysis system test kit explanation of Amersham company, and the KODAK imaging system develops.
(3) result: see Fig. 6 B, the result shows, 72h after transfection compares with control group, and the PRR11 protein expression of PRR11siRNA transfection group all is suppressed, and explains that PRR11siRNA can effectively suppress the expression of PRR11 on protein level.
5, cell proliferation experiment
Employing is based on water miscible tetrazolium salts WST-8 [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2; 4-disulfophenyl)-2H-terazolium; Monosodium salt] cell proliferation/toxicity assay, concrete grammar is with reference to CellTiter
Figure BSA00000657961600071
AQueous One Solution Cell Proliferation Assay (available from Promega company) operation instruction.With the contrast and transfection the H1299 of PRR11siRNA, HCC827 and A549 cell with about 5 * 10 3The density in/hole is seeded to 96 well culture plates, and respectively at 0h, 24h, 48h and four time points of 72h, every hole adds Ce1lTiter
Figure BSA00000657961600072
AQueous One Solution reagent 10 μ l place CO 2Hatch 1h~4h in the cell culture incubator.Measure the absorbance value of every porocyte with ELIASA then, calculate the cell multiplication factor at the 490nm place.The result shows that after employing RNAi technology suppressed the PRR11 expression, the growing multiplication of tumour cell received remarkable inhibition, sees Fig. 7.
Embodiment 5:RNAi technology suppresses the influence of PRR11 genetic expression to the lung carcinoma cell clonality
1, suppresses the shRNA carrier of PRR11 genetic expression and the structure of negative control carrier
According to the PRR11siRNA sequence among the embodiment 4, design corresponding shRNA template sequence and be:
Positive-sense strand: 5 '-GATCCACGCAGGCCTTAAGGAGAATTCAAGAGATTCTCCTTAAGGCCTGCGTTTTT TTGGAAA-3 ';
Antisense strand: 5 '-AGCTTTTCCAAAAAAACGCAGGCCTTAAGGAGAATCTCTTGAATTCTCCTTAAGGC CTGCGTG-3 '.
The shRNA template sequence of confidential reference items negative control is:
Positive-sense strand: 5 '-GATCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTT TTGGAAA-3 ';
Antisense strand: 5 '-AGCTTTTCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTC GGAGAAG-3 '.
Above-mentioned sequence 5 ' art end contains BamH I/Bgl II site, and 3 ' end contains Hind III site, entrusts Sangon Biotech (Shanghai) Co., Ltd. to adopt synthetic this sequence of chemical synthesis.
Adopt Hind III and Bgl II that pSUPER.retro.neo+GFP carrier (Oligoengine company) is carried out double digestion; Adopt the Gel Extraction Kit test kit of Omega Bio-Tek company to reclaim big fragment carrier enzyme then and cut product, adopt the DNA Ligation Kit test kit of TAKARA company that the enzyme that reclaims is cut product and be connected with above-mentioned shRNA template sequence.Adopt direct sequencing to identify and obtain positive recombinant plasmid, respectively called after pControl-sh and pPRR11-sh.Adopt the Plasmid Mini Kit I test kit extracting plasmid of Omega Bio-Tek company to be used for subsequent experimental.
2, the structure of PRR11 gene silencing stable cell line
Choose the H1299 cell and set up PRR11 gene silencing stable cell line and corresponding negative control stable cell line.
(1) transfection experiment: transient transfection is inoculated an amount of cell to 6 well culture plate previous day; When cell degree of converging reaches 80~90%; Adopt the Lipofectamine2000 reagent of Invitrogen company to carry out plasmid transfection, negative control group and PRR11shRNA group is set.Concrete grammar reference reagent working instructions carry out.
(2) screening stable cell line: behind the transfection 48h; Go down to posterity in 1: 10 ratio and respectively to organize cell, apply screening pressure simultaneously, adopt the culture medium culturing that contains G418 (available from Genview company); Suspend drug screening pressure after about 14 days; Enlarged culturing, the part cell cryopreservation, part continues to add the G418 screening.With cell dilution to 100/ml, be seeded to 96 well culture plates by the amount (cell concentration reaches 1/hole in theory) in 10ul/ hole and cultivated about 14 days.At any time observe each porocyte GFP fluorescent signal in the culturing process, select the cell enlarged culturing that nearly all cell is all expressed the GFP hole., methods such as quantitative RT-PCR and Western Blot obtain PRR11 gene silencing stable cell line (called after pControl-sh) and corresponding negative control stable cell line (called after pPRR11-sh) after proving conclusively.
3, soft agar is cultivated the clone and is formed test
(1) gets pControl-sh and pPRR11-sh logarithmic phase cell,, make it to become unicellular, make viable count, with RMPI-1640 nutrient solution adjustment cell density to 2 * 10 that contain 20% foetal calf serum with 0.25% tryptic digestion and piping and druming gently 4Individual/mL.
(2) prepare the LMP agar liquid glucose of 1.2% and 0.7% two concentration respectively with zero(ppm) water, behind the autoclaving, maintain 40 ℃ and do not solidify.
(3) in 1: 1 ratio 1.2% agarose and 2 * RMPI-1640 substratum (calf serum that contains 2 * microbiotic and 20%) are mixed after, get the 1.5mL mixed solution and inject 6 well culture plates, cooled and solidified is put CO as bottom-layer agar 2Subsequent use in the cell culture incubator.
(4) in 1: 1 ratio with 0.7% agarose with after 2 * RMPI-1640 substratum mixes in sterile test tube mutually, in pipe, add the cell suspension of 0.2mL again, abundant mixing injects and is covered with 1.2% agarose bottom plate.After treating that top-layer agar solidifies, insert 37 ℃ of 5%CO 2Cultivated in the cell culture incubator 10~14 days.
(5) after the crystal violet solution dyeing, observation of cell clone number under the inverted microscope, 5 visuals field are chosen in every hole under * 100 visuals field, counting clone sum.
(6) result: see Fig. 8, the result shows, compares with control group, and after inhibition PRR11 expressed, tumour cell clonality on soft agar significantly was suppressed.
Embodiment 6:RNAi technology suppresses PRR11 genetic expression to the lung cancer growth of nude mice transplantation tumor
1, prepares cell
Get pControl-sh and pPRR11-sh logarithmic phase cell, 0.25% tryptic digestion and piping and druming gently make it to become unicellular, wash cell twice, living cell counting with PBS.PBS suspendible cell makes its cell density be about 1 * 10 7Individual/ml.
2, inoculation
With two groups of the heavy female nude mice random assignments of 4~6 week 17~20g in ages, be set to negative control group pControl-sh and experimental group pPRR11-sh respectively, respectively nude mice back subcutaneous vaccination pControl-sh and pPRR11-sh cell 200ul/.
3, observe and measure
Day from inoculation begins to observe the tumour formation time, begins after tumour forms with vernier caliper measurement knurl footpath, twice weekly.
4, collect tumor tissues
When the bigger tumor tissue growth of volume to about 1000mm 3The time, put to death nude mice, peel off tumor tissues, 10% formaldehyde solution is fixed, paraffin embedding, section, HE dyeing.
5, result
Directly calculate and draw the nude mice tumor growth curve according to the knurl of measuring, the result sees Fig. 9, compares with control group, and after suppressing PRR11 and expressing, growth of tumor obviously is suppressed.
Figure ISA00000657961800011
Figure ISA00000657961800031
Figure ISA00000657961800041
Figure ISA00000657961800051

Claims (9)

1. participate in the albumen of growth of tumour cell, propagation and cell cycle regulating; This albumen has the aminoacid sequence shown in the sequence 2 in the sequence table, the aminoacid sequence that perhaps obtains through one or more amino acid whose disappearance, replacement or increase in the said aminoacid sequence.
2. the proteic gene of coding claim 1, it be have the base sequence shown in the sequence 1 DNA or with the DNA of said DNA hybridize under stringent condition.
3. be directed against the proteic antibody of claim 1, the specific antibody that it is to use said albumen to produce as immunogen.
4. test right requires 1 proteic test kit, and it contains the specific antibody of claim 3, can carry out antigen-antibody reaction, is used to detect have the albumen shown in the sequence 2.
5. be used to detect the diagnostic kit of the nucleotide sequence shown in the sequence 1, it contain with nucleotide sequence 1 in partial nucleotide sequence complementary nucleotide sequence.
6. to the siRNA or the antisense oligonucleotide of the nucleotide sequence shown in the sequence 1, it contain with nucleotide sequence 1 in partial nucleotide sequence complementary nucleotide sequence.
7. the application of the albumen of claim 1 in the medicine of preparation treatment tumour.
8. the application of the gene of claim 2 in the medicine of preparation treatment tumour.
9. the application of the gene of the albumen of claim 1 and claim 2 in pulmonary cancer diagnosis and treatment.
CN201210011455.4A 2012-01-13 2012-01-13 The albumen and application of PRR11 genes and its coding Active CN102558336B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210011455.4A CN102558336B (en) 2012-01-13 2012-01-13 The albumen and application of PRR11 genes and its coding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210011455.4A CN102558336B (en) 2012-01-13 2012-01-13 The albumen and application of PRR11 genes and its coding

Publications (2)

Publication Number Publication Date
CN102558336A true CN102558336A (en) 2012-07-11
CN102558336B CN102558336B (en) 2017-07-21

Family

ID=46405065

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210011455.4A Active CN102558336B (en) 2012-01-13 2012-01-13 The albumen and application of PRR11 genes and its coding

Country Status (1)

Country Link
CN (1) CN102558336B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016055568A3 (en) * 2014-10-08 2016-06-09 Cancer Research Technology Ltd Prr11 binding agents for cancer therapy
CN109073657A (en) * 2016-01-29 2018-12-21 株式会社国际电气通信基础技术研究所 Renal functional evaluation device, device and phosphorus Estimation of Intake device for predicting renal complications morbidity
US11180539B2 (en) 2016-03-29 2021-11-23 Karydo Therapeutix, Inc. Pharmaceutical composition or food composition, and method for assessing effect of active ingredient in vivo
US11244760B2 (en) 2015-06-25 2022-02-08 Karydo Therapeutix, Inc. Prediction device based on inter-organ cross talk system
US12091701B2 (en) 2016-03-29 2024-09-17 Karydo Therapeutix, Inc. Screening method for candidate substances for active component to prevent or treat at least one disease selected from the group consisting of renal hypofunction, chronic kidney disease and kidney failure

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
LAMESCH,P. ET AL.: "Homo sapiens proline rich 11 (PRR11), mRNA", 《GENBANK ACCESSION:NM_018304.3》 *
LAMESCH,P. ET AL.: "proline-rich protein 11 [Homo sapiens]", 《GENBANK ACCESSION:NP_060774.2》 *
SOMEONE: "PREDICTED: proline-rich protein 11 isoform 1 [Pan troglodytes]", 《GENBANK ACCESSION:XP_001172831.1》 *
崔涛: "肿瘤候选基因PRR11原核、真核表达载体构建、细胞定位及功能的初步研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 *
崔涛等: "新基因PRR11 的克隆、原核表达及鉴定", 《生物技术通报》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016055568A3 (en) * 2014-10-08 2016-06-09 Cancer Research Technology Ltd Prr11 binding agents for cancer therapy
US11244760B2 (en) 2015-06-25 2022-02-08 Karydo Therapeutix, Inc. Prediction device based on inter-organ cross talk system
CN109073657A (en) * 2016-01-29 2018-12-21 株式会社国际电气通信基础技术研究所 Renal functional evaluation device, device and phosphorus Estimation of Intake device for predicting renal complications morbidity
CN109073657B (en) * 2016-01-29 2021-09-07 无限生物制药公司 Renal function evaluation device, device for predicting onset of renal complications, and phosphorus intake estimation device
US11180539B2 (en) 2016-03-29 2021-11-23 Karydo Therapeutix, Inc. Pharmaceutical composition or food composition, and method for assessing effect of active ingredient in vivo
US12091701B2 (en) 2016-03-29 2024-09-17 Karydo Therapeutix, Inc. Screening method for candidate substances for active component to prevent or treat at least one disease selected from the group consisting of renal hypofunction, chronic kidney disease and kidney failure

Also Published As

Publication number Publication date
CN102558336B (en) 2017-07-21

Similar Documents

Publication Publication Date Title
Jiang et al. Current prevalence status of gastric cancer and recent studies on the roles of circular RNAs and methods used to investigate circular RNAs
CN103316359B (en) Application of long-chain non-coding RNA in preparation of non-small cell lung cancer treatment drugs
Qu et al. Expression of long non-coding RNA HOXA11-AS is correlated with progression of laryngeal squamous cell carcinoma
Yang et al. CircRNA_100876 promote proliferation and metastasis of breast cancer cells through adsorbing microRNA-361-3p in a sponge form.
Lin et al. Oncogene miR-154-5p regulates cellular function and acts as a molecular marker with poor prognosis in renal cell carcinoma
CN102558336A (en) PRR11 gene and coded protein and application thereof
Lin et al. MicroRNA-328 inhibits migration and epithelial–mesenchymal transition by targeting CD44 in nasopharyngeal carcinoma cells
Lin et al. MiR-187 overexpression inhibits cervical cancer progression by targeting HPV16 E6
Deng et al. Hsa_circ_0088233 alleviates proliferation, migration, and invasion of prostate cancer by targeting hsa-miR-185-3p
Wu et al. B-cell lymphoma/leukemia 10 promotes oral cancer progression through STAT1/ATF4/S100P signaling pathway
Sun et al. MicroRNA-365 suppresses cell growth and invasion in esophageal squamous cell carcinoma by modulating phosphoserine aminotransferase 1
CN111118159B (en) Marker gene SNORD16 gene and application thereof
Wang et al. Long noncoding RNA ZEB1-AS1 downregulates miR-23a, promotes tumor progression, and predicts the survival of oral squamous cell carcinoma patients
Wang et al. Circular RNA_0000629 suppresses bladder cancer progression mediating MicroRNA-1290/CDC73
Quan et al. miR-198 regulated the tumorigenesis of gastric cancer by targeting Toll-like receptor 4 (TLR4).
Luan et al. MiR-769-5p functions as an oncogene by down-regulating RYBP expression in gastric cancer.
Wang et al. Overexpression of ATAD2 indicates poor prognosis in oral squamous cell carcinoma
Zhou et al. miR‐942‐5p inhibits proliferation, metastasis, and epithelial‐mesenchymal transition in colorectal cancer by targeting CCBE1
CN109266743B (en) A kind of cancer markers and application thereof
Geng et al. Circular RNA circCOL6A3_030 is involved in the metastasis of gastric cancer by encoding polypeptide: circCOL6A3_030 promotes metastasis.
CN110172462B (en) Gene with promotion effect on generation and development of tumor, expression product and application thereof
Wang et al. LncRNA LACAT1 promotes proliferation of oral squamous cell carcinoma cells by inhibiting microRNA-4301.
Zhang et al. The role of hsa_circ_0000285 in metastasis of hepatocellular carcinoma.
Sun et al. Downregulation of CD166 inhibits invasion, migration, and EMT in the radio-resistant human nasopharyngeal carcinoma cell line CNE-2R
Gao et al. Lentivirus-mediated shRNA targeting MUTYH inhibits malignant phenotypes of bladder cancer SW780 cells

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant