CN102548552B

CN102548552B - Spectinomycin amide as tuberculosis

Info

Publication number: CN102548552B
Application number: CN201080042448.XA
Authority: CN
Inventors: R·E·李; J·齐; J·G·胡德勒; B·迈博姆; P·K·瓦戴迪; 拉凯什; J·刘
Original assignee: University of Tennessee Research Foundation
Current assignee: University of Tennessee Research Foundation
Priority date: 2009-07-24
Filing date: 2010-07-26
Publication date: 2016-06-01
Anticipated expiration: 2030-07-26
Also published as: US8685978B2; EP2461805B1; JP5770181B2; CN102548552A; WO2011011783A1; AU2010275375B2; EP2461805A1; AU2010275375A1; US9284325B2; JP2013500270A; EP2461805A4; US20140249155A1; US20110118272A1; CA2768582C; CA2768582A1

Abstract

This application describes new 3 '-deoxidation-3 '-acyl amino spectinomycin compound. Also describe application 3 '-deoxidation-3-acyl amino spectinomycin and other spectinomycin analogue treatment tuberculosis and the method for the treatment of microorganism infection.

Description

Spectinomycin amide as tuberculosis

Cross reference with related application

The rights and interests of the U.S. Provisional Patent Application 61/228,266 of subject requirement disclosed by the invention submission on July 24th, 2009, are hereby incorporated by full by the disclosure of which.

GOVERNMENT INTERESTS

Theme disclosed by the invention obtains the U.S. government of the approval number R01AI062415 that National Institute of Health (NationalInstitutesofHealth) gives and supports. Therefore, theme disclosed by the invention is enjoyed some right by U.S. government.

Technical field

Theme disclosed by the invention provides the spectinomycin analog that a class is new, and describes spectinomycin analog purposes in treatment tuberculosis and other microorganisms infect.

Write a Chinese character in simplified form

DEG C=degree Celsius

�� g=microgram

�� L=microlitre

��M=micromolar

ATCC=American Type Culture Collection

CBz=carboxybenzyl

Cfu=clonogenic unit

DIPEA=diisopropylethylamine

The Eagle culture medium of DMEM=Dulbecco improvement

DMSO=dimethyl sulfoxide

ESI=electrospray ionization

EtOH=ethanol

FBS=hyclone

FIC=FIC

HBTU=O-benzotriazole-N, N, N ', N '-tetramethyl-urea-hexafluorophosphate

HIV=human immunodeficiency virus

Hr=hour

Mark in IS=

IV=intravenous

Kg=kilogram

LC=liquid chromatography

MDR=multidrug resistance

MeOH=methanol

Mg=milligram

MIC=minimal inhibitory concentration

Min=minute

ML=milliliter

Mmol=mM

MS=mass spectrography

MW=molecular weight

Rpm=revolutions per minute

PCR=polymerase chain reaction

Pd-C=palladium carbon

Spc=spectinomycin

Stp=streptomycin

TB=tuberculosis

The extensive drug resistance of XDR=

Background technology

Mycobacterium tuberculosis (Mycobacteriumtuberculosis) is pathogen lungy, and it remains as one of successful and the most lethal infectious disease in the whole world. World Health Organization (WHO) estimates the annual tuberculosis activity case more than 3,000,000, and causing dies ten thousand deaths more than 100 dies. Referring toWorld Health Organization (WHO)WHO report 2007. The individuality of HIV is more likely to activity form that is infected and that develop into this disease, and popular in global spread due to HIV, and therefore this result in the increase that cases of tuberculosis quantity that global observation arrives is nearest significantly. Referring toCenter for Disease Control (CDC), TBandHIVCoinfection, 2006. The tuberculotherapy of current recommendation is four pharmaceutical admixtures of minimum 6 months, including Rimactazid, pyrazinamide and ethambutol. This long-term and loaded down with trivial details scheme result in disobeying of patient. This makes again the quantity of multidrug resistance (MDR) and extensive drug resistance (XDR) bacterial strain found in clinic increase, extremely limited for the effective therapeutic choice of these bacterial strains.

It is, therefore, apparent that need exploitation to treat novel treatment lungy. Especially the antituberculosis therapy agent such as having the following properties that is needed: internal strong anti-tubercular; Overriding resistance mycobacterium tuberculosis strain includes the activity of MDR and XDR bacterial strain; Fabulous safety/hypotoxicity; Drug interaction or antagonism is not had with the other drug being generally used for treatment tuberculosis or HIV; The activity of anti-that hide or slowly growth antibacterial, to help to reduce treatment time; And long serum half-life is to reduce dosage rate.

Summary of the invention

Theme disclosed by the invention provides formula (I) compound or pharmaceutically acceptable salt thereof or prodrug in some embodiments:

Wherein

R₁And R₂It is H, alkoxy carbonyl or aromatic alkoxy carbonyl independently of one another;

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₅It is-C (=O) R₆, wherein R₆Selected from (a) or (b):

(a)-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅; Or

The phenyl of (b) heteroaryl, the heteroaryl of replacement, 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that the phenyl of wherein said replacement is replaced by alkylidene together with two of which phenyl carbons selected from the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl; And wherein R₈It is the aryl of aryl or replacement independently.

In some embodiments, R₁And R₂It is individually H. In some embodiments, R₁And R₂It is individually selected from following aromatic alkoxy carbonyl: benzyloxycarbonyl group and the benzyloxycarbonyl group replaced by one or more halogens, alkoxyl and nitro. In some embodiments, R₁And R₂It is individually benzyloxycarbonyl group.

In some embodiments, R₃It is methyl or butyl. In some embodiments, R₄It is H, OH, methyl or methoxy.

In some embodiments, R₆It is 4-fluorophenyl or 2-fluorophenyl. In some embodiments, R₆Heteroaryl, described heteroaryl selected from pyridine radicals, pyrimidine radicals, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₆It is-C (R₈)₂, each of which R₈It it is the phenyl of phenyl or replacement.

In some embodiments, formula (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof or prodrug:

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that phenyl, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl and the two of which phenyl carbons that the phenyl of wherein said replacement replaces selected from fluorine is replaced by alkylidene together.

In some embodiments, R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

In some embodiments, R₇Be the heteroaryl of heteroaryl or replacement, comprise selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

In some embodiments, R₇Being the heteroaryl replaced, wherein said heteroaryl is replaced by one or more following groups: NH₂, OH, alkyl amino, arylamino, nitro, halogen, alkyl, the alkyl of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, acyl group, aryl, aryloxy group and replacement aryl. In some embodiments, R₇Being the heteroaryl replaced, wherein said heteroaryl is replaced by one or more following groups: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

In some embodiments, R₇Being the aralkyl of aralkyl or replacement, the aralkyl of wherein said aralkyl or replacement comprises the heteroaryl groups of heteroaryl or replacement.

In some embodiments, R₇Comprise nitrogen-containing hetero aryl, and formula (Ia) compound have the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂, alkyl, the alkyl of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, the aralkyl of replacement, aralkoxy, aryl, aryloxy group, acyl group and replacement aryl;

Or wherein R₉And R₁₀Together, or R₁₁And R₁₂It is alkylidene together; And

Each R₁₅Aryl independently selected from H, alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl and replacement;

Or its officinal salt or prodrug.

In some embodiments, formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrazine-2-base) formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-fluorobenzene-1-base) formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,2-diphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-methyl] butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-(2-aminoacetylamino)-3-phenyl] propionyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-3-benzamido propanoylamino spectinomycin; With

3 '-dihydro-3 '-deoxidation-4 (R)-3-(2-phenylacetamido) propanoylamino spectinomycin;

Or its officinal salt or prodrug.

In some embodiments, described compound is officinal salt. In some embodiments, described compound is hydrochlorate or hydrobromate.

In some embodiments, theme disclosed by the invention provides pharmaceutical composition, and it comprises: (a) formula (I) compound or pharmaceutically acceptable salt thereof or prodrug:

Wherein

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₅It is-C (=O) R₆, wherein R₆Selected from (i) or (ii): (i)-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(ii) selected from heteroaryl, the heteroaryl of replacement, the phenyl of 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that the phenyl of wherein said replacement is replaced by alkylidene together with two of which phenyl carbons selected from the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl; And wherein R₈It is the aryl of aryl or replacement independently of one another;

And (b) pharmaceutically suitable carrier.

In some embodiments, described pharmaceutically suitable carrier is pharmaceutically useful in people. In some embodiments, described pharmaceutical preparation comprises other treatment and/or antimicrobial compound further. In some embodiments, other antimicrobial compounds described are antitubercular compounds. In some embodiments, other antimicrobial compound described is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin. In some embodiments, described pharmaceutical preparation is for orally or topically using.

In some embodiments, theme disclosed by the invention provides the method that treatment antibacterial infects in the experimenter having treatment to need, and described method includes formula (I) compound or pharmaceutically acceptable salt thereof or the prodrug of using effective dose to described experimenter:

Wherein

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₅It is-C (=O) R₆, wherein R₆Selected from (a) or (b):

The phenyl of (b) heteroaryl, the heteroaryl of replacement, 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that the phenyl of wherein said replacement is replaced by alkylidene together with two of which phenyl carbons selected from the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl; And wherein R₈It is the aryl of aryl or replacement independently of one another.

In some embodiments, R₁And R₂It is individually H. In some embodiments, R₃It is methyl or butyl. In some embodiments, R₄It is H, OH, methyl or methoxy.

In some embodiments, R₆It it is 4-fluorophenyl. In some embodiments, R₆Heteroaryl, its selected from pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

In some embodiments, R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls. In some embodiments, R₇Being the heteroaryl of heteroaryl or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

Or wherein R₉And R₁₀Together or R₁₁And R₁₂It is alkylidene together; And

Or its officinal salt or prodrug.

In some embodiments, described compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin; And

Or its officinal salt or prodrug.

In some embodiments, described compound is Orally administered or local application. In some embodiments, before using formula (I) compound, other treatment compound is used to experimenter after or during the period.

In some embodiments, described infection is gram positive bacteria infection. In some embodiments, described infection is chosen from following infection: mycobacterial infections, anthrax bacillus (Bacillusanthracis) infect, enterococcus faecalis (Enterococcusfaecalis) infects and streptococcus pneumoniae (Streptococcuspneumoniae) infects.

In some embodiments, described infection is infection due to Bacillus anthracis, and formula (I) compound is 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin; Or 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin; Or its officinal salt or prodrug.

In some embodiments, described infection is streptococcus pneumoniae infection, and formula (I) compound is selected from: 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino)-thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl)-acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl)-pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(TRIFLUORO-METHYL) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin and 3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin; Or its officinal salt or prodrug.

In some embodiments, described infection is that enterococcus faecalis infects, and formula (I) compound is selected from: 3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl)-amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin; With 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin; Or its officinal salt or prodrug.

In some embodiments, described infection is m tuberculosis infection, and formula (I) compound is selected from: 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl)-acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin; Or its officinal salt or prodrug.

In some embodiments, prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below: (a) has the antibacterial of the experimenter of infection risk to infect; B recurrence that () antibacterial infects; And (c) its combination. In some embodiments, use formula (I) compound and infect to treat the antibacterial existed.

In some embodiments, theme disclosed by the invention provides the method treating tuberculosis in the experimenter having treatment to need, and described method includes formula (I) compound or pharmaceutically acceptable salt thereof or the prodrug of using effective dose to described experimenter:

Wherein

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₅Selected from alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl, the aryl of replacement and acyl group.

In some embodiments, R₅It it is acyl group. In some embodiments, R₅There is-C (=O) R₆Structure, wherein R₆Aryl selected from alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl and replacement. In some embodiments, R₆Selected from heteroaryl, the heteroaryl of replacement, the phenyl of 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇And-C (R₈)₂; R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that phenyl, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl and the two of which phenyl carbons that the phenyl of wherein said replacement replaces selected from fluorine is replaced by alkylidene together; And each R₈It is the aryl of aryl or replacement independently. In some embodiments, R₆Selected from-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅; Or its officinal salt or prodrug.

In some embodiments, formula (I) compound is formula (Ia) compound:

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that phenyl, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl and the two of which phenyl carbons that the phenyl of wherein said replacement replaces selected from fluorine is replaced by alkylidene together; And

Or its officinal salt or prodrug.

In some embodiments, R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4--methylenedioxyphenyls and 2,3-difluorophenyls. In some embodiments, R₇Being the heteroaryl of heteroaryl or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇Being the heteroaryl of heteroaryl or replacement, it comprises selected from following heteroaryl: pyridine radicals, thiazolyl, benzoAzoles base and benzothiazolyl.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

Or its officinal salt or prodrug.

In some embodiments, described compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-phenyl] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-amino)-propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-phenylacetamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methyl) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-aminopropionyl amino spectinomycins; And

3 '-dihydro-3 '-deoxidation-4 (R)-(2-amino) acetylamino spectinomycin;

Or its officinal salt or prodrug.

In some embodiments, described compound is officinal salt. In some embodiments, described compound is hydrochlorate or hydrobromate. In some embodiments, described compound is Orally administered or used by suction.

In some embodiments, described method also includes the therapeutic compound of using other to experimenter. In some embodiments, other therapeutic compound is antibiotic. In some embodiments, other therapeutic compound is antituberculosis therapy agent. In some embodiments, other therapeutic compound is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

In some embodiments, prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below: (a) has the m tuberculosis infection of the experimenter of infection risk; The recurrence of (b) m tuberculosis infection; And (c) its combination. In some embodiments, formula (I) compound is used to treat the m tuberculosis infection existed. In some embodiments, formula (I) compound is used to treat the infection of the multidrug resistance bacterial strain of mycobacterium tuberculosis. In some embodiments, formula (I) compound has 25 �� g/mL or less against mycobacterium tuberculosis minimal inhibitory concentration (MIC).

In some embodiments, theme disclosed by the invention provides selected from following compound:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

Or its officinal salt or prodrug.

In some embodiments, theme disclosed by the invention provides the method that treatment antibacterial infects in the experimenter having treatment to need, wherein said method include to experimenter use effective dose selected from following compound: 3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; And 3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin, or its officinal salt or prodrug. In some embodiments, it is that enterococcus faecalis infects that described antibacterial infects, and described method includes 3 '-dihydro-3 of using effective dose to experimenter '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin, or its officinal salt or prodrug.

One purpose of theme disclosed by the invention is to provide new spectinomycin derivant; such as, but not limited to 3 '-dihydro-3 '-(R)-acyl amino spectinomycin derivant, and the compound of the infection including mycobacterium tuberculosis complex is infected for treating microorganism.

The purpose of theme disclosed by the invention is pointed out hereinbefore, and it is realized whole or in part by theme disclosed by the invention, when with when the best accompanying drawing described is associated below, along with the carrying out described, other purposes also will be apparent from.

Accompanying drawing is sketched

Fig. 1 is the schematic diagram of the illustrative methods of the compound synthesizing theme disclosed by the invention.

Fig. 2 is the schematic diagram of the illustrative methods of the compound synthesizing theme disclosed by the invention.

Fig. 3 be showing with compound incubation 4 hours after, protein synthesis in compound 1329,1445 or comparison full cell Mycobacterium bovis (M.bovis) BCG that causes of antibiotics streptomycin the post figure suppressed.

Fig. 4 compares to transcribe/translate, at escherichia coli (E.coli) S30, the figure that the luciferase protein synthesis caused in method of testing suppresses by compound 1329 (circle) or spectinomycin (triangle).

Fig. 5 is showing and transcribes/translate in method of testing escherichia coli, the post figure that the comparison of the spectinomycin analog of 6.6 ��Ms (brighter posts) or 0.66 ��M (relatively sleeper) is active.

Fig. 6 is showing the figure of compound 1329 (intravenous, 10mg/kg body weight) pharmacokinetics situation in rats. Each group of data are from an animal. Group 1 (circle) refers to the data from animal 1. Group 2 (trianglees) refer to the data from animal 2. Group 3 (square) refer to the data from animal 3. Group 4 (rhombuses) refer to the data from animal 4.

Detailed Description Of The Invention

Disclosed by the invention theme be will be described more fully below with reference to appended embodiment, show representational embodiment in the described embodiment. But, theme disclosed by the invention can embody in different forms, should not be assumed that and is limited to embodiment illustrated herein. And be to provide these embodiments so that the disclosure is thoroughly with complete, and the scope of embodiment will be transmitted fully to those skilled in the art.

Unless otherwise defined, all technology used herein have the identical implication being generally understood that with theme those of ordinary skill in the field described herein with scientific terminology. All publications mentioned above, patent application, patent and other lists of references are all incorporated by as reference using it.

In the specification and in the claims, given chemical formula or title will include all of optics and stereoisomer and racemic mixture, if this type of isomer and mixture exist.

I.Definition

According to the Patent Law convention existed for a long time, when including in claims for the application, term " a kind of (a/an) " means " one or more ". Therefore, " a kind of compound " can refer to multiple (that is, two or more) compound.

Unless otherwise noted, the numeral of the amount of all expression components that uses in the specification and in the claims, reaction condition etc. should be understood to modify by term " about " in all cases. Therefore, unless the contrary indicated otherwise, otherwise numerical parameter in this specification and in the appended claims is depending on disclosed theme and seeks the desirable properties obtained and the approximation changed. Therefore, when relating to the amount of value or quality, weight, time, temperature, volume or percentage ratio, terms used herein " about " be meant to include from specified amount �� 20% or �� 10%, more preferably �� 5%, change even more preferably from �� 1% and more preferably �� 0.1% because this type of change is adapted for carrying out disclosed method.

When being used for describing two or more activity, situation or result, term "and/or" refers to scenario described below: wherein listed situation both of which is included, or wherein only one of two listed situations are included.

It is synonym that term " comprised " with " including ", " containing " or " being characterised by ", and it is that be included or open, and be not excluded for other, the element that do not describe or method step.

" comprising " term of art being to use in claim language, it is meant to mentioned element and is crucial but can add other elements, and still forms the construction in the scope of the said claims.

As used herein, phrase " by ... composition " eliminate in the unspecified any element of claim, step or component. When phrase " by ... composition " occurs in the clause of main body of claim, but not immediately preamble time, it only limits described clause institute column element, and other elements will not be got rid of outside making as a whole claim.

Scope of the claims is limited the material that extremely indicates or step by phrase used herein " substantially by ... composition ", adds the basis that will not substantially affect theme required for protection and novel features those.

With regard to term " comprising ", " by ... composition " and " substantially by ... composition ", when these three term used herein for the moment, disclosure and the theme claimed can include any one in use another two term.

Term as used herein " alkyl " refers to C_1-20(comprising end value) linear (namely, " straight chain "), side chain or ring-type, saturated or unsaturated at least partly and in some cases completely unsaturated (namely, thiazolinyl and alkynyl) hydrocarbon chain, including such as methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, the tert-butyl group, amyl group, hexyl, octyl group, vinyl, acrylic, cyclobutenyl, pentenyl, hexenyl, octenyl, butadienyl, propinyl, butynyl, pentynyl, hexin base, heptyne base and allene base. " side chain " refers to that wherein low alkyl group (such as methyl, ethyl or propyl group) is connected to the alkyl group of linear alkyl chain. " low alkyl group " refers to alkyl (that is, the C with 1 to about 8 carbon atom_1-8Alkyl), for instance 1,2,3,4,5,6,7 or 8 carbon atoms. " senior alkyl " refers to the alkyl with about 10 to about 20 carbon atoms, for instance 10,11,12,13,14,15,16,17,18,19 or 20 carbon atoms. In certain embodiments, " alkyl " refers in particular to C_1-8Straight chained alkyl. In certain embodiments, " alkyl " refers in particular to C_1-8Branched alkyl.

Alkyl is optionally replaced (" alkyl of replacement ") by one or more alkyl substituents, and wherein said substituent group can be identical or different. Term " alkyl substituent " includes but not limited to: alkyl, replacement alkyl (include but not limited to; whole haloalkyl, such as perfluoroalkyl), aralkyl, the aralkyl of replacement, halogen, amino, alkyl amino, arylamino, aryl, the aryl of replacement, nitro, sulfenyl (thio), acyl group, hydroxyl, aryloxy group, alkoxyl, perhaloalkoxy groups, alkylthio group, arylthio, aralkyl oxy, aromatic alkyl sulfurio, carboxyl, alkoxy carbonyl, oxo and cycloalkyl. Optionally insert along alkyl chain one or more oxygen, sulfur or replacement or unsubstituted nitrogen-atoms, wherein nitrogen substituent group is hydrogen, low alkyl group (also referred herein as " alkylaminoalkyl group ") or aryl.

Therefore; term as used herein " alkyl of replacement " includes alkyl as herein defined, one or more atoms of wherein said alkyl or functional group and is replaced by another atom or functional group's (including the such as alkyl of alkyl, replacement, aralkyl, the aralkyl of replacement, halogen, aryl, the aryl of replacement, alkoxyl, carboxyl, acyl group, hydroxyl, nitro, amino, alkyl amino, dialkyl amido, sulfate radical and sulfydryl).

Terms used herein " aryl " refers to aromatic substituents, and it can be single aromatic rings or condense multi-aromatic ring together. Term " aryl " is particularly including heterocyclic aromatic compounds. Aromatic rings especially can include phenyl, naphthyl, furyl, thienyl and pyridine radicals. In special embodiment, term " aryl " means to comprise the aromatic ring of such as 5,6,7,8,9 or 10 carbon atoms of about 5 to about 10 carbon atoms, and includes 5 yuan and 6 yuan of hydrocarbon aromatic rings and heterocycle aromatic ring.

Aryl is optionally replaced (" aryl of replacement ") by one or more aryl substituents, and wherein said aryl substituent can be identical or different. term " aryl substituent " includes but not limited to: alkyl, the alkyl replaced (includes but not limited to, whole haloalkyl (such as perfluoroalkyl)), aryl, the aryl replaced, aralkyl, hydroxyl, alkoxyl, perhaloalkoxy groups, aryloxy group, aralkyl oxy, carboxyl, acyl group, halogen, nitro, alkoxy carbonyl, aryloxycarbonyl, aromatic alkoxy carbonyl, acyloxy, acyl amino is (such as, aroylamino), acylamino-, carbamoyl, alkyl-carbamoyl, dialkyl carbamoyl, arylthio, alkylthio group, alkylidene and-NR ' R ", wherein R ' and R " can be each hydrogen independently, alkyl, the alkyl replaced, aryl, the aryl replaced and aralkyl.

Therefore; term as used herein " aryl of replacement " includes aryl defined herein; one or more atoms of wherein said aryl or functional group (are included the such as alkyl of alkyl, replacement, halogen, aryl, the aryl of replacement, alkoxyl, aryloxy group (such as by another atom or functional group; phenoxy group), hydroxyl, nitro, amino, alkyl amino (such as; phenyl amino), dialkyl amido, arylamino, carboxyl, acyl group (such as, benzoyl), sulfate radical and sulfydryl) replace. Therefore, the aryl of replacement includes the aryl (that is, " biaryl ") that aryl replaces.

The instantiation of aryl includes but not limited to: cyclopentadienyl group, phenyl, naphthyl; And heteroaryl, described heteroaryl includes but not limited to: furan, thiophene, pyrroles,Azoles, triazole, pyrans, pyridine, imidazoles, benzimidazole, benzofuran, benzoAzoles, benzothiazole, isothiazole, differentAzoles, pyrazoles, pyrazine, thiazole, triazine, pyrimidine, pyridazine, quinoline, isoquinolin, indole, carbazole etc.

Term " heteroaryl " refers to aryl as defined above, and wherein the skeleton of aromatic ring comprises at least one hetero atom, such as, but not limited to oxygen, sulfur, nitrogen or selenium. Exemplary heteroaryl includes but not limited to: furan, thiophene, pyrroles, pyrans, triazole (such as, 1,2,3-triazolyl or 1,2,4-triazolyls), pyridine (such as, 2-pyridine radicals, 3-pyridine radicals or 4-pyridine radicals), imidazoles, benzimidazole,Azoles, isothiazole, benzofuran, benzoAzoles, differentAzoles, pyrazoles, pyrazine, pyridazine, triazine, thiazole (such as, 4-thiazolyl or 5-thiazolyl), benzothiazole, phentriazine, pyrimidine (such as, 4-pyrimidine radicals or 2-pyrimidine radicals), quinoline, isoquinolin, indole and carbazole. " nitrogen-containing hetero aryl " refers to the heteroaryl that the skeleton of wherein aromatic ring comprises at least one nitrogen. Exemplary nitrogen-containing hetero aryl includes but not limited to: pyrroles, triazole, pyridine, imidazoles, benzimidazole,Azoles, isothiazole, benzoAzoles, differentAzoles, pyrazoles, pyrazine, pyridazine, triazine, thiazole, benzothiazole, phentriazine, pyrimidine, quinoline, isoquinolin, indole and carbazole.

Term as used herein " acyl group " refers to-OH of the wherein carboxyl organic acid group replaced by another substituent group. Therefore, acyl group can by general formula R C (=O)-expression, and wherein R is the alkyl as herein defined, aralkyl or the aryl that are optionally replaced by one or more alkyl or aryl substituent groups. Therefore, term " acyl group " is particularly including aryl-acyl (herein also referred to as " aroyl "), and wherein R is aryl (such as, furyl or phenyl) or the aryl replaced. The instantiation of acyl group includes acetyl group and benzoyl.

Term " acyl amino " refers to-NHC (=O) R group, and wherein R is the alkyl, aralkyl or the aryl that are optionally replaced by one or more alkyl or aryl substituent groups.

" (Cyclic) of ring " and " cycloalkyl " refer to the non-aromatic monocyclic of such as 3,4,5,6,7,8,9 or 10 carbon atoms of about 3 to about 10 carbon atoms or multi-ring loop systems. Cycloalkyl is optionally that part is undersaturated. Cycloalkyl is also optionally replaced by alkyl substituent defined herein, oxo and/or alkylidene. Can being optionally inserted into one or more oxygen, sulfur or replacement or unsubstituted nitrogen-atoms along cycloalkyl chain, wherein nitrogen substituent group is the aryl of hydrogen, alkyl, the alkyl of replacement, aryl or replacement, thus provides heterocyclic radical. Representational monocyclic cycloalkyl ring includes cyclopenta, cyclohexyl and suberyl. Polycyclic naphthene basic ring includes adamantyl, octahydro naphthyl, naphthalane, Camphora, camphane and noradamantyl.

" alkylidene " refers to the divalent aliphatic hydrocarbon of the straight or branched with such as 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 carbon atoms of 1 to about 20 carbon atom. Alkylidene can be straight chain, side chain or ring-type. Alkylidene is optionally also undersaturated and/or is replaced by one or more " alkyl substituents ". Can being optionally inserted into one or more oxygen, sulfur or substituted or unsubstituted nitrogen-atoms (referred to herein as " alkylaminoalkyl group ") along alkylidene, wherein nitrogen substituent group is alkyl as previously described. Exemplary alkylidene includes methylene (-CH₂-); Ethylidene (-CH₂-CH₂-); Propylidene (-(CH₂)₃-); Cyclohexylidene (-C₆H₁₀-);-CH=CH-CH=CH-;-CH=CH-CH₂-;-(CH₂)_q-N(R)-(CH₂)_r-, wherein q and r is the integer of 0 to about 20 independently of one another, for instance 0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20, and R is hydrogen or low alkyl group; Methylene-dioxy (-O-CH₂-O-0; And ethylenedioxy (-O-(CH₂)₂-O-). Alkylidene can have about 2 to about 3 carbon atoms, and can have 6-20 carbon further.

" alkoxyl " or " alkyl oxy " refers to allcyl-O-groups, and wherein alkyl is as described above. Term as used herein " alkoxyl " may relate to C_1-20(including end value) linear, branch or ring-type, saturated or undersaturated oxidation hydrocarbon chain, including such as methoxyl group, ethyoxyl, propoxyl group, isopropoxy, butoxy, tert-butoxy and amoxy.

" aryloxy group " or " aryloxy " refers to aryl-O-group, and wherein aryl is as described above, including the aryl replaced. Term as used herein " aryloxy group " can refer to phenoxy group or hexyl oxygen base, and the phenoxy group that replaces of alkyl, the alkyl of replacement, halogen or alkoxyl or hexyl oxygen base.

" aralkyl " refer to aryl-alkyl-, wherein aryl and alkyl are as described above, and can include replace aryl (and heteroaryl of heteroaryl and replacement) and replacement alkyl. Exemplary aralkyl includes but not limited to: benzyl, phenethyl, furfuryl, picolyl, pyridine ethyl and menaphthyl.

" aralkyl of replacement " refers to the aralkyl that wherein both the aryl moiety of aralkyl, moieties or aryl and moieties are replaced by one or more alkyl or aryl substituent groups.

" aralkyl oxy ", " aralkoxy " refer to aralkyl-O-, and wherein aralkyl is as described above. The aralkyl of aralkyl oxy can be heteroaryl. Exemplary aralkoxy is benzyloxy.

" whole haloalkyl " refers to alkyl as defined above, and each hydrogen atom being wherein connected with carbochain is all substituted by halogen. " perfluoroalkyl " refers to that whole haloalkyl, wherein said halogen are fluorine (that is ,-F), such as, but not limited to trifluoromethyl (that is ,-CF₃)��

" perhaloalkoxy groups " refers to-O-whole haloalkyl. Perhaloalkoxy groups includes but not limited to " perfluoro alkoxy " (that is ,-O-perfluoroalkyl). Exemplary perhaloalkoxy groups is trifluoromethoxy (that is ,-OCF₃) and tribromo methoxyl group (that is ,-OCBr₃)��

" alkyl amino " refers to-NRR ' group, wherein R and R ' be hydrogen, the alkyl of the alkyl that describes before or replacement, as long as at least one is not H in R and R '. Exemplary alkyl amino includes methylamino, tert-butylamino, ethylamino, isopropylamino, ethylmethylamino, dimethylamino and diethylamino.

" arylamino " refers to-NRR ' group, wherein R and R ' be hydrogen, the aryl of the aryl that describes before or replacement, as long as at least one is not H in R and R '. Exemplary arylamino include phenyl amino, rubigan amino, to Fluorophenylamino, a Fluorophenylamino, p-methoxyphenyl amino, p-trifluoromethyl phenyl amino etc.

" alkoxy carbonyl " refers to alkyl-O-C (=O)-group. Exemplary alkoxy carbonyl includes methoxycarbonyl, ethoxy carbonyl, butoxy carbonyl and tert-butoxycarbonyl.

" aryloxycarbonyl " refers to aryl-O-C (=O)-group. Exemplary aryloxycarbonyl includes phenoxy group-and naphthoxy-carbonyl.

" aromatic alkoxy carbonyl " refers to aralkyl-O-C (=O)-group. Exemplary aromatic alkoxy carbonyl is benzyloxycarbonyl group.

Term " amino " refers to-NH₂Group.

Term " carbonyl " refers to-C (=O)-group.

Term " carboxyl " refers to-C (=O) OH or-C (=O) O-group.

Term " acylamino-" refers to-C (=O) NR₂Group, each of which R is the aryl of H, alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl or replacement independently.

Term as used herein " halogen " or " halo " refer to fluorine, chlorine, bromine and iodine group.

Term " hydroxyl " refers to-OH group.

Term " nitro " refers to-NO₂Group.

Term " sulfenyl " refers to-SR group, and wherein R is the aryl of H, alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl or replacement.

When use term " independently selected from " time, mentioned substituent group (such as R, such as group R₁And R₂, or group X and Y) can be identical or different. Such as, R₁And R₂Can both be the alkyl of replacement or R₁Can be hydrogen and R₂It can be the alkyl etc. replaced.

Unless otherwise indicated herein, " R ", " R ' " of name or " X " group generally will have the structure corresponding with the group with described name that this area is approved. For the purpose of explaination, above-mentioned some representational " R " defined below and " X " group. These definition purposes for supplementing and explain, rather than get rid of; On the basis of the disclosure, these definition are apparent to those skilled in the art.

II. generally consider

Spectinomycin (MW332) is the lowest molecular weight member of aminoglycoside antibiotics. It optionally combines with the unique binding site (in the RNA spiral 34 in the header structure territory of 30S ribosomal subunit) in bacterial ribosome, blocks transposition blocking protein synthesis therewith. This is the position different from the binding site of other ribosome activity antituberculosis therapy agent (including streptomycin, kanamycin, capreomycin and Linezolid). Spectinomycin is mainly used as second line treatment and selects, and treats Diplococcus gonorrhoeae (Neisseriagonorrhoeae) and infect in the patient that more effective First Line clinically anti-eisseria therapeutic agent such as cephalosporins or fluoroquinolones are not tolerated. Referring toHolloway, TheMedicalClinicsofNorthAmerica, 66 (1), 169-173 (1982); WithNovak et al., Antimicrob.AgentsChemother., 34 (12), 2342-2347 (1990).

Due to discovery and the development of spectinomycin, have evaluated compound trospectomycin similar in structure and acmimycin clinically, wherein trospectomycin has been enter into III clinical trial phase, for treating general gram positive bacterial infection. Referring toGismondo etc.,DrugsExp.Clin.Res., 17 (2), 101-104 (1991). Spectinomycin, trospectomycin and acmimycin are shown below in chart 1.

The structure of chart 1. spectinomycin, trospectomycin and Acmimycin

III.3 '-acyl amino and 3 '-alkyl amino spectinomycin derivant

Theme disclosed by the invention relates in part to 3 '-deoxidation, 3 '-acyl amino and 3 '-deoxidation, 3 '-alkyl amino spectinomycin analog. In some embodiments, theme disclosed by the invention provides formula (I) compound or pharmaceutically acceptable salt thereof or prodrug:

Wherein

R₁And R₂It is each independently selected from but is not limited to H, alkoxy carbonyl and aromatic alkoxy carbonyl;

R₃It it is alkyl;

R₄It is independently selected from but not limited to H, hydroxyl, alkyl or alkoxyl; And

R₅Selected from but be not limited to alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl, the aryl of replacement and acyl group.

In some embodiments, R₁And R₂It is individually H. In some embodiments, R₁And R₂One of or both be nitrogen-protecting group group. Such as can be described according to the nitrogen-protecting group group that theme disclosed by the invention usesGreeneandWuts, ProtectiveGroupsinOrganicSynthesis, the third edition; NewYork, john wiley & sons, Inc., 1999. In some embodiments, R₁And/or R₂It is can with the alkoxy carbonyl of spectinomycin nitrogen-atoms formation carbamate or aromatic alkoxy carbonyl. In some embodiments, R₁And/or R₂It it is the group that can be removed by catalytic hydrogenation. Such as, various aromatic alkoxy carbonyls can be used for covering amino group, and can pass through catalytic hydrogenation (such as, using palladium catalyst) and remove. In some embodiments, R₁And/or R₂Being aromatic alkoxy carbonyl, it is selected from benzyloxycarbonyl group with by the benzyloxycarbonyl group of one or more halogens, alkoxyl and nitro replacement. This type of group include but not limited to benzyloxycarbonyl group (CBz), to methbxybenzyl-oxycarbonyl (Moz), to nitrobenzyloxycarbonyl (PNZ), to bromo-benzyloxycarbonyl, to benzyloxycarbonylchloride base, 2,4-dichloro benzyloxycarbonyl group and 3,4-dimethoxy-6-nitrobenzyloxycarbonyl. Other aromatic alkoxy carbonyl blocking group includes but not limited to diphenyl methyl oxygen base carbonyl, 5-benzisoxaAzoles ylmethyl oxygen base carbonyl (Bic) and 9-anthrylmethyl oxygen base carbonyl. In some embodiments, R₁And R₂Both are CBz.

In some embodiments, R₃It is C₁-C₈Alkyl (such as, methyl, ethyl, or the propyl group of side chain, straight chain or ring-type, butyl, amyl group, hexyl, heptyl or octyl group). In some embodiments, R₃It is methyl or butyl (such as, normal-butyl).

In some embodiments, R₄Selected from H, OH, methyl and methoxyl group. In some embodiments, R₄It it is hydroxyl.

In some embodiments, R₅It it is the aryl of alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl or replacement. In some embodiments, R₅Including heteroaryl or cycloalkyl (such as ,-CH₂-heteroaryl or-CH₂-cycloalkyl). In some embodiments, formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin (1419);

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin (1422);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin (1423);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin (1424); With

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin (1450);

Or its officinal salt or prodrug.

In some embodiments, R₅Being acyl group and formula (I) compound is 3 '-acyl amino spectinomycin derivant, it is also referred to as " spectinomycin amide ". Therefore, R₅Can have structure-C (=O) R₆, wherein R₆Aryl selected from alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl and replacement. In some embodiments, R₆It is or comprises heteroaryl.

In some embodiments, R₆Selected from heteroaryl, the heteroaryl of replacement, the phenyl of 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement is the phenyl that can classify as one or more following groups: the di-substituted-phenyl that the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl are replaced by alkylidene together with two of which phenyl carbons; And each of which R₈It is the aryl of aryl or replacement independently. In some embodiments, R₆Being alkyl, alkylaminoalkyl group or alkylaminoacyl, it is selected from-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅��

In some embodiments, R₆It is 2-fluorophenyl or 4-fluorophenyl. In some embodiments, R₆The heteroaryl of heteroaryl or replacement, wherein said heteroaryl selected from pyridine radicals, pyrimidine radicals, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. Work as R₆When being the heteroaryl replaced; described heteroaryl ring can be selected from following one or more substituent groups and replace: halogen, nitro, hydroxyl, amino, alkyl amino, arylamino, alkyl, alkoxyl, the alkyl (such as, whole haloalkyl) of replacement, perhaloalkoxy groups, aralkyl, aralkoxy, aryl, aryloxy group, the aryl of replacement, carboxyl, acyl group and acylamino-. Such as, heteroaryl substituent can be fluorine, chlorine, bromine, methyl, methoxyl group, NH₂��NO₂, trifluoromethoxy, phenyl, replacement phenyl (such as, the phenyl of halogen substiuted) or trifluoromethyl etc.

In some embodiments, R₆It is that there is-C (R₈)₂The Diarylmethylidene of structure, each of which R₈It is the aryl of aryl or replacement independently. Therefore, R₈Can be that phenyl or heteroaryl are (such as above for R₆One of described heteroaryl), the heteroaryl of the phenyl that replaces or replacement. In some embodiments, two R₈It it is all phenyl.

In some embodiments, R₆There is-CH₂R₇Structure, and formula (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof or prodrug:

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement can classify as one or more of: the di-substituted-phenyl that phenyl, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl and the two of which phenyl carbons that fluorine replaces is replaced by alkylidene together.

In some embodiments, R₇Being the heteroaryl of heteroaryl or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇Comprising heteroaryl, described heteroaryl is selected from pyridine radicals, thiazolyl, benzoAzoles base and benzothiazolyl.

In some embodiments, R₇It it is the heteroaryl replaced; wherein said heteroaryl is replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxyl, carboxyl, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Therefore, R₇Heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. In some embodiments, R₇Heteroaryl can replace by aryl or containing aromatic yl group so that R₇Making as a whole is biaryl (that is, R₇The aryl of heteroaryl and another aryl or replacement is directly connected to, or is connected with the aryl of another aryl or replacement by connector, described connector such as alkylidene (such as, methylene) ,-O-,-C (=O)-or-NH-). With R₇Heteroaryl connect containing aromatic yl group can be such as phenyl, benzyl, phenoxy group, benzoyl, halogen substiuted phenyl (such as; to fluorophenyl), alkoxyl replace phenyl (such as; m-methoxyphenyl) etc.; or the phenyl amino of phenyl amino or replacement (such as, halogen-, alkyl-, alkoxyl-, the phenyl amino of whole haloalkyl-or perhaloalkoxy groups-replacement).

In some embodiments, R₇Being the aralkyl of aralkyl or replacement, it includes the heteroaryl of heteroaryl or replacement. In some embodiments, the aralkyl of aralkyl or replacement can comprise selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇It is comprise pyridine radicals, thiazolyl, benzoThe aralkyl of azoles base or benzothiazolyl or the aralkyl of replacement. The heteroaryl moieties of aralkyl can be replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxycarboxyl group, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Such as, heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. Additionally, aralkyl R₇Moieties also can be replaced by such as alkyl, acyl group, amino, acyl amino, halogen, hydroxyl or other alkyl substituents.

In some embodiments, R₇Being nitrogen-containing hetero aryl, it is optionally replaced by one or more aryl substituents. In some embodiments, the atom adjacent (that is, in 2-position) that at least one nitrogen-atoms of nitrogen-containing hetero aryl connects with the Acylmethylene group directly and in formula (Ia) structure. In some embodiments, formula (Ia) compound is compound or pharmaceutically acceptable salt thereof or the prodrug of formula (Ib), (Ic) or (Id):

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂, alkyl, the alkyl of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, the aralkyl of replacement, aralkoxy, aryl (such as, phenyl or heteroaryl), aryloxy group, acyl group (such as, aroyl) and the aryl (such as, the phenyl of the heteroaryl of replacement or replacement) that replaces; Or wherein R₉And R₁₀Together or R₁₁And R₁₂It is alkylidene (such as ,-CH=CH-CH=CH-) together; And

Each of which R₁₅Independently selected from H, alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl (such as, phenyl or heteroaryl) and the aryl (such as, the heteroaryl of the phenyl of replacement or replacement) that replaces.

In some embodiments, R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄In at least one is N (R₁₅)₂, for instance, one of them R₁₅It it is the aryl of aryl or replacement. In some embodiments, R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄In at least one is the aryl of aryl or replacement.

In some embodiments, described compound is formula (Ib) compound, wherein X₁It is CH, and wherein R₁₀It not H (such as, wherein R₁₀Selected from aryl, the aryl of replacement, halogen or nitro). In some embodiments, described compound is formula (Id) compound, wherein X₃It is S and R₁₃It is H. In some embodiments, R₁₄It is N (R₁₅)₂��

In some embodiments, formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin (1299);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin (1329);

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin (1364);

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin (1365);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin (1367);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin (1368);

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin (1370);

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin (1399);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin (1400);

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin (1411);

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin (1412);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin (1413);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin (1439);

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin (1443);

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin (1444);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin (1445);

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin (1447);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin (1448)

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin (1449);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrazine-2-base) formamido group spectinomycin (1453);

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin (1465);

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin (1466);

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin (1487);

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin (1489);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin (1490);

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin (1491);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-fluorobenzene-1-base) formamido group spectinomycin (1492);

3 '-dihydro-3 '-deoxidation-4 (R)-(2,2-diphenyl) acetylamino spectinomycin (1514);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin (1516);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin (1517);

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin (1518);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin (1519);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin (1520);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin (1535);

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin (1536);

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin (1537);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin (1538);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin (1539);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin (1540);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin (1541);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin (1542);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin (1543);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin (1544);

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin (1351);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin (1369);

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin (1485);

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-methyl] butyrylamino spectinomycin (1486);

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-(2-aminoacetylamino)-3-phenyl] propionyl-amino spectinomycin (1502);

3 '-dihydro-3 '-deoxidation-4 (R)-3-benzamido propanoylamino spectinomycin (1503); And

3 '-dihydro-3 '-deoxidation-4 (R)-3-(2-phenylacetamido) propanoylamino spectinomycin (1504);

Or its officinal salt or prodrug.

In some embodiments, compared with spectinomycin, formula (I) compound has the cellular uptake entering mycobacterium tuberculosis, other antibacterials or infected host tissue of rising. In some embodiments, compared with spectinomycin, described compound has better bioavailability after oral administration. In some embodiments, compared with spectinomycin, described compound have raising to the ribosomal affinity of mycobacterium tuberculosis 30S. In some embodiments, compared with spectinomycin, the discharge susceptibility being discharged mechanism by medicine is reduced by described compound.

IV. prodrug

In some representational embodiments, compound disclosed herein is prodrug. Prodrug means such compound, after being applied to receiver, and its compound that (directly or indirectly) theme disclosed by the invention can be provided or its active metabolite or residue. When this compounds is applied to experimenter, prodrug can increase the bioavailability (such as by making Orally administered compound more easily absorb to blood) of the compound of theme disclosed by the invention, maybe can improve compound to particular organisms compartment (such as, cell, tissue, biosystem) delivery.

The ester that the prodrug of the compound of disclosure of the invention can include the reaction of one of hydroxyl of formula (I), (Ia), (Ib), (Ic) and/or (Id) compound and carboxylic acid halides, anhydride or Acibenzolar (such as, pentafluorophenyl group ester) and be formed. The esterase that the ester of prodrug can pass through to be present in blood plasma or tissue cracks in vivo, or can be hydrolyzed in aqueous conditions at physiological ph. The prodrug of the compound of disclosure of the invention also may be formed: by derivative to the amino of formula (I), (Ia), (Ib), (Ic) and/or (Id) compound or hydroxyl to form carbamate, carbonic ester, phosphate ester, azo group or amide, it can cracking under physiological condition (such as, at specific pH or pass through enzyme).

V. officinal salt

Compound described herein can be used as officinal salt. Officinal salt is such as described inBerge etc.,(J.Pharm.Sci., 66 (1), 1-19 (1977)), which is hereby incorporated by reference for it. Term " pharmaceutically acceptable " can relate to pharmaceutically useful salt (or carrier) in people.

Officinal salt includes but not limited to gluconate, lactate, acetate, tartrate, citrate, phosphate, maleate, borate, nitrate, sulfate and hydrochlorate. The salt of compound described herein can such as be prepared by making alkali cpd and desired acid react in the solution. After having reacted, be not dissolved in solvent therein by adding proper amount of described salt, thus from solution crystal salt. In some embodiments, by making hydrogen chloride gas pass through the alcoholic solution of free alkali thus preparing hydrochlorate. In some embodiments, officinal salt is hydrochlorate or hydrobromate.

VI. the method that treatment microorganism is infected

In some embodiments, theme disclosed by the invention relates to the method that treatment microorganism is infected in the experimenter having treatment needs, wherein said method includes using spectinomycin derivant (such as to experimenter, formula (I), (Ia), (Ib), (Ic) and/or (Id) compound, or its prodrug and/or officinal salt).

Can can be caused by various microorganisms by the infection that theme disclosed by the invention is treated, including fungus, algae, protozoacide, antibacterial and virus. in some embodiments, described infection is that antibacterial infects. can be infected by the exemplary antibacterial that the method for theme disclosed by the invention is treated includes but not limited to by the following infection caused: staphylococcus aureus (Staphylococcusaureaus), enterococcus faecalis (Enterococcusfaecalis), anthrax bacillus (Bacillusanthracis), the species (Streptococcusspecies) of Streptococcus are (such as, streptococcus pyogenes (Streptococcuspyogenes) and streptococcus pneumoniae (Streptococcuspneumoniae)), escherichia coli (Escherichiacoli), bacillus pyocyaneus (Pseudomonasaeruginosa), Bulbus Allii Cepae Bai Huoerde bacillus (Burkholderiacepacia), the species (Proteusspecies) of Proteus are (such as, proteus mirabilis (Proteusmirabilis) and proteus vulgaris (Proteusvulgaris)), klebsiella pneumoniae (Klebsiellapneumoniae), Acinetobacter baumannii (Acinetobacterbaumannii), addicted to maltose Stenotrophomonas (Strenotrophomonasmaltophillia), mycobacterium tuberculosis (Mycobacteriumtuberculosis), Mycobacterium bovis (Mycobacteriumbovis), other mycobacterias of tuberculosis complex, and non-tuberculous mycobacteria, including mycobacterium buruli (Mycobacteriumulcerans).

The method of disclosure theme can be used for treating these diseases, because they suppress the generation of disease, development or diffusion, cause disappearing of disease, cure disease, or otherwise improve suffer from, the risky general health of patient suffered from or infect described disease. Therefore, according to theme disclosed by the invention, term " treatment " and grammatical variants and phrase " Therapeutic Method " thereof are intended to include any desired Results, the method including but not limited to the infection existed in treatment experimenter, and prevention is (namely, prevent) method that infects, such as it is being exposed to microorganism disclosed herein or expection by the experimenter that is exposed under microorganism disclosed herein.

In some embodiments, being used for being administered orally, the pharmaceutical preparation of intravenous, intramuscular, nose or local application provides spectinomycin derivant. Therefore, in some embodiments, described preparation can be prepared for dosage form, such as, but not limited to tablet, capsule, liquid agent (solution or suspension), suppository, ointment, ointment or aerosol. In some embodiments, theme disclosed by the invention provides the described compound and/or preparation that have been lyophilized, and its restructural forms pharmaceutical preparations, for such as being used by intravenous or intramuscular injection.

In some embodiments, spectinomycin derivant is before one or more other treatment compounds, be subsequently or simultaneously applied to experimenter. Other treatment compound can be known Antimicrobe compound or the therapeutic agent (such as, anti-inflammatory compound) reducing pain and/or fever. Such as, other treatment compound can be antibiotic, such as penicillin, for instance benzylpenicillin, penicillin V, methicillin, oxazacillin, carbenicillin, nafcillin, ampicillin etc.; Cephalosporin, for instance cefaclor, cefazolin sodium, cefuroxime, latamoxef etc.; Carbapenem; Monobactam antibiotic; Tetracycline; Macrolide; Lincomycin; Polymyxin; Sulfonamides class; Quinolinones; Cloramphenical; Metronidazole; Trimethoprim; Vancomycin; Streptomycin etc. In some embodiments, other compound is known antitubercular compounds, such as, but not limited to isoniazid, ethambutol and rifampicin (that is, Rifampicin).

In some embodiments, described spectinomycin derivant has the selective active that anti-particular type antibacterial infects. Such as, in some embodiments, described compound has the selective active of anti-following bacterium: mycobacterium tuberculosis, anthrax bacillus, enterococcus faecalis, streptococcus pneumoniae, Acinetobacter baumannii or addicted to maltose Stenotrophomonas. " selective active " means described compound and demonstrates the activity infecting higher anti-particular type infection than anti-other types. In some embodiments, the activity that its anti-another type of specific activity that the anti-a kind of type of described compound infects infects is high by 2,5,10,20,50,100 or more times, as by measured by minimal inhibitory concentration (MIC).

In some embodiments, the infection including being caused by the mycobacteria including biological mycobacterium tuberculosis is infected in microorganism. In some embodiments, described infection is caused by the multidrug resistance strain of mycobacterium tuberculosis. Infect and also can be caused by other mycobacterias, include but not limited to: Mycobacterium bovis (M.bovis); Other mycobacterias of tuberculosis complex (such as, mycobacterium africanum (M.africanum), M.canetti, mycobacterium microti (M.microti)); Or non-tuberculous mycobacteria, such as, but not limited to mycobacterium buruli (M.ulcerans), mycobacterium avium-intracellulare (M.aviumintracellulare), mycobacterium kansasii (M.kansasii), Mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonei (M.chelonae), Mycobacterium leprae (M.leprae).

In some embodiments, spectinomycin derivant is applied to the experimenter that there is microorganism infection. In some embodiments, the recurrence that spectinomycin derivant infects or prophylaxis of microbial infects prophylactically is used with prophylaxis of microbial. Therefore, in some embodiments, spectinomycin derivant is prophylactically used with prevention or the generation reducing one below: (a) microorganism in the experimenter having infection risk is infected; B recurrence that () microorganism is infected; And (c) its combination.

In some embodiments, theme disclosed by the invention provides the method that treatment antibacterial infects in the experimenter having treatment to need, and wherein said method includes using formula (I) compound or pharmaceutically acceptable salt thereof or prodrug to experimenter:

Wherein

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

In some embodiments, R₁And R₂It is individually H. In some embodiments, R₃It is C₁-C₈Alkyl (such as, methyl, ethyl, or the propyl group of side chain, straight chain or ring-type, butyl, amyl group, hexyl, heptyl or octyl group). In some embodiments, R₃It is methyl or butyl (such as, normal-butyl). In some embodiments, R₄Selected from H, OH, methyl and methoxyl group. In some embodiments, R₄It it is hydroxyl.

In some embodiments, formula (I) compound is spectinomycin amide (that is, wherein R₅It is acyl group). In some embodiments, R₅It is-C (=O) R₆, wherein R₆Aralkyl selected from alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl and replacement. In some embodiments, R₅It is-C (=O) R₆, wherein:

(a)R₆Selected from-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(b)R₆Selected from heteroaryl, the heteroaryl of replacement, the phenyl of 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the di-substituted-phenyl that the phenyl of wherein said replacement is replaced by alkylidene together with two of which phenyl carbons selected from the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl; And wherein R₈It is the aryl of aryl or replacement independently;

Or its officinal salt or prodrug.

In some embodiments, R₆It is 2-fluorophenyl or 4-fluorophenyl. In some embodiments, R₆The heteroaryl of heteroaryl or replacement, wherein said heteroaryl selected from pyridine radicals, pyrimidine radicals, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. Work as R₆When being the heteroaryl replaced; described heteroaryl ring can be selected from following one or more substituent groups and replace: halogen, nitro, hydroxyl, amino, alkyl amino, arylamino, alkyl, alkoxyl, the alkyl (such as, whole haloalkyl) of replacement, perhaloalkoxy groups, aralkyl, aralkoxy, aryl, aryloxy group, the aryl of replacement, carboxyl, acyl group and acylamino-. Such as, heteroaryl substituent can be fluorine, chlorine, bromine, methyl, methoxyl group, NH₂��NO₂, trifluoromethoxy, phenyl, replacement phenyl or trifluoromethyl etc.

In some embodiments, R₆It is that there is structure-C (R₈)₂Diarylmethylidene, each of which R₈It is the aryl of aryl or replacement independently. Therefore, R₈Can be phenyl or heteroaryl (such as above-mentioned for R₆One of described heteroaryl), the heteroaryl of the phenyl that replaces or replacement. In some embodiments, two R₈It it is all phenyl.

In some embodiments, R₆There is structure-CH₂R₇, and formula (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof or prodrug:

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement is selected from: the di-substituted-phenyl that phenyl, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl and the two of which phenyl carbons that fluorine replaces is replaced by alkylidene together.

In some embodiments, R₇Being the heteroaryl of heteroaryl or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇Comprise selected from pyridine radicals, thiazolyl, benzoThe heteroaryl of azoles base and benzothiazolyl.

In some embodiments, R₇It it is the heteroaryl replaced; wherein said heteroaryl is replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxyl, carboxyl, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Therefore, R₇Heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. In some embodiments, R₇Heteroaryl replaces by aryl or containing aromatic yl group so that R₇Making as a whole is biaryl (that is, R₇The aryl of heteroaryl and another aryl or replacement is directly connected to, or is connected with the aryl of another aryl or replacement by connector, described connector such as alkylidene (such as, methylene) ,-O-,-C (=O)-or-NH-). With R₇Heteroaryl connect containing aromatic yl group can be such as phenyl, benzyl, phenoxy group, benzoyl, halogen substiuted phenyl (such as; to fluorophenyl), alkoxyl replace phenyl (such as; m-methoxyphenyl) etc.; or the phenyl amino of phenyl amino or replacement (such as, halogen-, alkyl-, alkoxyl-, the phenyl amino of whole haloalkyl-or perhaloalkoxy groups-replacement).

In some embodiments, R₇Being the aralkyl of aralkyl or replacement, it comprises the heteroaryl of heteroaryl or replacement. In some embodiments, the aralkyl of aralkyl or replacement can comprise selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇It is comprise pyridine radicals, thiazolyl, benzoThe aralkyl of azoles base or benzothiazolyl or the aralkyl of replacement. The heteroaryl moieties of aralkyl can be replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxyl, carboxyl, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Such as, heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. Additionally, aralkyl R₇Moieties also can be replaced by such as alkyl, acyl group, amino, acyl amino, halogen, hydroxyl or other alkyl substituents.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂, alkyl, the alkyl of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, the aralkyl of replacement, aralkoxy, aryl (such as, phenyl or heteroaryl), aryloxy group, acyl group (such as, aroyl) and the aryl (such as, the heteroaryl of the phenyl of replacement or replacement) that replaces; Or wherein R₉And R₁₀Together or R₁₁And R₁₂It is alkylidene (such as ,-CH=CH-CH=CH-) together; And

In some embodiments, formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin (1364);

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin (1365);

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin (1412);

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin (1448);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin (1369);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin (1424); And

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin (1450);

Or its officinal salt or prodrug.

In some embodiments, oral, locally, intravenous or use described compound by suction. In some embodiments, before using formula (I) compound, other treatment compound is used to experimenter after or during the period.

In some embodiments, infection is the infection of gram-positive bacterium, such as, but not limited to mycobacterial infections, infection due to Bacillus anthracis, enterococcus faecalis and streptococcus pneumoniae infection.

In some embodiments, infection is infection due to Bacillus anthracis, and formula (I) compound is selected from: 3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin (1368), 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin (1443) or 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin (1444).

In some embodiments, infection is streptococcus pneumoniae infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin (1541);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyphenyl) acetylamino spectinomycin (1446); And

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-phenyl] propanoylamino spectinomycin (1515).

In some embodiments, infection is that enterococcus faecalis infects, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin (1542); And

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin (1543).

In some embodiments, infection is m tuberculosis infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin (1465)

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl amino) thiazole-4-yl) acetylamino spectinomycin (1520);

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin (1543); And

Or its officinal salt or prodrug.

VII. the method treating tuberculosis

It is believed that the disclosure shows that 3 '-amino spectinomycin derivant and 3 '-acyl amino spectinomycin derivant are effective in treatment tuberculosis infections relating first. Therefore, in some embodiments, theme disclosed by the invention provides the method treating tuberculosis in the experimenter having treatment to need, and wherein said method includes formula (I) compound or pharmaceutically acceptable salt thereof or the prodrug of using effective dose to experimenter:

Wherein

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

Therefore, the method of theme disclosed by the invention can be used for treating these tuberculosis, because they suppress TB generation, development or diffusion infected, causes what TB infected to disappear, cure TB to infect, or otherwise improve suffer from, the risky general health of experimenter suffered from or infect tuberculosis.

In some embodiments, R₅It is the alkyl comprising heteroaryl or cycloalkyl or aralkyl (such as ,-CH₂-heteroaryl or-CH₂-cycloalkyl). In some embodiments, R₅It it is the aralkyl of the replacement of the phenyl comprising replacement.

In some embodiments, R₅It is acyl group and there is structure-C (=O) R₆, wherein R₆Aryl selected from alkyl, the alkyl of replacement, aralkyl, the aralkyl of replacement, aryl and replacement.

In some embodiments, R₆It is selected from :-CH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂,-CH (CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅With-CH₂CH₂NHC (=O) CH₂C₆H₅��

In some embodiments, R₆Selected from heteroaryl, the heteroaryl of replacement, the phenyl of 2-replacement, the phenyl of 4-halogen substiuted ,-CH₂R₇With-C (R₈)₂; Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement can be characterized as following one or more: the di-substituted-phenyl that the phenyl of fluorine replacement, the phenyl of alkyl replacement, the phenyl of 2-replacement, the mono-substituted phenyl of 3-, 2,3-dibasic phenyl are replaced by alkylidene together with two of which phenyl carbons; And each R₈It is the aryl of aryl or replacement independently.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl; And

In some embodiments, R₇It it is the heteroaryl replaced; wherein said heteroaryl is replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxyl, carboxyl, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Such as, R₇Heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. In some embodiments, R₇Heteroaryl replaces by aryl or containing aromatic yl group so that R₇Making as a whole is biaryl (that is, R₇The aryl of heteroaryl and another aryl or replacement is directly connected to, or is connected with the aryl of another aryl or replacement by connector, described connector such as alkylidene (such as, methylene) ,-O-,-C (=O)-or-NH-). With R₇Heteroaryl connect containing aromatic yl group can be such as phenyl, benzyl, phenoxy group, benzoyl, halogen substiuted phenyl (such as; to fluorophenyl), alkoxyl replace phenyl (such as; m-methoxyphenyl) etc. or phenyl amino or replacement phenyl amino (such as, halogen-, alkyl-, alkoxyl-, the phenyl amino of whole haloalkyl-or perhaloalkoxy groups-replacement).

In some embodiments, R₇Being the aralkyl of aralkyl or replacement, it comprises the heteroaryl of heteroaryl or replacement. In some embodiments, the aralkyl of aralkyl or replacement can comprise selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl. In some embodiments, R₇It is comprise pyridine radicals, thiazolyl, benzoThe aralkyl of azoles base or benzothiazolyl or the aralkyl of replacement. The heteroaryl moieties of aralkyl can be replaced by one or more following groups: the aryl of amino, alkyl amino, arylamino, nitro, halogen, hydroxycarboxyl group, acyl group, alkyl, the alkyl (such as, whole haloalkyl) of replacement, alkoxyl, perhaloalkoxy groups, aralkyl, aryl, aryloxy group and replacement. Such as, heteroaryl can by one or more fluorine, chlorine, bromine, methoxyl group, methyl, NO₂, trifluoromethoxy, phenyl amino, phenyl or trifluoromethyl replace. Additionally, aralkyl R₇Moieties also can be replaced by such as alkyl, acyl group, amino, acyl amino, halogen, hydroxyl or other alkyl substituents.

Wherein:

R₃It it is alkyl;

R₄It is H, hydroxyl, alkyl or alkoxyl;

X₁It is CH or N;

X₂And X₃It is O, S or NH;

In some embodiments, described compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin (1364);

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin (1365);

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin (1412);

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-phenyl] propanoylamino spectinomycin (1515);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin (1369);

3 '-dihydro-3 '-deoxidation-4 (R)-dodecanoylamino spectinomycin (1366);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-amino)-propanoylamino spectinomycin (1469);

3 '-dihydro-3 '-deoxidation-4 (R)-phenylacetamido spectinomycin (1398);

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butylamino spectinomycin (1420);

3 '-dihydro-3 '-deoxidation-4 (R)-dodecylamino spectinomycin (1421);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin (1424);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methyl) benzylamino spectinomycin (1425);

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin (1450);

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyphenyl) acetylamino spectinomycin (1446);

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-aminopropionyl amino spectinomycin (1467); And

3 '-dihydro-3 '-deoxidation-4 (R)-(2-amino) acetylamino spectinomycin (1470);

Or its officinal salt or prodrug.

Described compound can be used by any applicable approach: oral, locally, intravenous etc. In some embodiments, orally or through sucks and uses described compound.

In some embodiments, other therapeutic compound (such as, with formula (I) compound simultaneously, or before or after formula (I) compound) is used to experimenter. In some embodiments, other treatment compound is the therapeutic compound (such as, anti-inflammatory compound) that antibiotic maybe can reduce pain and/or fever. Antibiotic includes but not limited to: penicillins is benzylpenicillin, penicillin V, methicillin, oxazacillin, carbenicillin, nafcillin, ampicillin etc. such as; The penicillins combined with beta lactamase restrainer; Cephalosporin, for instance cefaclor, cefazolin sodium, cefuroxime, latamoxef etc.; Carbapenem; Monobactam antibiotic; Aminoglycoside; Tetracyclines; Macrolide; Lincomycin class; Polymyxins; Sulfonamides class; Quinolones; Cloramphenical; Metronidazole; Trimethoprim; Vancomycin; Streptomycin etc. In some embodiments, other treatment is antitubercular compounds, such as, but not limited to isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

In some embodiments, prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below: (a) has the m tuberculosis infection of the experimenter of infection risk; The recurrence of (b) m tuberculosis infection; And (c) its combination. In some embodiments, formula (I) compound is used to treat the m tuberculosis infection existed. In some embodiments, use described compound with treatment, prevention or reduce with other mycobacterias of tuberculosis complex (such as, mycobacterium africanum, M.canetti, mycobacterium microti) or the generation of infection be correlated with of Mycobacterium bovis.

Can pass through multiple technologies such as Sputum smears, chest x-ray, (namely Tuberculin skin is tested, awns Tu Shi (Mantoux) test) and/or the existence (such as, chest pain, hemoptysis, fever, night sweat, poor appetite, fatigue etc.) of other clinical symptoms determine the experimenter suffering from mycobacterium tuberculosis or other tuberculosis infections relatings. If required, from thinking experimenter separation of bacterial RNA, DNA or protein of suffering from TB, can analyze by means commonly known in the art, and compared with the known nucleic acid of bacteria RNA, DNA or protein or aminoacid sequence.

In some embodiments, use formula (I) compound to treat the infection of the multidrug resistance bacterial strain (that is, the bacterial strain to two or more previously known antituberculotics such as isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin drug resistance) of mycobacterium tuberculosis.

In some embodiments, formula (I), (Ia), (Ib), (Ic) and/or (Id) compound has 25 �� g/mL or less against mycobacterium tuberculosis minimal inhibitory concentration (MIC). MIC can determine by means commonly known in the art, for instance, asHurdle etc.,J.Antimicrob.Chemother., 62 (5), described in 1037-1045 (2008).

VIII. pharmaceutical preparation

Formula (I), (Ia), (Ib), (Ic) and (Id) compound, its officinal salt, corresponding to the prodrug of formula (I), (Ia), (Ib), (Ic) and (Id) compound and officinal salt thereof in this article referred to as " reactive compound ". The pharmaceutical preparation that comprises above-mentioned reactive compound is also provided herein. These pharmaceutical preparatioies are included in the reactive compound as described herein in pharmaceutically suitable carrier. Pharmaceutical preparation can be prepared for being administered orally, intravenous, intramuscular, local or aerosol are used, as will be discussed in greater detail below. Preparation can prepare into dosage form, such as, but not limited to tablet, capsule, liquid agent (solution or suspensoid), suppository, ointment, ointment or aerosol. And, theme disclosed by the invention provides the described reactive compound being lyophilized, and its restructural forms pharmaceutical preparations, for such as being used by intravenous or intramuscular injection.

Therapeutically effective amount or the dosage of its purposes any particular active compounds within the embodiments described herein scope will have some to distinguish between compound and compound and between patient and patient, and will depend upon which disease and the route of delivery of patient. As general recommendations, the dosage of about 0.1 to about 50mg/kg will have treatment effect, and all of which weight is based on the weight of reactive compound and calculates, including also such when using salt. Higher levels of toxicity considers intravenous dosages can be limited in more low-level, such as at most about 10mg/kg, and all of which weight is based on the weight of the alkali of described activity and calculates, including also such when using salt. The dosage of about 10mg/kg to about 50mg/kg can be used for Orally administered. Usually, the dosage of about 0.5mg/kg to about 5mg/kg can be used for intramuscular injection. For administered intravenously or orally, representational dosage is 1 ��m of ol/kg to 50 ��m of ol/kg, and optional 22 ��m of ol/kg and 33 ��m of ol/kg compounds.

The persistent period for the treatment of is usually once a day or twice, continues two to three time-of-weeks, or until disease is substantially controlled. Use with the lower dosage preventability that lower frequency gives with prevention or the generation reducing infection and recurrence.

For local application, the preparation of the reactive compound comprising about 0.05 to about 5% weight can be prepared (such as, solution, paste, ointment, ointment, ointment etc.), it can daily one or many, continue for some time (such as, one week, two weeks or three weeks) or until disease is substantially controlled.

According to the inventive method, pharmaceutical active compounds described herein can be used as solid or as liquid oral, or can use as solution, suspensoid or Emulsion intramuscular or intravenous. Alternatively, described compound or salt are alternatively arranged as liposome turbid liquor by suction, intravenous or intramuscular administration. When being used by suction, reactive compound or salt should be the form of many solid particles or droplet, and described granule or droplet have the particle diameter of about 0.5 to about 5 micron and preferably about 1 to about 2 micron.

The pharmaceutical preparation being suitable for intravenous or intramuscular injection is other embodiments provided herein. Described pharmaceutical preparation is included in formula described herein (I), (Ia), (Ib), (Ic) and/or (Id) compound in any pharmaceutically suitable carrier, prodrug described herein or its officinal salt. If needing solution, then water be with regard to can be selected for water soluble compounds or salt carrier. Just can for water soluble compounds or salt, it is suitable that the such as organic solvent of glycerol, propylene glycol, Polyethylene Glycol or its mixture is probably. In the latter case, described organic solvent can contain remarkable amounts of water. In either case, solution then all can with appropriate method sterilizing well known in the art, and typically via 0.22-zut filter. After sterilizing, solution can be distributed to suitable container, in the vial of such as depyrogenation. Described distribution completes preferably by aseptic procedure. Then sterile enclosure can be placed on bottle, and if desired, can lyophilizing vial content.

Except formula (I), (Ia), (Ib), (Ic) and/or (Id) compound or their salt or prodrug, described pharmaceutical preparation also can contain other additives, such as pH adjusting agent. Specifically, useful pH adjusting agent includes acid, all example hydrochloric acids; Alkali or buffer agent, such as sodium lactate, sodium acetate, sodium phosphate, sodium citrate, sodium borate or gluconic acid sodium salt. Additionally, described preparation also can contain anti-microbial preservative. Useful anti-microbial preservative includes methyl hydroxybenzoate, nipasol and benzyl alcohol. When being placed in by preparation in the bottle being designed as multiple dose use, generally use anti-microbial preservative. Pharmaceutical preparation described herein can apply technology lyophilizing well known in the art.

In the still another embodiment of theme described herein, providing injectable, stable, sterile preparation, it is included in formula (I), (Ia), (Ib), (Ic) and/or (Id) compound or its salt in the unit dosage forms sealed in container. Described compound or salt provide with the form of lyophilized products, and described lyophilized products with suitable pharmaceutically suitable carrier reconstruct, can be suitable to be injected to the liquid preparation of experimenter to be formed. Described unit dosage forms generally comprises about 10mg extremely about 10g compound salt. When described compound or salt are substantially insoluble in, can apply and present in an amount at least sufficient to the acceptable emulsifying agent of the physiology of the q.s of compound described in emulsifying or salt in aqueous carrier. This type of useful emulsifying agent a kind of is phosphatidylcholine.

Other drug preparation can be prepared, such as aqueous base Emulsion from water-fast compound or its salt disclosed herein. In such cases, described preparation is by the pharmaceutically acceptable emulsifying agent containing q.s, with the described compound or its salt of emulsified phase desired amount. The emulsifying agent being particularly useful includes phosphatidylcholine and lecithin.

Other embodiments provided herein include the Liposomal formulation of reactive compound disclosed herein. The technology forming liposome turbid liquor is well known in the art. When compound be can water-soluble salt time, the liposome technology that application is conventional, described salt can be mixed in lipid capsule. In such cases, due to the water solublity of reactive compound, described reactive compound is by the hydrophilic centre or the core that are mainly entrained in liposome. The lipid layer used can have any conventional composition, and can be able to be maybe without cholesterol containing cholesterol. When reactive compound interested is water insoluble, application conventional liposome forms technology again, and described salt can mainly be entrained in the hydrophobic lipid bilayer forming described liposome structure. In either case, the size of produced liposome can be reduced, as by use standard sonication and homogenisation techniques.

Lyophilization can comprising the Liposomal formulation of reactive compound disclosed herein, to produce lyophilized products, it can use pharmaceutically suitable carrier of such as water to reconstruct, to regenerate liposome turbid liquor.

Additionally provide and be adapted as aerosol partly or by sucking the pharmaceutical preparation used. These preparations can comprise solution or the suspension of desired compound described herein or its salt or many solid particles of described compound or salt. Desired preparation can be placed in little chamber and be atomized. Atomization by compressing air or can be completed by ultrasonic energy, to form many droplets or the solid particle comprising described compound or salt. Described droplet or solid particle should have the particle diameter of about 0.5 to about 10 micron, more preferably from about 0.5 to about 5 micron. Solid particle can obtain by processing solid chemical compound or its salt with any appropriate method well known in the art, is such as obtained by micronization. Most preferably, the size of solid particle or droplet would be about 1 to about 2 micron. At this on the one hand, available commercial nebulizers realizes this purpose. Described compound can be used by the aerosol suspension of inhalable particles with the method for United States Patent (USP) 5,628,984, and which is hereby incorporated by reference for described disclosure.

When being adapted as pharmaceutical preparation that aerosol uses and being liquid form, described preparation can be included in the water soluble reactive compound in aqueous carrier. Can there is surfactant, which reduce the surface tension of preparation, when being atomized, it is enough to the droplet resulting within the scope of desired size.

As noted, it is provided that can water-soluble and water-fast reactive compound. Term as used herein " can be water-soluble " intent definition can with the amount of about 50mg/mL or higher any component soluble in water. And, term as used herein " water insoluble " intent definition has any component of the dissolubility in water less than approximately 20mg/mL. In some embodiments, can water soluble compounds or salt be probably desired, and in other embodiments, water-fast compound or salt are also likely to be desired.

In theme disclosed by the invention, the experimenter for the treatment of is contemplated to be people experimenter in its many embodiments, it is to be understood that method described herein is all effective for all invertebrate species, all invertebrate species are all intended to be included in term " experimenter ". Method described herein is used especially for treatment and/or the infectious disease of prevention warm-blooded vertebrate. Therefore, described method can be used as the treatment of mammal and birds.

More specifically, provided herein is mammiferous treatment, the such as mankind, and due to endangered (such as siberia tiger), Economic Importance (raise in farm for the animal of human consumption) and/or social importance (as house pet or at the zoo in domesticated animal) and those mammals that the mankind are critically important, such as, carnivore (such as cat and Canis familiaris L.) outside people, pig (swine) (piglets (pig), pig (hog), wild boar), ruminant (such as cattle (cattle), cattle (oxen), sheep, Llama, giraffe, deer, goat, wild ox and camel) and horse. the treatment of birds is also provided herein, including in endangered, the zoo for the treatment of or as raising pets (such as, Psittacula alexandri fasciata) those birds, and birds, the birds more particularly raised and train, i.e. poultry, such as turkey, chicken, duck, goose, guinea fowl etc., because they are also economically important for human. therefore, the embodiment of method described herein includes domestic animal and includes but not limited to the treatment of the pig (swine) (piglets (pig), pig (hog)) of domestication, ruminant, horse, poultry etc.

Embodiment

It is included into following example in the way of setting forth subject matter disclosed herein. Mean level according to the disclosure and those skilled in the art, it would be recognized by those skilled in the art that the purpose of following example is merely illustrative of, and when without departing substantially from the scope of theme disclosed by the invention, can carry out many changes, modification and amendment.

Embodiment 1

The synthesis of spectinomycin analog

Conventional method: 3 '-deoxidation, 3 '-acyl amino disclosed by the invention and 3 '-deoxidation 3 ' (R)-alkyl amino spectinomycin synthesize according to those the similar methods described before. Referring toWoitun etc.J.Antibiot (Tokyo), 34 (1), 22-27 (1981); AndMaier etc., J.Antibiot (Tokyo), 34 (1), 16-21 (1981). 1,3-benzyloxy carbonyl-3 ' (R)-amino spectinomycin synthesizes with two steps as shown in Figure 1 from spectinomycin dihydrochloride pentahydrate. First, water is applied benzyl chloroformate and NaHCO₃, with carboxybenzyl (CBz), the methyl secondary amine in A ring is protected as Benzylcarbamate. Then, with ammonium nitrate and sodium cyanoborohydride in methanol to shielded intermediate product reduction amination, it is thus achieved that 3 '-deoxidation-3 '-aminoderivative.

Then pass through application HBTU in dichloromethane by described amine and various acid couplings, thus using it for synthesis target 3 '-acyl amino spectinomycin derivant. Referring to Fig. 1. Then pass through using palladium carbon (Pd/C) catalytic hydrogenation 2 hours thus removing CBz group, to provide purposed amide. For the aryl side chains that the hydrogenolytic conditions being used for removing CBz group is sensitive, application is exposed to HBr48% aqueous solution 2 hours alternatively, to provide the end-product of deprotection.

3 '-deoxidation-3 '-alkyl amino spectinomycin derivant is obtained by two approach: for simple alkyl substituent group, by TFA and twoNaBH is applied under the existence of alkane₄Reduce corresponding two-CBz protection amide (referring to Fig. 1); Or by applying PtO₂Catalytic hydrogenation aryl aldehyde direct-reduction alkylation 1,3-bis-benzyloxycarbonyl group 3 ' (R)-amino spectinomycin. Referring to Fig. 2. Two kinds of methods are all applied Pd/C catalytic hydrogenation subsequently and are carried out CBz deprotection in two hours, to provide target 3 '-deoxidation 3 ' (R)-alkyl amino spectinomycin.

The conventional method of synthesis 3 '-deoxidation, 3 '-acyl amino spectinomycin: to the CH of the acid (3mmol) selected by stirring₂Cl₂(10mL) add HBTU (3mmol) with in DIPEA (6mmol) solution, and at room temperature stir mixture 1h. It is subsequently adding 6,8-bis-benzyloxycarbonyl groups 4 (R)-amino spectinomycin (1mmol), and at room temperature stirs overnight. Use excessive CH₂Cl₂Diluting reaction solution, and wash with water, dry (Na₂SO₄) and concentrate. Adopt oil/ethyl acetate gradient system, the amide of corresponding protection is provided by column chromatography eluting residue. By the amide of protection being dissolved in MeOH and EtOH (1: the 1) solution of the 1.25MHCl containing 10%Pd-C (50% mass), thus realizing the deprotection of amido protecting group. At 30Psi/H under room temperature₂Lower to mixture hydrogenation 2 hours, filter and concentrate. Cold diethyl ether grinds the solid obtained, the solid filtering and obtaining with excessive washed with diethylether, dry in a vacuum, obtain target 3 '-deoxidation, 3 '-acyl amino spectinomycin.

The conventional method of synthesis 3 '-deoxidation, 3 '-acyl amino spectinomycin, method 2: to the CH of the acid (3mm0l) selected by stirring₂Cl₂(10mL) add HBTU (3mmol) with in DIPEA (6mmol) solution, and at room temperature stir mixture 1h. It is subsequently adding 6,8-bis-benzyloxycarbonyl groups 4 (R)-amino spectinomycin (1mmol), and at room temperature stirs overnight. Use excessive CH₂Cl₂Diluting reaction solution, and wash with water, dry (Na₂SO₄) and concentrate. Application oil/ethyl acetate gradient system, provides the amide of corresponding protection by column chromatography eluting residue. By the amide of protection is dissolved in 48%HBr (aqueous solution), thus realizing the deprotection of amido protecting group. It is stirred at room temperature 2 hours, then solution is dried in a vacuum. By methanol dissolution residual substance, in this solution, add ether, cross filter solid and with washed with diethylether, obtain target 3 '-deoxidation, 3 '-acyl amino spectinomycin.

The analytical data of individual 3 '-deoxidation, 3 '-acyl amino spectinomycin compound:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridine-3 base) propionamido spectinomycin dihydrochloride (1299):¹HNMR(D₂O, 500MHz): �� 8.74-8.65 (2H, m), 8.55-8.50 (1H, m), 8.03 (1H, dd, J1=8.0, J2=5.5Hz), 4.89 (1H, s), 4.77-4.75 (2H, m), 4.36 (1H, t, J=10.5Hz), 4.109 (1H, t, J=3.0Hz), 4.02-3.92 (2H, m), 3.92-3.82 (1H, m), 3.51 (1H, dd, J1=11.5Hz, J2=2.5Hz), 3.26 (1H, dd, J1=10.0, J2=2.5Hz), 2.83 (6H, brs), 2.81-2.76 (2H, m), 1.90-1.80 (1H, m), 1.60-1.52 (1H, m), 1.22 (3H, d, J=6.0Hz), MS (ESI): m/z467 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2 base) acetylamino spectinomycin dihydrochloride (1329):¹HNMR(D₂O, 500MHz): �� 8.45 (1H, d, J=6.0Hz), 8.57 (1H, t, J=7.5Hz), 8.00 (1H, t, J=7.0Hz), 7.97 (1H, d, J=8.0Hz), 5.01 (1H, s), 4.77-4.75 (2H, m), 4.40 (1H, t, J=10.5Hz), 4.23 (1H, t, J=6.5Hz), 4.21 (1H, m), 4.13-4.02 (1H, m), 4.04 (1H, t, J=10.0Hz), 3.97 (1H, t, J=10.0Hz), 3.52 (1H, dd, J1=11.5, J2=2.5Hz), 3.27 (1H, dd, J1=10.5, J2=2.5Hz), 2.83 (3H, s), 2.82 (3H, s), 1.96-1.87 (1H, m), 1.81-1.74 (1H, m), 1.27 (3H, d, J=6.0Hz),¹³CNMR(D₂O, 75MHz): �� 146.7141.0,138.2,128.0,125.492.6,89.7,69.53,67.6,65.6,65.1,61.1,59.6,58.0,51.8,33.7,30.3,30.2,19.4; MS (ESI): m/z453 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino)-acetylamino spectinomycin dihydrochloride (1351):¹HNMR(D₂O, 500MHz): �� 4.96 (1H, s), 4.78-4.76 (2H, m), 4.40 (1H, t, J=10.0Hz), 4.25-4.19 (1H, m), 4.09-4.01 (2H, m), 4.01-3.94 (1H, m), 3.92 (1H, d, J=8.0Hz), 3.54 (1H, dd, J1=10.5, J2=2.5Hz), 3.27 (1H, dd, J1=10.5, J2=2.5Hz), 2.85 (3H, s), 2.84 (3H, s), 1.97-1.88 (1H, m), 1.82-1.74 (1H, m), 1.39 (9H, s), 1.27 (3H, d, J=6.0Hz),¹³CNMR(D₂O, 75MHz): �� 92.6,89.7,69.6,67.6,65.6,65.2,59.7,58.1,57.4,51.6,42.2,33.7,30.4,30.3,24.4,19.4; MS (ESI): m/z447 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin dihydrochloride (1364):¹HNMR(D₂O, 500MHz): �� 7.82-7.76 (2H, m), 7.32-7.24 (2H, m), 5.13 (1H, s), 4.47 (1H, t, J=10.5Hz), 4.39 (1H, t, J=3.0Hz), 4.20-4.12 (1H, m), 4.08 (1H, t, J=10.0Hz), 4.01 (1H, t, J=10.0Hz), 3.58 (1H, dd, J1=11.0, J2=2.5Hz), 3.31 (1H, dd, J1=10.5, J2=2.5Hz), 2.88 (3H, s), 2.87 (3H, s), 2.05-1.96 (1H, m), 1.96-1.88 (1H, m), 1.30 (3H, d, J=6.0Hz),¹³CNMR(D₂O, 75MHz): �� 129.6 (d, J=9.4Hz), 115.3 (d, J=22.1Hz), 92.7,90.1,69.6,67.7,65.6,65.2,61.2,59.7,58.1,52.2,34.0,30.4,30.3,19.5; MS (ESI): m/z456 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin dihydrochloride (1365):¹HNMR(D₂O, 500MHz): �� 7.70 (1H, d, J=1.0Hz), 7.23 (1H, d, J=3.5Hz), 6.65 (1H, dd, J1=3.5, J2=1.5Hz), 5.14 (1H, s), 4.43 (1H, t, J=10.5Hz), 4.38-4.33 (1H, m), 4.22-4.13 (1H, m), 4.05 (1H, t, J=10.0Hz), 3.98 (1H, t, J=10Hz), 3.55 (1H, dd, J1=11.0, J2=2.5Hz), 3.28 (1H, dd, J1=10.5, J2=2.5Hz), 2.85 (3H, s), 2.84 (3H, s), 2.02-1.93 (1H, m), 1.90-1.81 (1H, m), 1.27 (3H, d, J=6.0Hz), MS (ESI): m/z427 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-dodecanoylamino spectinomycin dihydrochloride (1366):¹HNMR(D₂O, 500MHz): �� 4.98 (1H, s), 4.40 (1H, dd, J1=10.5, J2=10.0Hz), 4.16 (1H, t, J=3.0Hz), 4.09-4.02 (1H, m), 4.02 (1H, t, J=10.0Hz), 3.97 (1H, t, J=10.0Hz), 3.52 (1H, dd, J1=11.0, J2=3.0Hz), 3.26 (1H, dd, J1=10.5, J2=3.0Hz), 2.84 (3H, s), 2.83 (3H, s), 2.32 (2H, t, J=7.0Hz), 1.94-1.85 (1H, m), 1.75-1.68 (1H, m), 1.66-1.55 (2H, m), 1.32-1.24 (19H, m), 0.86 (3H, t, J=7.0Hz), MS (ESI): m/z516 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluoro-phenyl)-acetylamino spectinomycin dihydrochloride (1367):¹HNMR(D₂O, 500MHz): �� 7.82-7.74 (2H, m), 7.30-7.20 (2H, m), 5.11 (1H, s), 4.45 (1H, t, J=11.0Hz), 4.37 (1H, t, J=3.0Hz), 4.17-4.10 (1H, m), 4.06 (1H, t, J=10.0Hz), 3.99 (1H, t, J=10.0Hz), 3.52 (1H, dd, J1=11.0, J2=3.0Hz), 3.28 (1H, dd, J1=10.0, J2=2.5Hz), 2.86 (3H, s), 2.84 (3H, s), 2.04-1.94 (2H, m), 1.94-1.86 (1H, m), 1.28 (3H, d, J=6.0Hz),¹³CNMR(D₂O, 75MHz): �� 129.5 (d, J=9.4Hz), 115.3 (d, J=22.2Hz), 92.7,90.0,69.6,67.7,65.6,65.2,61.1,59.7,58.1,52.2,33.9,30.4,30.3,19.5; MS (ESI): m/z470 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-3 base) acetylamino spectinomycin dihydrochloride (1368):¹HNMR(D₂O, 500MHz): �� 8.80-8.70 (2H, m), 8.56-8.50 (1H, m), 8.07 (1H, dd, J1=7.5, J2=6.0Hz), 5.02 (1H, s), 4.40 (1H, t, J=10.5Hz), 4.19 (1H, t, J=3.5Hz), 4.14-3.94 (6H, m), 3.52 (1H, dd, J1=11.0, J2=2.5Hz), 3.27 (1H, dd, J1=10.0, J2=2.5Hz), 2.83 (3H, s), 2.82 (3H, s), 1.96-1.86 (1H, m), 1.80-1.70 (1H, m), 1.26 (3H, d, J=6.0Hz), MS (ESI): m/z453 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl)-butyrylamino spectinomycin dihydrochloride (1369):¹HNMR(D₂O, 500MHz): �� 5.00 (1H, s), 4.40 (1H, t, J=10.5Hz), 4.20-4.15 (1H, m), 4.10-3.92 (3H, m), 3.52 (1H, dd, J1=11.0, J2=2.5Hz), 3.26 (1H, dd, J1=10.0, J2=2.5Hz), 2.84 (3H, s), 2.83 (3H, s), 2.19 (2H, d, J=8.0Hz), 2.04-1.96 (1H, m), 1.94-1.86 (1H, m), 1.76-1.68 (1H, m), 1.25 (3H, d, J=6.0Hz), 0.97-0.88 (6H, m),¹³CNMR(D₂O, 75MHz): �� 92.6,90.0,69.6,67.6,65.6,65.1,61.1,59.6,58.1,51.3,44.3,34.00,30.3,30.2,25.8,21.4,21.0,19.4; MS (ESI): m/z418 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin dihydrochloride (1370):¹HNMR(D₂O, 500MHz): �� 8.66 (1H, d, J=4.5Hz), 8.10 (2H, d, J=3.5Hz), 7.74-7.65 (1H, m), 5.16 (1H, s), 4.45 (1H, t, J=11.0Hz), 4.39 (1H, t, J=3.5Hz), 4.25-4.15 (1H, m), 4.07 (1H, t, J=10.0Hz), 4.00 (1H, t, J=10.5Hz), 3.56 (1H, dd, J1=11.0, J2=2.5Hz), 3.28 (1H, dd, J1=10.0, J2=2.5Hz), 2.86 (3H, s), 2.84 (3H, s), 2.02-1.98 (1H, m), 1.97-1.91 (1H, m), 1.28 (3H, d, J=6.0Hz),¹³CNMR(D₂O, 75MHz): �� 148.1,138.8,127.3,122.5,92.5,69.63,67.6,65.6,65.3,61.1,59.7,58.1,33.7,30.4,30.2,19.4; MS (ESI): m/z439 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-phenylacetamido spectinomycin dihydrochloride (1398):¹HNMR(D₂O, 500MHz): �� 7.41 (2H, t, J=7.3Hz), and 7.31-7.36 (3H, m), 5.45 (1H, s), 4.39 (1H, t, J=10.7Hz), 4.15 (1H, brs), and 3.94-4.05 (3H, m), 3.64-3.67 (2H, m), 3.50-3.58 (3H, m), 2.81 (6H, s), 1.85-1.91 (1H, m), 1.71 (1H, d, J=14.6Hz), 1.24 (3H, d, J=5.8Hz);¹³CNMR(CD₃OD, 125MHz): �� 135.4,128.7,126.4,93.5,90.6,70.4,66.2,61.7,58.5,52.3,41.9,37.5,34.6,30.0,19.7; MS (ESI): m/z452 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin dihydrochloride (1399):¹HNMR(D₂O, 500MHz): �� 7.20 (4H, q, J=7.8Hz), 4.96 (1H, s), 4.36 (1H, t, J=10.5Hz), 4.12 (1H, brs), 3.92-4.03 (2H, m), 3.60 (2H, s), 3.49 (2H, d, J=10.7Hz), 3.24 (2H, d, J=10.2Hz), 2.80 (6H, s), 2.30 (3H, s), 1.85 (1H, t, J=11.4Hz), 1.68 (1H, d, J=14.1Hz), 1.21 (3H, d, J=5.86Hz);¹³CNMR(CD₃OD, 125MHz): �� 175.7,137.7,133.8,130.3,130.29,95.1,92.2,72.0,68.5,63.2,60.0,43.0,39.0,36.1,31.9; MS (ESI): m/z466 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin dihydrochloride (1400):¹HNMR(D₂O, 500MHz): �� 7.33 (1H, t, J=8.0Hz), 6.93 (3H, t, J=9.5Hz), 4.97 (1H, s), 4.73 (2H, s), 4.36 (1H, t, J=10.5Hz), 4.13 (1H, s), 3.92-4.04 (3H, m), 3.81 (3H, s), 3.63 (3H, s), 3.48-3.57 (1H, m), 3.24 (1H, d, J=10.0Hz), 2.80 (6H, s), 1.86 (1H, t, J=11.4Hz), 1.69 (1H, d, J=14.1Hz), 1.22 (3H, d, J=6.3Hz),¹³CNMR(CD₃OD, 125MHz): �� 175.3,161.4,138.3,130.6,122.5,115.8,113.5,95.1,92.2,71.9,67.8,63.2,55.7,43.5,39.0; MS (ESI): m/z482 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin dihydrochloride (1411):¹HNMR(D₂O, 500MHz): �� 6.76-6.86 (3H, m), 5.95 (2H, s), 4.96 (1H, s), 4.36 (1H, t, J=10.5Hz), 4.12 (1H, s), 3.92-4.02 (4H, m), 3.48-3.56 (3H, m), 3.23 (1H, d, J=9.7Hz), 2.79 (6H, s), 1.86 (1H, t, J=11.4Hz), 1.69 (1H, d, J=14.4Hz), 1.22 (3H, d, J=5.8Hz);¹³CNMR(CD₃OD, 125MHz): �� 130.5,123.4,110.5,102.4,95.1,72.0,67.2,63.2,60.0,43.0,39.0,31.8,21.3; MS (ESI): m/z496 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin dihydrochloride (1412):¹HNMR(D₂O, 500MHz): �� 7.28 (1H, t, J=7.5Hz), 7.09-7.18 (3H, m), 4.97 (1H, s), 4.37 (1H, t, J=10.7Hz), 4.12 (1H, s), and 3.92-4.02 (2H, m), 3.61 (2H, s), 3.49 (2H, d, J=10.9Hz), 3.24 (2H, d, J=10.0Hz), 2.79 (6H, s), 2.31 (3H, s), 1.85 (1H, t, J=11.4Hz), 1.69 (1H, d, J=13.9Hz), 1.22 (3H, d, J=5.8Hz); MS (ESI): m/z466 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-4 base) acetylamino spectinomycin dihydrochloride (1413):¹HNMR(D₂O, 500MHz): �� 8.71 (2H, t, J=6.3Hz), 7.97 (1H, d, J=5.8Hz), 7.89 (1H, d, J=6.1Hz), 4.99 (1H, s), 4.36 (1H, t, J=10.0Hz), 4.17 (1H, d, J=10.9Hz), 3.92-4.18 (3H, m), 3.62 (1H, q, J=7.0Hz), 3.50 (1H, d, J=10.9Hz), 3.41 (1H, d, J=11.9Hz), 3.24 (1H, d, J=9.7Hz), 2.96-3.02 (1H, m), 2.81 (6H, s), 1.86-1.89 (1H, m), 1.64-1.74 (1H, m), 1.23 (3H, d, J=5.3Hz),¹³CNMR(CD₃OD, 125MHz): �� 139.4,136.8,130.9,129.5,128.7,127.2,95.1,92.2,72.0,68.6,67.8,63.2,53.9,49.7,43.4,39.0; MS (ESI): m/z453 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2 base) acetylamino spectinomycin dihydrochloride (1439):¹HNMR(D₂O, 500MHz): �� 8.27 (1H, d, J=7.5Hz), 7.99 (1H, d, J=6.35Hz), 7.00 (1H, t, J=7.0Hz), 5.06 (1H, s), 4.35-4.43 (2H, m), 4.00-4.08 (2H, m), 3.89-3.98 (1H, m), 3.54 (2H, dd, J=10.9Hz), and 3.43-3.46 (1H, m), 3.35-3.40 (1H, m), 3.25 (1H, t, J=6.3Hz), 2.82 (6H, s), and 2.14-2.15 (2H, m), 1.25 (3H, d, J=5.6Hz); MS (ESI): m/z454 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyl group-phenyl) acetylamino spectinomycin dihydrochloride (1446):¹HNMR(D₂O, 500MHz): �� 7.25 (2H, d, J=8.5Hz), 6.98 (2H, d, J=8.5Hz), 4.97 (1H, s), 4.38 (1H, t, J=10.1Hz), 4.13 (1H, s), 3.93-4.04 (3H, m), 3.82 (3H, s), 3.49-3.64 (3H, m), 3.34 (1H, s), 3.25 (1H, d, J=7.57Hz), 2.80 (6H, s), 1.86 (1H, t, J=11.4Hz), 1.70 (1H, d, J=14.8Hz), 1.23 (3H, d, J=6.1Hz); MS (ESI): m/z482 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin dihydrochloride (1447):¹HNMR(D₂O, 500MHz): �� 7.23 (1H, q, J=8.8Hz), 7.14 (1H, q, J=8.0Hz), 7.09 (1H, t, J=7.5Hz), 5.01 (1H, s), 4.39 (1H, t, J=10.5Hz), 4.17 (1H, s), 3.94-4.10 (3H, m), 3.77 (2H, s), 3.50-3.58 (2H, m), 3.34 (1H, s), 3.25 (1H, dd, J=2.6, 10.2Hz), 2.82 (6H, s), 1.86-1.89 (1H, m), 1.75 (1H, d, J=14.6Hz), 1.25 (3H, d, J=6.1Hz), MS (ESI): m/z488 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyl group-phenyl) acetylamino spectinomycin dihydrochloride (1448):¹HNMR(D₂O, 500MHz): �� 7.36 (1H, t, J=7.32Hz), 7.24 (1H, d, J=7.3Hz), 7.05 (1H, d, J=8.3Hz), 7.00 (1H, t, J=7.5Hz), 4.96 (1H, s), 4.37 (1H, t, J=10.7Hz), 4.12 (1H, s), 3.93-4.06 (3H, m), 3.82 (3H, s), 3.50-3.63 (3H, m), 3.33 (2H, s), 3.25 (1H, dd, J=2.4, 10.5Hz), 2.80 (6H, s), 1.84-1.90 (1H, m), 1.72 (1H, d, J=14.4Hz), 1.25 (3H, d, J=6.1Hz), MS (ESI): m/z482 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin three hydrobromate (1443):¹HNMR(D₂O, 500MHz): �� 9.00 (1H, s), 7.45 (1H, s), 4.99 (1H, s), 4.40 (1H, t, J=10.0Hz), 4.17 (1H, m), 4.08-3.94 (3H, m), 3.90 (2H, s), 3.64 (1H, q, J=7.0Hz), 3.51 (1H, dd, J₁=11.0Hz, J₂=2.5Hz), 3.25 (1H, dd, J₁=10.0Hz, J₂=2.5Hz), 2.82 (3H, s), 2.81 (3H, s), 1.88 (1H, m), 1.78 (1H, m), 1.25 (3H, d, J=6.0Hz) .MS (ESI): m/z459 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin three hydrobromate (1444):¹HNMR(D₂O, 500MHz): �� 6.61 (1H, s), 4.98 (1H, s), 4.39 (1H, t, J=10.0Hz), 4.18 (1H, t, J=3.0Hz), 4.05-3.94 (3H, m), 3.77 (1H, m), 3.71 (1H, d, J=6.5Hz), 3.63 (1H, q, J=7.0Hz), 3.51 (1H, dd, J₁=11.0Hz, J₂=2.5Hz), 3.22 (1H, dd, J₁=10.5Hz, J₂=2.5Hz), 2.83 (3H, s), 2.82 (3H, s), and 1.93-1.87 (1H, m), 1.77-1.74 (1H, m), 1.25 (3H, d, J=6.0Hz) .MS (ESI): m/z474 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin three hydrobromate (1445):¹HNMR(D₂O, 500MHz): �� 8.46 (1H, br), 7.76 (1H, br), 7.53 (1H, br), 5.00 (1H, s), 4.40 (1H, t, J=10.5Hz), 4.18 (1H, t, J=3.0Hz), 4.08-3.91 (5H, m), 3.64 (1H, q, J=7.0Hz), 3.51 (1H, dd, J₁=11.0Hz, J₂=2.5Hz), 3.25 (1H, dd, J₁=10.0Hz, J₂=2.5Hz), 2.82 (3H, s), 2.81 (3H, s), and 1.92-1.83 (1H, m), 1.78-1.75 (1H, m), 1.25 (3H, d, J=6.5Hz) .MS (ESI): m/z471 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin hydrobromate (1449):¹HNMR(D₂O, 500MHz): �� 9.18 (1H, br), 7.90 (2H, m), 5.01 (1H, s), 4.39 (1H, t, J=10.5Hz), 4.19 (1H, m), 4.11 (2H, m), 4.03 (1H, t, J=10.0Hz), 3.96 (1H, t, J=10.0Hz), 3.77 (1H, t, J=10.0Hz), 3.51 (1H, dd, J₁=11.3Hz, J₂=2.5Hz), 3.41 (1H, t, J=9.5Hz), 3.25 (1H, dd, J₁=10.3Hz, J₂=3.0Hz), 3.22 (1H, dd, J1=10.75Hz, J2=2.5Hz), 2.82 (3H, s), 2.81 (3H, s), 1.92-1.86 (1H, m), 1.78-1.75 (1H, m), 1.25 (3H, d, J=5.5Hz) .MS (ESI): m/z454 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrazine-2-base) formamido group spectinomycin four hydrobromate (1453):¹HNMR(D₂O, 400MHz): �� 9.20 (1H, d, J=1.4Hz), 8.84 (1H, d, J=2.5Hz), 8.75 (1H, dd, J=2.5Hz, 1.5Hz), 5.16 (1H, s), 4.90 (1H, s), 4.51-4.36 (2H, m), 4.21 (1H, d, J=5.8Hz), 4.08 (1H, t, J=9.8Hz), 3.99 (1H, t, J=10.1Hz), 3.60-3.53 (1H, m), 3.29 (1H, dd, J=10.2Hz, 2.8Hz), 2.85 (6H, d, J=8.5Hz), 2.04-1.91 (2H, m), 1.28 (3H, d, J=6.1Hz) .MS (ESI): m/z440 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin three hydrobromate (1465):¹HNMR(D₂O, 400MHz): �� 7.82-7.69 (1H, m), 7.67 (1H, dd, J=6.7Hz, 2.3Hz), 7.46 (2H, pd, J=7.5Hz, 3.8Hz), 5.02 (1H, s), 4.48-4.35 (1H, m), 4.22 (1H, t, J=3.0Hz), 4.15-4.05 (2H, m), 4.05-3.93 (2H, m), 3.53 (1H, dd, J=11.1Hz, 2.6Hz), 3.26 (1H, dt, J=15.6Hz, 7.9Hz), 2.83 (8H, s), 1.96-1.85 (1H, m), 1.82 (1H, d, J=14.4Hz), 1.27 (3H, d, J=6.1Hz) .MS (ESI): m/z493 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin four hydrobromate (1466):¹HNMR(D₂O, 400MHz): �� 8.67 (1H, d, J=1.4Hz), 7.36 (1H, d, J=1.3Hz), 5.00 (1H, s), 4.90 (1H, s), 4.40 (1H, dd, J=10.9Hz, 10.0Hz), 4.19 (1H, t, J=3.0Hz), 4.13-3.90 (3H, m), 3.88 (2H, d, J=3.5Hz), 3.54 (1H, dd, J=7.9Hz, 3.3Hz), 3.27 (1H, dd, J=10.2Hz, 2.7Hz), 2.83 (6H, s), 1.96-1.85 (1H, m), 1.76 (1H, dd, J=12.3Hz, 2.3Hz), 1.26 (3H, d, J=6.1Hz) .MS (ESI): m/z442 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino] propanoylamino spectinomycin tri hydrochloride (1467):¹HNMR(D₂O, 400MHz): �� 4.23 (2H, t, J=8.0Hz), and 3.94-4.06 (2H, m), 3.76-3.93 (3H, m), 3.38 (1H, d, J=10.3Hz), 3.22 (1H, s), 3.11 (1H, d, J=8.8Hz), 2.67 (6H, d, J=2.6Hz), and 1.70-1.80 (1H, m), 1.59 (1H, d, J=14.1Hz), 1.36 (3H, d, J=7.0Hz), 1.09 (3H, d, J=6.0Hz); MS (ESI): m/z405 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(3-amino) propanoylamino spectinomycin tri hydrochloride (1469):¹HNMR(D₂O, 400MHz): �� 4.31 (2H, t, J=8Hz), 4.10 (1H, s), and 3.83-4.02 (3H, m), 3.44 (2H, d, J=8Hz), and 3.14-3.24 (3H, m), 2.75 (6H, d, J=5.8Hz), 2.67 (2H, t, J=8.0Hz), 1.76-1.86 (1H, m), 1.66 (1H, d, J=16Hz), 1.16 (3H, d, J=4.0Hz); MS (ESI): m/z405 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-amino) acetylamino spectinomycin tri hydrochloride (1470):¹HNMR(D₂O, 400MHz): �� 4.26 (2H, t, J=8.0Hz), 4.08 (1H, s), and 3.71-3.96 (4H, m), 3.36-3.47 (1H, m), 3.24 (2H, s), 3.13 (1H, d, J=8.0Hz), 2.70 (6H, d, J=5.8Hz), 1.73-1.83 (1H, m), 1.64 (1H, d, J=12Hz), 1.12 (3H, d, J=4.0Hz); MS (ESI): m/z391 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino, 3-methyl] valeryl amino spectinomycin tri hydrochloride (1485):¹HNMR(D₂O, 400MHz): �� 4.39 (2H, t, J=8Hz), 4.20 (1H, s), 3.88-4.06 (4H, m), 3.50 (1H, d, J=12Hz), 3.23 (1H, d, J=12Hz), 2.79 (6H, d, J=8Hz), and 1.85-2.01 (2H, m), 1.70 (1H, d, J=16Hz), 1.40-1.53 (1H, m), 1.22 (3H, d, J=4.0Hz), and 1.10-1.19 (1H, m), 0.98 (3H, d, J=8Hz), 0.90 (3H, t, J=8Hz); MS (ESI): m/z447 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino, 3-methyl] butyrylamino spectinomycin tri hydrochloride (1486):¹HNMR(D₂O, 400MHz): �� 4.30 (2H, t, J=8.0Hz), 4.14 (1H, s), 3.80-4.00 (4H, m), 3.44 (1H, d, J=8.0Hz), 3.27 (1H, s), 3.17 (1H, d, J=8.0Hz), 2.74 (6H, d, J=4.0Hz), 2.08-2.20 (1H, m), and 1.79-1.90 (1H, m), 1.64 (1H, d, J=16.0Hz), 1.15 (3H, d, J=6.0Hz), 0.92 (6H, t, J=8.0Hz); MS (ESI): m/z433 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino, 3-(4-fluorophenyl)] propanoylamino spectinomycin tri hydrochloride (1487):¹HNMR(D₂O, 400MHz): �� 7.42 (2H, d, J=4.0Hz), 7.19 (2H, d, J=4.0Hz), 4.26 (2H, t, J=8.0Hz), 3.97 (1H, s), 3.90 (2H, t, J=8.0Hz), 3.68-3.79 (2H, m), 3.44 (2H, d, J=12.0Hz), 3.19 (2H, d, J=8.0Hz), 3.03 (2H, d, J-8.0Hz), 2.73 (6H, s), 1.74 (1H, t, J=12.0Hz), 1.47 (1H, d, J=12.0Hz), 1.13 (3H, d, J=4.0Hz); MS (ESI): m/z499 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin four hydrobromate (1489):¹HNMR(D₂O, 400MHz): �� 7.88 (1H, d, J=3.6Hz), 7.74-7.65 (1H, m), 4.98 (1H, s), 4.74 (1H, t, J=2.7Hz), 4.37 (1H, dd, J=11.0Hz, 9.9Hz), 4.17 (1H, t, J=3.1Hz), 4.10-3.89 (4H, m), 3.52-3.47 (1H, m), 3.24 (1H, dd, J=10.1Hz, 2.9Hz), 2.81 (7H, s), 1.94-1.82 (1H, m), 1.79-1.71 (1H, m), 1.23 (3H, d, J=6.1Hz) .MS (ESI): m/z459 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin three hydrobromate (1490):¹HNMR(D₂O, 400MHz): �� 9.34 (1H, s), 8.64 (1H, d, J=8.6Hz), 7.66 (1H, d, J=8.6Hz), 5.02 (1H, s), 4.76 (1H, t, J=2.8Hz), 4.46-4.31 (1H, m), 4.20 (1H, t, J=3.1Hz), 4.15-3.92 (3H, m), 3.81-3.55 (1H, m), 3.53 (1H, dd, J=11.2Hz, 2.7Hz), 3.33-3.22 (1H, m), 2.83 (6H, d, J=1.9Hz), 1.99-1.83 (1H, m), 1.78 (1H, d, J=14.5Hz), 1.26 (3H, d, J=6.1Hz) .MS (ESI): m/z498 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin three hydrobromate (1491):¹HNMR(D₂O, 400MHz): �� 8.03 (2H, dd, J=17.1Hz, 8.1Hz), 7.65-7.57 (1H, m), 7.57-7.48 (1H, m), 5.03 (1H, s), 4.77 (1H, t, J=2.7Hz), 4.44-4.37 (1H, m), 4.23 (1H, t, J=3.1Hz), 4.16-3.89 (4H, m), 3.53 (1H, dd, J=8.3Hz, 2.8Hz), 3.27 (1H, dd, J=10.1Hz, 2.8Hz), 2.83 (6H, d, J=5.2Hz), 2.23 (1H, s), 1.97-1.85 (1H, m), 1.80 (1H, dd, J=12.2Hz, 2.3Hz), 1.26 (3H, d, J=6.1Hz) .MS (ESI): m/z509 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-fluorobenzene-1-base) formamido group spectinomycin dihydrochloride (1492):¹HNMR(D₂O, 400MHz): �� 7.62 (2H, m), 7.38-7.24 (2H, m), 5.05 (1H, s), 4.77 (1H, s), 4.47 (1H, dd, J=10.9Hz, 10.0Hz), 4.40 (1H, t, J=2.9Hz), 4.18-3.95 (3H, m), 3.58 (1H, m), 3.30 (1H, dd, J=10.2Hz, 2.8Hz), 2.87 (6H, d, J=7.8Hz), and 2.06-1.87 (2H, m), 1.30 (3H, d, J=6.1Hz) .MS (ESI): m/z456 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2 (S)-4-amino-2-hydroxyl) butyrylamino spectinomycin tri hydrochloride (1493):¹HNMR(D₂O, 400MHz): �� 5.03 (1H, s), 4.76 (1H, s), 4.45-4.34 (2H, m), 4.19 (1H, t, J=3.1Hz), 4.14-3.92 (3H, m), 3.56-3.50 (1H, m), 3.27 (1H, dd, J=10.2Hz, 2.8Hz), 3.16 (2H, t, J=6.7Hz), 2.84 (6H, d, J=3.4Hz), 2.16 (1H, m), 2.07-1.89 (2H, m), 1.78 (1H, dd, J=12.4Hz, 2.2Hz), 1.26 (3H, d, J=6.1Hz) .MS (ESI): m/z435 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (R)-amino] propanoylamino spectinomycin tri hydrochloride (1501):¹HNMR(D₂O, 400MHz): �� 4.34 (2H, t, J=8.0Hz), 4.15 (1H, s), 4.08 (1H, d, J=8.0Hz), 3.88-4.04 (2H, m), 3.46-3.52 (1H, m), 3.31 (2H, s), 3.19-3.25 (1H, m), 2.79 (6H, d, J=4.0Hz), 1.82-1.93 (1H, m), 1.71 (1H, d, J=16.0Hz), 1.49 (3H, d, J=8.0Hz) .1.21 (3H, d, J=8.0Hz) .MS (ESI): m/z405 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-(2-aminoacetylamino)-3-phenyl]-propanoylamino spectinomycin tri hydrochloride (1502):¹HNMR(D₂O, 400MHz): �� 7.07-7.25 (5H, m), 4.26-4.36 (2H, m), 3.85-3.94 (2H, m), and 3.70-3.83 (3H, m), 3.38-3.50 (1H, m), 3.31 (2H, s), and 3.15-3.23 (2H, m), 2.96-3.08 (2H, m), 2.77 (6H, d, J=4.0Hz), 1.78-1.88 (1H, m), 1.54-1.69 (1H, m), 1.18 (3H, d, J=8.0Hz) .MS (ESI): m/z538 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-3-benzamido propanoylamino spectinomycin dihydrochloride (1503):¹HNMR(D₂O, 400MHz): �� 7.73 (2H, d, J=8.0Hz), 7.57-7.63 (2H, m), 7.51 (2H, t, J=8.0Hz), 4.34 (2H, t, J=8.0Hz), 4.11 (1H, s), 3.93 (2H, p, J=8.0Hz), 3.57-3.83 (3H, m), 3.43-3.51 (1H, m), 3.32 (1H, s), 3.19-3.25 (1H, m), 2.79 (6H, s), 2.51-2.71 (2H, m), 1.71-1.82 (1H, m), 1.55 (1H, d, J=12.0Hz), 0.97 (3H, d, J=4.0Hz) .MS (ESI): m/z509 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-3-(2-phenylacetamido) propanoylamino spectinomycin dihydrochloride (1504):¹HNMR(D₂O, 400MHz): �� 7.23-7.42 (5H, m), 4.35 (2H, t, J=8.0Hz), 4.07 (1H, s), 3.83-4.01 (3H, m), and 3.39-3.57 (3H, m), 3.17-3.36 (4H, m), 2.79 (6H, s), 2.46 (2H, br.s), 1.74-1.86 (1H, m), 1.58 (1H, d, J=12.0Hz), 1.18 (3H, d, J=4.0Hz) .MS (ESI): m/z523 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2,2-diphenyl) acetylamino spectinomycin dihydrochloride (1514):¹HNMR(D₂O, 400MHz): �� 7.46-7.31 (10H, m), 5.30 (1H, s), 4.91 (1H, s), 4.76 (1H, s), 4.40 (1H, dd, J=11.0Hz, 9.7Hz), 4.23 (1H, t, J=3.0Hz), 4.05-3.90 (3H, m), 3.53 (1H, dd, J=11.1Hz, 2.7Hz), 3.27 (1H, dd, J=9.9Hz, 2.7Hz), 2.84 (6H, s), 1.97-1.86 (1H, m), 1.77 (1H, dd, J=12.4Hz, 2.2Hz), 1.23 (3H, d, J=6.1Hz) .MS (ESI): m/z528 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino, 3-phenyl] propanoylamino spectinomycin tri hydrochloride (1515):¹HNMR (400MHz, D₂O): �� 7.32-7.42 (3H, m), 7.22-7.29 (2H, m), 4.29 (2H, t, J=8HHz), 4.00 (1H, s), 3.83-3.94 (2H, m), 3.39-3.58 (2H, m), and 3.15-3.34 (3H, m), 2.97-3.14 (2H, m), 2.77 (6H, s), 1.59-1.71 (1H, m), 1.09-1.17 (1H, m), 1.06 (3H, d, J=4.0Hz) .MS (ESI): m/z481 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin three hydrobromate (1516):¹HNMR(D₂O, 400MHz): �� 8.77 (1H, s), 8.33 (1H, s), 7.58 (1H, s), 5.03 (1H, s), 4.78 (1H, s), 4.42 (1H, dd, J=10.9Hz, 9.9Hz), 4.20 (1H, d, J=3.0Hz), 4.14-3.95 (5H, m), 3.55 (1H, dd, J=11.2Hz, 2.5Hz), 3.29 (1H, dd, J=10.1Hz, 2.7Hz), 2.85 (6H, d, J=1.6Hz), 1.96-1.88 (1H, m), 1.79 (1H, d, J=14.6Hz), 1.28 (3H, d, J=6.1Hz) .MS (ESI): m/z531, 533 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin three hydrobromate (1517):¹HNMR(D₂O, 400MHz): �� 7.94 (2H, dd, J=7.8Hz, 1.7Hz), 7.67-7.55 (3H, m), 7.51 (1H, s), 5.03 (1H, s), 4.48-4.38 (1H, m), 4.21 (1H, d, J=3.1Hz), 4.14-3.92 (5H, m), 3.55 (1H, dd, J=11.1Hz, 2.6), 3.29 (1H, dd, J=10.1Hz, 2.8Hz), 2.85 (6H, d, J=1.4Hz), 1.95-1.87 (1H, m), 1.81 (1H, d, J=14.4Hz), 1.27 (3H, d, J=6.1Hz) .MS (ESI): m/z535 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin three hydrobromate (1518):¹HNMR(D₂O, 400MHz): �� 8.60-8.56 (1H, m), 8.45 (1H, td, J=8.0Hz, 1.6Hz), 7.88-7.82 (2H, m), 4.84 (1H, s), 4.76 (1H, s), 4.29 (1H, dd, J=10.9Hz, 9.8Hz), 4.03 (1H, d, J=2.9Hz), 3.98-3.81 (3H, m), 3.44 (1H, d, J=11.2Hz), 3.29 (2H, dd, J=11.6Hz, 4.5Hz), 3.22-3.15 (1H, m), 2.83 (2H, dd, J=10.2Hz, 4.4Hz), 2.75 (6H, s), 1.83-1.73 (1H, m), 1.52 (1H, d, J=14.6Hz), 1.14 (3H, d, J=6.1Hz) .MS (ESI): m/z467 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin three hydrobromate (1519):¹HNMR(D₂O, 400MHz): �� 8.91 (1H, s), 8.66 (1H, m), 7.88 (1H, m), 7.67 (2H, m), 7.50 (3H, m), 4.91 (1H, s), 4.65 (1H, s), 4.28 (1H, d, J=10.0Hz), 4.12 (2H, d, J=8.2Hz), 4.03-3.71 (3H, m), 3.41 (1H, s), 3.14 (1H, s), 2.70 (6H, d, J=7.8Hz), 1.79 (1H, m), 1.68 (1H, d, J=11.0Hz), 1.15 (3H, d, J=6.1Hz) .MS (ESI): m/z529 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin three hydrobromate (1520):¹HNMR(D₂O, 400MHz): �� 7.60-7.54 (2H, m), 7.50-7.43 (3H, m), 6.76 (1H, s), 5.00 (1H, s), 4.42 (1H, dd, J=10.9Hz, 9.9Hz), 4.21 (1H, t, J=3.1Hz), 4.12-3.95 (3H, m), 3.84-3.74 (2H, m), 3.57 (1H, dd, J=11.1Hz, 2.6Hz), 3.30 (1H, dd, J=10.2Hz, 2.7), 2.86 (6H, d, J=1.4Hz), 1.93 (1H, ddd, J=15.0Hz, 10.3Hz, 3.9Hz), 1.78 (1H, dd, J=12.3Hz, 2.2Hz), 1.28 (3H, d, J=6.1Hz) .MS (ESI): m/z550 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2 base) acetylamino spectinomycin three hydrobromate (1535):¹HNMR(D₂O, 400MHz): �� 8.92 (1H, d, J=2.2Hz), 8.66 (1H, dd, J=8.4, 2.2Hz), 7.90 (1H, d, J=8.4Hz), 7.69-7.62 (2H, m), 7.56-7.50 (2H, m), 4.94 (1H, s), 4.67 (1H, m), 4.34-4.28 (1H, m), 4.13 (2H, m), 4.07-3.85 (3H, m), 3.56 (1H, q, J=7.1Hz), 3.45 (1H, dd, J=11.1, 2.6Hz), 3.19 (1H, dd, J=10.2, 2.7Hz), 2.74 (6H, d, J=0.9Hz), 1.90-1.78 (1H, m), 1.70 (1H, m), 1.19 (3H, d, J=6.1Hz) .MS (ESI): m/z563 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin three hydrobromate (1536):¹HNMR(D₂O, 400MHz): �� 9.10-9.05 (1H, m), 9.02 (1H, d, J=8.5Hz), 8.42 (1H, d, J=7.3Hz), 8.39-8.31 (1H, m), 7.98 (1H, dd, J=8.4, 5.3Hz), 7.89 (1H, t, J=7.9Hz), 5.07 (1H, s), 4.45 (1H, t, J=3.0Hz), 4.42-4.34 (1H, m), 4.16-4.05 (1H, m), 4.01 (1H, t, J=10.0Hz), 3.91 (1H, t, J=10.1Hz), 3.50 (1H, d, J=11.2Hz), 3.21 (1H, d, J=10.3Hz), 2.77 (6H, d, J=13.0Hz), 2.01-1.91 (2H, m), 1.21 (3H, d, J=6.1Hz) .MS (ESI): m/z489 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin tetrabromide (1537):¹HNMR(D₂O, 400MHz): �� 7.84 (1H, s), 7.34 (3H, ddd, J=8.1, 4.4, 1.5Hz), 7.28-7.24 (2H, m), 5.53 (2H, s), 4.85 (1H, s), 4.66 (1H, t, J=2.5Hz), 4.35-4.25 (1H, m), 4.05 (1H, t, J=3.1Hz), 3.89 (3H, dt, J=24.4, 9.8Hz), 3.55 (2H, q, J=7.1Hz), 3.43 (1H, d, J=8.7Hz), 3.20-3.13 (1H, m), 2.73 (6H, d, J=2.1Hz), 1.82-1.73 (1H, m), 1.63 (1H, dd, J=12.3, 2.4Hz), 1.13 (3H, d, J=6.1Hz) .MS (ESI): m/z533 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin tribromide (1538):¹HNMR(D₂O, 400MHz): �� 7.39-7.34 (2H, m), 7.20-7.14 (2H, m), 6.62 (1H, s), 4.87 (1H, s), 4.68-4.66 (1H, m), 4.30 (1H, dd, J=10.9, 9.9Hz), 4.09 (1H, t, J=3.0Hz), 3.91 (3H, m), 3.65 (1H, d, J=3.8Hz), 3.55 (1H, q, J=7.1Hz), 3.46-3.41 (1H, m), 3.18 (1H, dd, J=10.2, 2.7Hz), 2.74 (s, 6H), 1.86-1.77 (1H, m), 1.66 (1H, d, J=14.6Hz), 1.16 (3H, d, J=6.1Hz) .MS (ESI): m/z568 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin tribromide (1539):¹HNMR(D₂O, 400MHz): �� 7.40 (1H, td, J=8.2, 6.6Hz), 7.22-7.13 (2H, m), 6.99 (1H, td, J=8.6, 2.4Hz), 6.67 (1H, s), 4.88 (1H, s), 4.67 (1H, t, J=2.8Hz), 4.35-4.21 (1H, m), 4.09 (1H, t, J=3.1Hz), 4.01-3.83 (3H, m), 3.66 (1H, d, J=1.8Hz), 3.58-3.53 (1H, m), 3.44 (1H, dd, J=7.7, 3.4Hz), 3.18 (1H, dd, J=10.2, 2.7Hz), 2.74 (6H, s), 1.86-1.76 (1H, m), 1.71-1.62 (1H, m), 1.14 (3H, d, J=6.1Hz) .MS (ESI): m/z568 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino)-thiazole-4-yl) acetylamino spectinomycin tribromide (1540):¹HNMR(D₂O, 400MHz): �� 7.45-7.41 (2H, m), 7.35 (2H, d, J=8.5Hz), 6.65 (1H, s), 4.88 (1H, s), 4.67 (1H, t, J=2.8Hz), 4.30 (1H, dd, J=10.9, 9.9Hz), 4.09 (1H, t, J=3.1Hz), 4.00-3.83 (3H, m), 3.66 (1H, d, J=2.6Hz), 3.55 (1H, q, J=7.1Hz), 3.44 (1H, dd, J=7.7, 3.4Hz), 3.18 (1H, dd, J=10.2, 2.8Hz), 2.74 (6H, s), 1.86-1.75 (1H, m), 1.71-1.63 (1H, m), 1.15 (3H, d, J=6.1Hz) .MS (ESI): m/z634 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino)-thiazole-4-yl) acetylamino spectinomycin tribromide (1541):¹HNMR(D₂O, 400MHz): �� 7.71 (2H, d, J=8.5Hz), 7.51 (2H, d, J=8.6Hz), 6.71 (1H, s), 4.88 (1H, s), 4.68-4.66 (1H, m), 4.30 (1H, dd, J=11.0, 9.9Hz), 4.09 (1H, t, J=3.0Hz), 3.98-3.84 (3H, m), 3.67 (1H, s), 3.55 (1H, q, J=7.1Hz), 3.43 (1H, m), 3.18 (1H, dd, J=10.2, 2.7Hz), 2.74 (s, 6H), 1.86-1.75 (1H, m), 1.67 (1H, d, J=14.5Hz), 1.14 (3H, d, J=6.1Hz) .MS (ESI): m/z618 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin tribromide (1542):¹HNMR(D₂O, 400MHz): �� 8.90 (1H, d, J=2.2Hz), 8.66 (1H, dd, J=8.4, 2.2Hz), 7.91 (1H, d, J=8.4Hz), 7.74-7.66 (2H, m), 7.29-7.21 (2H, m), 4.94 (1H, s), 4.69-4.67 (1H, m), 4.35-4.27 (1H, m), 4.16 (1H, d, J=4.6Hz), 4.14-4.11 (1H, m), 4.07-3.85 (3H, m), 3.56 (1H, q, J=7.1Hz), 3.49-3.42 (1H, m), 3.19 (1H, dd, J=10.2, 2.6Hz), 2.75 (s, 6H), 1.90-1.77 (1H, m), 1.70 (1H, d, J=14.6Hz), 1.19 (3H, d, J=6.1Hz) .MS (ESI): m/z547 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetyl-amino spectinomycin tribromide (1543):¹HNMR(D₂O, 400MHz):¹HNMR (400MHz, D₂O) �� 8.90 (1H, s), 8.63 (1H, d, J=8.3Hz), 7.87 (1H, d, J=8.5Hz), 7.47 (1H, t, J=8.0Hz), 7.29 (1H, d, J=7.6Hz), 7.25 (1H, s), 7.10 (1H, d, J=8.3Hz), 4.94 (1H, s), 4.31 (1H, t, J=10.4Hz), 4.13 (2H, s), 4.06-3.87 (3H, m), 3.83 (s, 3H), 3.56 (1H, dd, J=14.2, 7.1Hz), 3.44 (1H, d, J=3.9Hz), 3.18 (1H, d, J=8.9Hz), 2.74 (s, 6H), 1.87-1.81 (1H, m), 1.70 (1H, d, J=14.0Hz), 1.19 (3H, d, J=6.0Hz) .MS (ESI): m/z559 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin tribromide (1544):¹HNMR(D₂O, 400MHz):¹HNMR (400MHz, D₂O) �� 8.57 (1H, dd, J=5.3, 1.8Hz), 7.87-7.85 (2H, m), 4.93 (1H, s), 4.69-4.66 (1H, m), 4.34-4.28 (1H, m), 4.11 (1H, t, J=3.0Hz), 4.09-3.83 (m, 5H), 3.45 (1H, dd, J=11.1, 2.6Hz), 3.19 (1H, dd, J=10.2, 2.8Hz), 2.74 (6H, d, J=0.9Hz), 1.87-1.78 (1H, m), 1.69 (1H, d, J=14.5Hz), 1.18 (3H, d, J=6.1Hz) .MS (ESI): m/z487 (M⁺+H).

The conventional method of synthesis 3 '-deoxidation, 3 '-alkyl amino spectinomycin (1419,1420 and 1421): to the NaBH of stirring under room temperature₄(10mmol) anhydrous the two of the amide (1mmol) of He two Cbz protectionsAlkane (10mL) suspension is added in twoCF in alkane (2mL)₃COOH (10mmol). After stopping releasing gas, heating blends backflow 2h, cooling, pour in water (50mL), and use CH₂Cl₂(2x30mL) extract, wash with water (30mL), dry (Na₂SO₄), evaporation, and by purification by column chromatography residue. By the amide of protection being dissolved in the mixture in MeOH and EtOH (1: 1) of the 1.25MHCl containing 10%Pd-C (50% mass), thus realizing the deprotection of amido protecting group. At 30Psi/H under room temperature₂Lower hydrogenated mixture 2 hours, filters and concentrates. The solid obtained is ground with cold diethyl ether, the solid filtering and obtaining with excessive washed with diethylether, dry in a vacuum, obtain target 3 '-deoxidation, 3 '-alkyl amino spectinomycin.

The conventional method of synthesis 3 '-deoxidation, 3 '-alkyl amino spectinomycin (1422-1425): under room temperature, 6,8-bis-benzyloxycarbonyl groups 4 (R)-amino spectinomycin (1mmol) in anhydrous EtOH (10mL) and corresponding aryl aldehyde (1.2mmol) are stirred 5h. Add PtO₂(catalyst), and at room temperature at 30Psi/H₂Middle by mixture hydrogenated over night, filter, concentration, and by column chromatography eluting. By the amide of protection being dissolved in the mixture in MeOH and EtOH (1: 1) of the 1.25MHCl containing 10%Pd-C (50% mass), thus realizing the deprotection of amino CBz blocking group. At 30Psi/H under room temperature₂Lower hydrogenated mixture 2 hours, filters and concentrates. The solid obtained is ground with cold diethyl ether, the solid filtering and obtaining with excessive washed with diethylether, dry in a vacuum, obtain target 3 '-deoxidation, 3 '-alkyl amino spectinomycin.

The analytical data of individual 3 '-deoxidation, 3 '-alkyl amino spectinomycin compound:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin tri hydrochloride (1419):¹HNMR(CD₃OD, 500MHz): �� 5.01 (1H, s), 4.33 (1H, t, J=10.2Hz), 3.99 (1H, t, J=9.5Hz), 3.88 (1H, t, J=10.0Hz), 3.62-3.67 (3H, m), 3.42-3.53 (1H, m), 3.05-3.11 (3H, m), 2.81 (3H, s), 2.78 (3H, s), 1.99-2.08 (1H, m), 1.62-1.82 (1H, m), 1.28 (3H, d, J=5.6Hz), 1.14-1.19 (1H, m), 0.72 (2H, d, J=5.3Hz), 0.43 (2H, d, J=16.6Hz), MS (ESI): m/z388 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butylamino spectinomycin tri hydrochloride (1420):¹HNMR(CD₃OD, 500MHz): �� 5.04 (1H, s), 4.39 (1H, t, J=10.5Hz), and 3.84-4.00 (3H, m), 3.67-3.77 (2H, m), and 3.06-3.23 (4H, m), 2.89 (3H, s), 2.85 (3H, s), 2.12-2.22 (2H, m), and 1.62-1.74 (3H, m), 1.34 (3H, d, J=5.8Hz), 1.01 (6H, brs);¹³CNMR(CD₃OD, 125MHz): �� 93.2,88.9,75.5,70.2,69.0,66.5,66.2,61.7,61.5,60.0,58.4,37.5,34.1,30.5, MS (ESI): m/z404 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-dodecylamino spectinomycin tri hydrochloride (1421):¹HNMR(D₂O, 500MHz): �� 5.03 (1H, s), 4.28-4.37 (1H, m), 4.03 (2H, t, J=9.7Hz), 3.96 (1H, t, J=10.0Hz), 3.75 (1H, t, J=10.0Hz), 3.53 (1H, d, J=8.5Hz), and 3.84-3.42 (1H, m), 3.09-3.26 (3H, m), 3.02 (1H, d, J=15.6Hz), 2.81 (8H, s), 1.98-2.10 (1H, m), 1.67-1.72 (1H, m), 1.28 (20H, brs), 0.82 (3H, d, J=6.5Hz);¹³CNMR(CD₃OD, 125MHz): �� 94.8,90.4,71.9,70.3,67.6,63.2,61.0,33.2,30.8,27.8,23.8,21.1; MS (ESI): m/z502 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2 bases-methylamino spectinomycin tri hydrochloride (1422):¹HNMR(D₂O, 500MHz): �� 7.61 (1H, s), 6.68 (1H, d, J=2.4Hz), 6.51 (1H, s), 5.04 (1H, s), 4.47 (1H, s), 4.28-4.36 (3H, m), and 4.01-4.09 (2H, m), 3.90-3.97 (1H, m), 3.81-3.90 (1H, m), and 3.46-3.54 (1H, m), 3.24-3.26 (1H, m), 2.81 (6H, s), and 1.89-2.17 (2H, m), 1.28 (3H, d, J=5.6Hz); MS (ESI): m/z414 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin tri hydrochloride (1423):¹HNMR(D₂O, 500MHz): �� 7.44 (1H, t, J=8.5Hz), 7.11 (3H, d, J=7.8Hz), 5.02 (1H, s), 4.26-4.54 (3H, m), 3.92-4.06 (3H, m), 3.84 (3H, s), 3.40-3.54 (2H, m), 3.20-3.26 (2H, m), 2.80 (6H, s), 2.06 (1H, d, J=15.6Hz), 1.92-1.98 (1H, m), 1.28 (3H, d, J=5.8Hz); MS (ESI): m/z454 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorine) benzylamino spectinomycin tri hydrochloride (1424):¹HNMR(D₂O, 500MHz): �� 7.52 (2H, t, J=7.5Hz), 7.22 (2H, t, J=8.5Hz), 5.02 (1H, s), 4.41 (2H, dd, J=13.4Hz), 4.29 (1H, t, J=10.5Hz), 4.00-4.09 (3H, m), 3.95 (1H, t, J=10.0Hz), 3.49 (2H, t, J=14.4Hz), 3.24 (1H, d, J=10.2Hz), 2.80 (3H, s), 2.78 (3H, s), 2.09 (1H, d, J=15.8Hz), 1.95-2.00 (1H, m), 1.27 (3H, d, J=5.8Hz), MS (ESI): m/z442 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methyl) benzylamino spectinomycin tri hydrochloride (1425):¹HNMR(D₂O, 500MHz): �� 7.35 (4H, dd, J=7.5Hz), 5.01 (1H, s), 4.38 (2H, dd, J=13.1Hz), 4.28 (1H, t, J=10.5Hz), 4.00-4.09 (3H, m), 3.94 (1H, t, J=10.0Hz), 3.50 (1H, d, J=10.9Hz), 3.42 (1H, brs), 3.25 (1H, d, J=10.0Hz), 2.80 (3H, s), 2.77 (3H, s), 2.35 (3H, s), 2.06 (1H, d, J=15.8Hz), 1.95 (1H, t, J=11.7Hz), 1.27 (3H, d, J=5.8Hz), MS (ESI): m/z438 (M⁺+H).

3 '-dihydro-3 '-deoxidation-4 (R)-2 phenylethylcarbamate spectinomycin tri hydrochloride (1450):¹HNMR(D₂O, 400MHz): �� 7.32-7.42 (3H, m), 7.22-7.29 (2H, m), 5.01 (1H, s), 4.38 (2H, dd, J=13.1Hz), 4.28 (1H, t, J=10.5Hz), 4.00-4.09 (3H, m), 3.94 (1H, t, J=10.0Hz), 3.50 (1H, d, J=10.9Hz), 3.42 (1H, brs), 3.25 (1H, d, J=10.0Hz), 2.62 (2H, m), 2.77 (3H, s), 2.35 (3H, s), 2.06 (1H, d, J=15.8Hz), 1.95 (1H, t, J=11.7Hz), 1.27 (3H, d, J=5.8Hz), MS (ESI): m/z438 (M⁺+H)��

Embodiment 2

General in vitro and in vivo method

MIC measures: application is according to clinical experiment research on standard institute (ClinicalLaboratoryStandardsInstitute) (CLSI;National, C.F.C.L.S.,MethodsforDilutionAntimicrobialSusceptibilityTestsforBac teriathatGrowAerobically-SeventhEdition:ApprovedStandard M7-A7, CLSI, Wayne, Pennsylvania, the U.S., 2008) micro-broth dilution methods measures MIC, and by visual examination reading. First the antibiotic of the preparation 2 times of serial dilutions in the 100 suitable broth bouillons of �� L in microtitration plate at the bottom of 96 hole circles (NalgeNuncInternational, Rochester, NewYork, the U.S.). What add equal-volume (100 �� L) in each hole contains about 10⁵The bacterial broth inoculum of antibacterial cfu/mL, to obtain from the 200 �� g/mL medicine final concentration started, and at plate described in 37 DEG C of aerobic incubations. Mycobacterium tuberculosis and mycobacterium bovis BCG microtitration plate incubation 7 days, and other bacterial strains are incubated overnight. Against mycobacterium tuberculosis MIC estimates also by the method based on CLSI agar ratio method. In brief, in 2mL7H11 agar, it is equipped with 24 orifice plates with the antibiotic of 2 times of serial dilutions, and inoculates with about 105cfu, incubation 3 weeks. After incubation, all MIC is recorded as lowest concentration of drug in all cases that stop bacterial growth.

Check board synergism is tested: by the checkerboard titration method in 96 hole circle base plates, have evaluated the activity of the Killing Mycobacterium Tuberculosis H37Rv of combine with Rimactazid and ethambutol 1329 in triplicate. Have evaluated the similar combination with streptomycin, with making comparisons. Plate contains the bacterial inoculum (10 in totally 200 �� L volume meat soups⁵Each antibiotic of cfu/mL) and 2 times of serial dilutions. The minimum and maximum concentration of each dilution medicine is at least �� 4 times of they MIC. 37 DEG C of incubations are after 7 days, by the MIC of visual detection reading drug regimen, and asEliopoulosDeng FIC (FIC) index calculating Killing Mycobacterium Tuberculosis H37Rv like that described. Referring toEliopoulos etc., AntimicrobialCombinations, in InAntibioticsinLaboratoryMedicine, Williams and Wilkins, Co., Baltimore, Maryland, the U.S., 2000,432-449 page. FIC index is explained as follows :��0.5, collaborative; > 0.5 to 4, is added; And > 4, antagonism. Referring toOdds, F.C., J.Antimicrob.Chemother., 52,1 (2003).

The selection of drug resistant mutants and phenotype characterize: by 100 �� L saturated culture are layered on containing 4,8 and the medicine of 16 �� agar MIC 7H11 agar plate on, thus measuring the spontaneous mutation frequency of Killing Mycobacterium Tuberculosis H37Rv. At room temperature incubation plate 3 weeks, are recorded as mutation frequency by Drug escape clones number divided by total viable cell. Then the clone that random picking separates from option board, and it is seeded in the 7H9 meat soup containing the antibiotic concentration selecting them. What then enable regrowth grows to mid-log phase when being cloned in the medicine and antibiotic MIC that are absent from being determined by the micro-dilution of meat soup.

Detection spectinomycin medicament-resistant mutation: for determining the genetic mechanism of resistance to spectinomycin in mycobacterium tuberculosis, apply from IntegratedDNATechnologies (Coralville, Iowa, U.S.) respective oligonucleotide primers pcr amplification 16SrRNA and rpsE gene. Under touchdown PCR cycling condition, application 16S-F (5 '-CCGTTTGTTTTGTCAGGATA) (SEQIDNO:1) and 16S-R (TTCTCAAACACCACACCCCA) (SEQIDNO:2) expand 16SrRNA, and expand rpsE with rpsE-F (5 '-GGCGTGCCGGGTGACAAAAAGG) (SEQIDNO:3) and rpsE-R (5 '-GAATCCTTCGTAAGCCCA) (SEQIDNO:4). The MINELUTE of application Qiagen^TMPCR kit (Qiagen, N.V., Venlo, Holland) purification amplicon, and apply ABIModel3130XLGeneticAnalyzer (AppliedBiosystems, FosterCity, California, the U.S.) by MolecularResourceCenter, UniversityofTennesseeHealthScienceCenter (Memphis, Tennessee, UnitedStatesofAmerica) order-checking. Then Application Software Program CLCMainWorkbench (CLCbio, Aarhus, Denmark) analytical sequence chromatogram.

Cytotoxicity: cultivate Vero epithelial cell (from cercopithecus aethiops in the Dulbecco being supplemented with 10% hyclone (FBS) the Eagle culture medium (DMEM) improved; American Type Culture Collection (ATCC) CCL-81; Manassas, Virginia, the U.S.), and it is maintained at (37C, 5%CO in moist incubator₂). Use cell scraper emigrated cells, by centrifugal collection, with��10⁶Cell/mL is resuspended in fresh culture, and distribution is to 96 hole microtitration plates (100 �� L/ hole), and 37 DEG C of incubations 18 hours. The test compound (800-0.4mg/L) of the 2 times of serial dilutions being subsequently adding in the DMEM containing FBS, and Incubate cells 72 hours again. From in triplicate research, application MTT cell proliferation method of testing (ATCC, Manassas, Virginia, the U.S.) assesses the cytopathy effect of compound with colorimetry. IC is obtained from the dose-effect curve that application GraphPadprism5 (GraphPadSoftware, SanDiego, California, the U.S.) is mapped₅₀Data.

Escherichia coli S30 transcribes/translates test: commercially available escherichia coli S30 tests (Promega, Madison, Wisconsin, the U.S.) and monitors luciferase yield, and carries out describing such as manufacturer. Reaction carries out in the 25 �� L volumes being made up of 10 LPremix, 2.5 �� L aminoacids complexs, 7.5 �� LS30 extracts, 2.5 �� L inhibitor or DMSO (2.5%), 1 �� LpBESTluc plasmid (1 �� g) and 1.5 �� L nuclease free water. By reactant incubation 30 minutes, then pass through to be placed in and within 5 minutes, terminate reaction on ice. Then, add 50 �� L luciferase test agent (Promega, Madison, Wisconsin, the U.S.), and at BioTekSYNERGY^TMHT plate reader (BioTekInstruments, Inc., Winooski, Vermont, the U.S.) obtains fluorescence reading. IC is obtained from the dose-effect curve that application GraphPadprism5 (GraphPadSoftware, SanDiego, California, the U.S.) is mapped₅₀Data. The micromole IC of the mensuration of application compound 1329₅₀Value, checked other spectinomycin derivants.

Microsomal in vitro metabolic stability: the Hepar Leporis seu Oryctolagi Microsome preparation thing (Cellzdirect, Austin, Texas, the U.S.) that application is collected assesses the Microsomal in vitro metabolic stability of compound. Compound (20 ��Ms) and 200 �� LNADPH actified solution (1.3mMNADP+, 3.3mM G-6-P in pH7.4 phosphate buffered solution, 3.3mMMgCl are tested by 25 �� L microsomal protein solution (10mg/mL) being added into 25 �� L₂With 1 unit/mL glucose-6-phosphate dehydrogenase (G6PD)) in thus start reaction. 37 DEG C of incubation reaction mixture, and sampled at 0,5,10,15,30,45,60 and 90 minutes respectively. MC reactant mixture is inactivated with comparing containing said components but application. All samples is all applied LC-MS/MS test and is analyzed. The disappearance of parent compound is monitored during incubation. By comparing before incubation and incubation post analysis substrate concentration, thus estimating the percentage ratio of the parent compound keeping complete.

Protein bound: application equilirbium dialysis measures the protein bound of compound. Rat plasma is prepared the test compound (low and high) of physiological relevant concentration. 200 �� L plasma samples are placed in central bore, and 350 �� L blank isotonic phosphate buffer liquid (pH7.4) are joined electrodialysis apparatus (MW cutoff value 6000-8000D,Device, PierceBiotechnologyInc, Rockford, Illinois, U.S.) surrounding chamber in. Cover described chamber with sealing member, and on the agitator be set to 100rpm 37 DEG C of incubations 4 hours. When incubation terminates, measure blood plasma and receive the volume of buffer, to determine and to solve volume transfer (if any). The blood plasma of aliquot and buffer are used for applies LC-MS/MS method of testing and determine drug level. Free fraction as the ratio calculation medicine of the concentration in buffer and in blood plasma.

Pharmacokinetics research: from HarlanBioscience (Indianapolis, Indiana, the U.S.) obtain weigh about 225g intubate male Sprague-Dawley rat (for oral research, only insert jugular vein, and intravenous is studied, then insert jugular vein and femoral vein). When can arbitrarily obtain food and water, animal is maintained in 12 hours light dark cycles. Rat group (n=4) is made to accept the intravenous (IV) of 10mg/kg or 100mg/kg dosage level or the test compound of oral dose respectively. For Orally administered, make animal fasted overnight and until use test compound 4 hours. Before administration and upon administration until the predetermined point of time of 48 hours collects Serial blood samples (about 250 �� L). Immediately by centrifugal (4 DEG C, 10,000rpm, 10 minutes) separated plasma, and it is stored in-80 DEG C, until analyzing. After medicament administration, 48 hours periods collected urine sample. Described research approach obtains the Institutional Animal nursing at University of Tennessee's health science center and uses the approval of committee (Memphis, Tennessee, the U.S.).

Sample preparation and LC-MS/MS test: by test compound being mixed to 50 �� L blank rat plasma, thus the calibration curve built within the scope of the 7.81-1000 �� g/L of each test compound. The analog similar on test compound structure and compound 1369 are used as the interior mark (IS) of all calibration standard substance and all plasma specimens. By adding 4 volumes ice cold methanol precipitation plasma protein containing IS. These samples of vortex oscillation, and 20 minutes are kept on ice. Afterwards, at 4 DEG C with 10,000rpm Centrifuge A sample 10 minutes, then dilute supernatant if necessary, and be injected in LC-MS/MS to be used for analyzing. Application is by two pumps, online degasser, system controller and CTCLeap Autosampler (LeapTechnologies, Carrboro, NorthCarolina, the U.S.) the Shimadzu chromatograph of liquid (ShimadzuCorporation that forms, Kyoto, Japan) carry out chromatographic isolation. The gradient of methanol and 10mM ammonium acetate (pH3.5) is used with the flow velocity of 0.4mL/ minute. Application guard column is protectedLuna3 �� HILIC, 100x4.6mm post (Phenomenex, Torrance, California, the U.S.) is used for separating. 10 �� L sample are injected in post, and eluate is introduced directly into the API3000 being equipped with electric spray ion source triple-quadrupole mass spectrometer (AppliedBiosystemsABI/MDS-Sciex, FosterCity, California, the U.S.) in. Under cation mode, operate described instrument with the nebulizer gas (NEB) of 7psi, the heavy curtain gas (CUR) of 8psi, the collision gas (CAD) of 10psi, the ion injection electric (IS) of+4000V and the temperature (TEM) of 500 DEG C. The multiple reaction monitoring chromatogram obtained carries out quantitatively for passing through application Analyst software version 1.4.1 (AppliedBiosystemsABI/MDS-Sciex, FosterCity, California, the U.S.).

Pharmacokinetic data is analyzed: analyzed the plasma concentration v. time data of oral dose by non-compartmental analysis method. Application has the dual chamber open model injecting input and single order output for analyzing IV plasma concentration v. time data. Infinity will be extrapolated to the time by trapezoidal rule to calculate from the time 0 to infinitely-great plasma concentration v. time area under curve (AUCinf). Application MRT=AUMCinf/AUCinf calculates the mean residence time (MRT) of IV dosage, the i.e. average magnitude of the time that granule is maintained in engine compartment, wherein AUMCinf is the area when concentration-time curve is extrapolated to infinity under M curve (momentcurve). Applicable equations CL=Doseiv/AUCinfiv computing system clearance rate (CL), wherein Doseiv and AUCinf, iv be respectively IV dosage and from the time 0 to infinitely great plasma concentration v. time curve respective area. Application Vss=MRT*CL obtains the estimated value of volume of distribution under stable state (Vss) from IV data. Application F=(AUCinf, oral*Doseiv)/(AUCinf, iv*Doseoral) oral availability (F) is calculated, wherein Doseoral, Doseiv, AUCinf, iv and AUCinf, oral is oral dose and IV dosage respectively, and from the time 0 to infinitely great plasma concentration v. time curve respective area. WillDavies etc.. the physiologic parameters of the rat that (Pharm.Res., 10 (7), 1093-1095 (1993)) obtains for calculate excretion than and hepatic extraction ratio.

Embodiment 3

Anti-tubercular

By the micro-broth dilution of medicine in 96 orifice plates, the Middlebrook7H9 being supplemented with 10%ADC culture medium measures the anti-tubercular of spectinomycin analog Killing Mycobacterium Tuberculosis H37Rv. By plate 37 DEG C of incubations 7 days, then read growth inhibited according to the method range estimation described before. For example, seeHurdle etc., J.Antimicrob.Chemother, 62 (5), 1037-1045 (2008). Result is shown in table 1 and table 2.

The anti-tubercular of table 1.3 '-deoxidation 3 ' (R)-acyl amino spectinomycin

The anti-tubercular of table 2.3 '-deoxidation 3 ' (R)-alkyl amino spectinomycin

Multiple compounds demonstrate good tuberculosis MIC value, and many of which has better anti-tubercular compared with spectinomycin. For structural change and MIC value, this series of structure activity relationship is closely. Theoretical do not fettered by any one, it is believed that this indicates and the strict rule of the specific binding of ribosome receptor site and uptake inhibitors to tubercule bacillus.

Embodiment 4

Antibacterial activity

The synthetic analogues determining spectinomycin resists the MIC of other Gram-positives important clinically multiple and gram-negative pathogens, described pathogen to include staphylococcus aureus, enterococcus faecalis, anthrax bacillus, streptococcus pyogenes, streptococcus pneumoniae, escherichia coli, bacillus pyocyaneus, Bulbus Allii Cepae Bai Huoerde bacillus, proteus mirabilis, proteus vulgaris, klebsiella pneumoniae, Acinetobacter baumannii and addicted to maltose Stenotrophomonas (Strenotrophomonasmaltophillia). These results are shown in table 3 and 4.

The activity of table 3. resisting gram-positive antibacterial^*

^*The full name that in table, listed test is biological is as follows: staphylococcus aureus 8325 or strains A TCC29213 (for 1471-1544); Streptococcus pyogenes ATCC700294; Streptococcus pneumoniae DAW27 or bacterial strain R6 (for 1443-1544); Enterococcus faecalis ATCC33186 and anthrax bacillus Sterne34F2. NT-does not test.

The activity of the anti-gram negative bacteria of table 4.^*

^*The full name that in table, listed test is biological is as follows: Bulbus Allii Cepae Bai Huoerde bacillus ATCC25416, proteus mirabilis ATCC25933, proteus vulgaris ATCC33420, klebsiella pneumoniae ATCC33495, Acinetobacter baumannii ATCC19606, addicted to maltose Stenotrophomonas ATCC13637, bacillus pyocyaneus PAO1, e. coli k12 and e. coli k12 �� tolC. NT-does not test.

As shown in table 3, some biologies are to more sensitive than other of specific derivatives. Such as, compound 1443,1444 and 1368 demonstrates the MIC of the anti-anthrax bacillus of 1.6,6.25 and 6.25 �� g/mL respectively, and it shows to improve 4-16 times than spectinomycin. Similarly, compound 1422,1535 and 1543 demonstrates and improves 4-16 times when anti-enterococcus faecalis than spectinomycin. Multiple compounds demonstrates the remarkable activity of anti-streptococcus pneumoniae. Such as, 1329,1446,1447,1491,1515,1516,1517,1519,1520,1535,1537,1538,1539,1540,1541,1542,1543 the anti-Streptococcus pneumoniae activity improving 8-62.5 times compared with spectinomycin is demonstrated with 1544.

As shown in table 4, the e. coli k12 tolC knock-out bacterial strain gathering around defective multiple medicines excavationg pump is more more sensitive to spectinomycin analog than parental E. coli K12, and the MIC of spectinomycin is not significantly affected. Not by any theoretical restriction, this seems to point out medicine discharge system and/or cell permeability to be likely to the relative inactive to spectinomycin against most bacterium living beings and is responsible for, and spectinomycin amide compound disclosed by the invention is different from spectinomycin in taking in and discharging bacterial cell. And, recently report spectinomycin by mycobacterium tuberculosis discharge (referring toRamon-Garcia etc., J.AntimicrobialChemistry, 59 (3), 544-547 (2007)), this can partly explain its general lack of anti-TB cytoactive. It is therefore contemplated that the related analogs of the anti-tubercular of the raising of compound 1329,1443,1444 and 1445 and their anti-other biological reflects the ability penetrating into particular organisms that these molecules raise. Additionally, seem these inhibitor to more insensitive by the discharge of medicine discharge mechanism.

Embodiment 5

The disappearance of cross resistance and binding mode research

Whether consistent with the Given information of spectinomycin for measuring the against mycobacterium tuberculosis binding mode of spectinomycin amide, the agar containing the medicine of the 4 of its MIC, 8 and 16 times selects the spontaneous medicament-resistant mutation strain of compound 1329. Show the mutant of resistance to 1329 with 1.9-3.7x10^-6Frequency occur, it is suitable with the mutation frequency of Isoniazid-resistant that application same procedure measures before. Referring toHurdle etc., J.Antimicrob.Chemother, 62 (5), 1037-1045 (2008). But, this is higher than the mutation frequency of streptomycin medicine resistant mutation strain, and the mutation frequency of streptomycin medicine resistant mutation strain is 0.7-1.6x10^-7. In Spirochaetes B. burgdorferi (Borreliaburgdorfeti), spectinomycin drug resistance is also with 10^-6Frequency produce, streptomycin is then with >=10^-7Frequency produce, and its produce from imparting spectinomycin drug resistance those different genes seats on sudden change. Referring toCriswell etc.,Antimicrob.AgentsChemother., 50 (2), 445-452 (2006). Not by any theoretical constraint, due to spectinomycin and the equal targeting 16SrRNA of streptomycin, it appears that the mutation frequency of the rising observed 1329 reflects site in non-target and undergos mutation, such as undergo mutation in the gene controlling 1329 absorptions. But, checked and show two kinds to 1329 and spectinomycin high level drug resistance (MIC=> 200 �� g/mL) and stablize the mutant cross resistance to streptomycin, kanamycin and other antituberculotic antibiotics. Referring to table 5. Not having mutant is crossing drug resistant to aminoglycoside streptomycin and kanamycin, capreomycin and 23S core candy body inhibitor Linezolid. Similarly, the spontaneous mutation strain of streptomycin is extremely sensitive to 1329, including the reference strain ATCC35820 to streptomycin drug resistance due to the sudden change in ribosomal protein S1 2. Referring toNair et al., Mol.Microbiol., 10 (3), 521-527 (1993). It is essential that 1329 and a line TB medicine isoniazid, be absent from crossing drug resistant between rifampicin and ethambutol. Referring to table 5. In a word, these results confirm 1329 and spectinomycin seem to demonstrate against mycobacterium tuberculosis new role pattern, its be unlikely endowed on other fixed TB antibiotic (including streptomycin and relevant aminoglycoside) drug resistance mechanism affected.

The table 5.1329 activity compared with streptomycin

^*Also that streptomycin, kanamycin, capreomycin, Linezolid, rifampicin, ethambutol and isoniazid is sensitive bacterial strain.

For probing into the hereditary basis to 1329 drug resistances, and the reason of the crossing drug resistant of shortage and aminoglycoside, two high-level mutants of 1329 have carried out molecular genetic analysis. In non-tuberculosis biology, the sudden change in spiral 34 (spectinomycin binding structural domain) is generally relevant to this antibiotic special drug resistance. Referring toGalimand etc.,Antimicrob.AgentsChemother., 44 (5), 1365-1366 (2000); AndO ' Connor and Dahlberg, CurrentMicrobiology, 45 (6), 429-433 (2002). Similarly, also giving spectinomycin drug resistance with the sudden change in the ribosome protein s 5 (being encoded by rpsE) of spectinomycin binding structural domain interaction, this is to be caused by the conformation change of spectinomycin binding structural domain in change 16SrRNA. For determining whether 1329 be also combined with spiral 34, and whether the sudden change in ribosome protein s 5 or 16SrRNA causes spectinomycin drug resistance in mycobacterium tuberculosis, in two kind of 1329 medicament-resistant mutation strain and HL-14 and 15, these genes is all checked order. When compared with the rpsE reference sequences represented by Rv0721 in rpsE and the H37Rv genome derived from their wild ancestor H37Rv, the rpsE gene of two kinds of mutants is not detected by nucleotide and changes. On the contrary, unit point transversion is contained in mutant HL-14 and 15 in the gene of 16SrRNA. Relate to the drug resistance of the point mutation imparting HL-14 that C1057A nucleotide changes, and mutant HL-15 suddenlys change containing C1184A in its 16SrRNA. Application BLAST sequence analysis models (building from the ribosomal crystal structure of escherichia coli combined to spectinomycin) and detects the position of these sudden changes relevant with spectinomycin binding structural domain with the homology of TB16SrRNA. Finding tuberculosis and escherichia coli 16SrRNA very high homology, wherein sequence 80% is same. Further, it was found that these sequences are around spectinomycin binding siteIt is 100% same in nucleus, supports application escherichia coli mapping in conjunction with the position of the sudden change of relevant mycobacterium tuberculosis 16SrRNA to spectinomycin amide to us further.

Position C1192 or the sudden change of its cross-helicity gametophyte G1064 in spiral 34 are the usual sites of spectinomycin drug resistance in escherichia coli and other biological body. From primary series comparison and structural analysis, it was observed that position C1184 and position C1192 homology in escherichia coli in mycobacterium tuberculosis ribosome. Referring toGalimand etc., Antimicrob.AgentsChemother., 44 (5), 1365-1366 (2000); AndO ' Connor and Dahlberg, CurrentMicrobiology, 45 (6), 429-433 (2002). These positions all produce the direct H-key contacts with spectinomycin of equivalence. Therefore, the sudden change producing adenine residue on position 1184 in mycobacterium tuberculosis removes H-key contacts, and described H-key contacts is crucial for the spectinomycin in stable mycobacterium tuberculosis ribosome. Similarly, position C1057 and escherichia coli C1066 is also homology, and it interacts also by H-key and stablizes spectinomycin. Report that the sudden change relating to C1066U gives Salmonella enteritidis (Salmonellaenterica) serovar Typhimurium and colibacillary spectinomycin drug resistance, this supports our discovery, and namely in mycobacterium tuberculosis, seat (C1057) of equal value imparts the high-level drug resistance to 1329 and spectinomycin. Referring toO ' Connor and Dahlberg, CurrentMicrobiology, 45 (6), 429-433 (2002). Not by any theoretical constraint, think that the mutant drug-resistant to 1329 is positioned directly in mycobacterium tuberculosis 16SrRNA spiral 34, this is consistent with the spectinomycin binding mode of report, and explains the crossing drug resistant that the target why lacked with streptomycin and other andribosome inhibitors against mycobacterium tuberculosis mediates. It practice, the sudden change in spiral 44 (that is, the binding site of aminoglycoside) is needed for streptomycin resistance. Sudden change in ribosomal protein S1 2 and/or spiral 44 is without influence on the combination of spectinomycin Yu spiral 34.

For probing into the macromole basis that mycobacteria is suppressed by spectinomycin amide further, apply H³-leucine (GEHealthcare, LifeSciences, Piscataway, NewJersey, the U.S.) has carried out, at the mid-log phase cell of mycobacterium bovis BCG, the radioactive label test that high molecular weight protein synthesizes. After the 1329 or 1445 of 10 times of MIC of interpolation in 4 hours, protein synthesis has been suppressed 50% or more. Referring to Fig. 3. Comparison antibiotics streptomycin also suppresses protein synthesis. This seems to indicate that spectinomycin amide acts on their ribosome target spot in bacterial cell, thus suppressing protein synthesis.

Except having the cellular uptake of raising or the tolerance to the mechanism of discharging, 1329 to be also possible in ribosome level more more effective than spectinomycin. That applies commercially available acellular escherichia coli S30 coupling transcribes/translation system (Promega, Madison, Wisconsin, the U.S.) test and suppressed by the protein synthesis of spectinomycin, luciferase yield on described systematic survey escherichia coli ribosome, and have been used for quantifying the antibiotic antibacterium target spot level activity of andribosome inhibitors before. Referring toMurray etc., Antimicrob.AgentsChemother., 42 (4), 947-950 (1998). Find that the concentration causing 1329 and spectinomycin of luciferase synthesis minimizing 50% is 0.66 ��M and 0.90 ��M respectively. Referring to Fig. 4. These results show that 1329 effect in ribosome level are the same with spectinomycin, but 1329 can penetrate into mycobacteria better to arrive its ribosome target spot.

The IC of application 1329₅₀As standard, have studied the relative inhibition activities of other compounds multiple at 0.66 and 6.6 ��M (that is, 1 and 10 times of the IC50 of 1329). Referring to Fig. 5. These results show that these compounds suppress the generation of luciferase protein on escherichia coli ribosome with the activity of the varying level relative to 1329.

At 0.66 ��M, the most compounds in test are effective not as 1329. Compound 1351 is second maximally effective. But, 1351 have the MIC value of 25 �� g/mL, and this points out this compound to have the permeability of relative mistake, and plays Main Function to the selective transport in tubercule bacillus in this series of activity. Similarly, 3 '-aminoalkyl series compound 1420,1422,1423,1424 and 1425 all suppresses well in acellular test, but has the tuberculosis MIC activity of relative mistake compared with 1329, and this points out them also to have poor permeability. Compound (1421,1369) and the compound (1439) of pyrimidine replacement that benzamide compounds (1364,1365,1370), alkyl replace are not so good as 1329 effectively in albumen synthesis test, and these they relatively low anti-tubercular of prompting are due to worse target spot affinity.

For the target spot level activity of further relatively larger miromycin amide, determine multiple compounds and transcribe/translate the concentration (IC causing luciferase synthesis to reduce 50% in method of testing escherichia coli₅₀). As shown in table 6, the IC of these compounds₅₀Change at 0.12-2.63 �� g/mL. Compound 1329,1443,1444 and 1445 all demonstrates the low IC comparable with spectinomycin and streptomycin₅₀, it was shown that these molecules take in the potent suppression synthesized into bacterial cell along with microprotein. Compound 1351 and 1447 also shows suitable low IC₅₀, but they higher anti-TB bacillus MIC may reflect the absorption entering these cells of minimizing, as described above. In a word, these results show that spectinomycin amide disclosed by the invention is the highly efficient depressor of bacterioprotein synthesis.

Table 6. causes the spectinomycin amide concentration that luciferase biosynthesis 50% suppresses in S30 tests

¹There is��biosynthetic the IC of luciferase of the MIC anti-tubercular of 6.25 �� g/mL and��0.57 �� g/mL₅₀Compound runic show.

From these results, it appears that the structure activity relationship of spectinomycin class Killing Mycobacterium Tuberculosis and possible other biological is by following mediation: the ability that (i) their cellular uptake interacts with Key residues in spectinomycin binding structural domain with the degree and (ii) molecule arriving their ribosome drug target. 1329, the high activity of 1443 and 1445 seems from high target spot affinity and good cellular uptake.

Embodiment 6

With other Antibiotic combinations

In some embodiments, antituberculotics is used in combination to be probably effectively. Enforcement standard check board method of testing is to assess combine 1329, the 1443 or 1445 Killing Mycobacterium Tuberculosis activity that whether can show raising with a line antituberculotics. FIC (FIC) the index prompting of 0.5 to 4 is added effect. Referring toOdds, F.C., J.Antimicrob.Chemother.52,1 (2003). Therefore, in table 7 display result show isoniazid, ethambutol or rifampicin and 1329 combination show addition effect. Therefore, spectinomycin class disclosed by the invention seems most probable and is suitable to other antituberculotics for therapeutic alliance.

Table 7. therapeutic alliance effect

Combination	FIC scope
		1329+ rifampicin	1-1.25
1329+ isoniazid	1-1.5
		1329+ ethambutol	1-1.5
Streptomycin+rifampicin	0.62
		Streptomycin+isoniazid	0.62
Streptomycin+ethambutol	1

Embodiment 7

Pharmacokinetic data and activity in vivo

For all antimicrobial agents material standed fors, the toxicity of assessment lead compound is critically important to guarantee they relative host cell selective killing target pathogen. Therefore, apply the colorimetric MTT based on cell proliferation obtaining good validation and assess the cytotoxicity of 1329 for VERO epithelial cell. Referring toHurdle etc., J.Antimicrob.Chemother, 62 (5), 1037-1045 (2008). Spectinomycin, 1329, the average cell toxicity IC of streptomycin and ethambutol₅₀It is 1030,2182.4,1536.1 and 731.6 respectively. Pass through IC₅₀Being 41.5,5456,7680.5 and 913.8 respectively divided by the MIC therapeutic index obtained, this shows similar with streptomycin and ethambutol, and 1329 is high selective for killing mycobacterium tuberculosis. The index of the difference of the spectinomycin of unmodified reflects the anti-TB bacillus activity of its difference. For determining what whether Cytotoxic shortage was caused by the combination poor with mammalian ribosomal, in rabbit reticulocyte (Promega, Madison, Wisconsin, the U.S.), test compound suppresses the ability of mammalian proteins matter synthesis. The IC of compound 1329,1443 and 1445₅₀Than the maximum concentration higher (that is, > 512 �� g/mL) tested. This shows that bacterial ribosome is high selective by these compounds, as shown in table 6.

The method described before application measures the preliminary pharmacokinetic curve of 1329 (that is, Lee1329). Referring toBudha etc., TheAAPSJournal, 10 (1), 157-165 (2008); AndBudha etc., Curr.Med.Chem., 15 (8), 809-825 (2008). After intravenous uses 10mg/kg in rats, 1329 create double; two index concentration/time graphs with different distributions and discharge phase. Referring to Fig. 6. The plasma proteins of described compound combines and is about 30%. 1329 are distributed widely with the steady-state distribution volume of 4.3L/kg. It has the time of staying in the average body of about 5.3 hours. The experiment in vitro prompting of application hepatomicrosome 1329 is metabolic stability, and wherein the parent drug of 95% keeps complete at incubation after 90 minutes.

After intravenous is used in rats, 1329 have the average system clearance rate of 0.8L/hr/kg. Being 0.46 by the dosage number of the unchanged excretion of kidney, wherein the dosage of about 40% was not eliminated at first 6 hours with changing. The excretion of 1329 is 1.7 than the ratio of glomerular filtration rate (renal clearance with), it was shown that filter and active secretion is as clean urinary system discharge process. The liver extraction ratio of described molecule is 0.13, it was shown that 1329 can classify as low liver extracts medicine.

Should be appreciated that when without departing substantially from the scope of theme disclosed by the invention, each details of theme disclosed by the invention can be changed. Additionally, preceding description is only for explanation purposes, rather than the purpose of restriction.

Claims

1. formula (I) compound or pharmaceutically acceptable salt thereof:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

(a)�CCH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅And CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(b) heteroaryl, the heteroaryl of replacement, the phenyl of 2-halogen substiuted, the phenyl of 4-halogen substiuted ,-CH₂R₇With-CH (R₈)₂;

Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyls;

And each of which R₈Being aryl independently, it is selected from phenyl or naphthyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

2. the compound of claim 1, wherein R₃It is methyl or butyl.

3. the compound of claim 1, wherein R₄It is OH or methoxyl group.

4. the compound of claim 1, wherein R₆It is 4-fluorophenyl or 2-fluorophenyl.

5. the compound of claim 1, wherein R₆Heteroaryl, its selected from pyridine radicals, pyrimidine radicals, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

6. the compound of claim 1, wherein R₆It is CH (R₈)₂, each of which R₈It it is phenyl.

7. the compound of claim 1, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

The phenyl of wherein said replacement is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

8. the compound of claim 7, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

9. the compound of claim 7, wherein R₇Being the heteroaryl of heteroaryl defined in claim 7 or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

10. the compound of claim 7, wherein R₇Being the heteroaryl of replacement defined in claim 7, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

11. the compound of claim 10, wherein R₇Being the heteroaryl of replacement defined in claim 10, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

12. have the compound of the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂��C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, phenyl, phenyl oxygen base, C₁-C₆Acyl group; And

Each R₁₅Independently selected from H, C₁-C₆Alkyl, phenyl, wherein said phenyl is optionally replaced selected from following substituent group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkyl;

Or its officinal salt.

13. compound, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,2-diphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-3-benzamido propanoylamino spectinomycin; And

Or its officinal salt.

14. the officinal salt of the formula of claim 1 (I) compound.

15. the officinal salt of claim 14, it is hydrochlorate or hydrobromate.

16. pharmaceutical preparation, it comprises:

The compound of (a) claim 1; And

(b) pharmaceutically suitable carrier.

17. the pharmaceutical preparation of claim 16, wherein said pharmaceutically suitable carrier is pharmaceutically useful in people.

18. the pharmaceutical preparation of claim 16, comprise other antimicrobial compound further.

19. the pharmaceutical preparation of claim 18, other antimicrobial compound wherein said is antitubercular compounds.

20. the pharmaceutical preparation of claim 18, other antimicrobial compound wherein said is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

21. the pharmaceutical preparation of claim 16, wherein said preparation is for orally or topically using.

22. the purposes that formula (I) compound or pharmaceutically acceptable salt thereof is in the medicine that preparation is infected for treatment antibacterial in experimenter:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

Wherein R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

23. the purposes of claim 22, wherein R₃It is methyl or butyl.

24. the purposes of claim 22, wherein R₄It is OH or methoxyl group.

25. the purposes of claim 22, wherein R₆It it is 4-fluorophenyl.

26. the purposes of claim 22, wherein R₆Heteroaryl, its selected from pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

27. the purposes of claim 22, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

28. the purposes of claim 27, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

29. the purposes of claim 27, wherein R₇Being the heteroaryl of heteroaryl defined in claim 27 or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

30. the purposes of claim 27, wherein R₇Being the heteroaryl of replacement defined in claim 27, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

31. the purposes of claim 30, wherein R₇Being the heteroaryl of replacement defined in claim 30, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

32. the purposes of claim 27, wherein R₇Comprise nitrogen-containing hetero aryl, and formula (Ia) compound have the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

Or its officinal salt.

33. the purposes of claim 22, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

Or its officinal salt.

34. the purposes of claim 22, wherein said compound is Orally administered or local application.

35. the purposes of claim 22, wherein before using formula (I) compound, use other therapeutic compound after or during the period.

36. the purposes of claim 22, wherein said infection is gram positive bacteria infection.

37. the purposes of claim 22, wherein said infection is selected from: mycobacterial infections, infection due to Bacillus anthracis, enterococcus faecalis infect and streptococcus pneumoniae infection.

38. the purposes of claim 37, wherein said infection is infection due to Bacillus anthracis, '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin, 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin or 3 '-dihydro-3 and formula (I) compound is 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin, or its officinal salt.

39. the purposes of claim 37, wherein said infection is streptococcus pneumoniae infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin; And

Or its officinal salt.

40. the purposes of claim 37, wherein said infection is that enterococcus faecalis infects, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin; And

Or its officinal salt.

41. the purposes of claim 37, wherein said infection is m tuberculosis infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

Or its officinal salt.

42. the purposes of claim 22, wherein prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below:

A () has the antibacterial of the experimenter of infection risk to infect;

B recurrence that () antibacterial infects; And

(c) its combination.

43. the purposes of claim 22, wherein use formula (I) compound and infect to treat the antibacterial existed.

44. formula (I) compound or pharmaceutically acceptable salt thereof is used for the purposes treating in the medicine of tuberculosis in experimenter in preparation:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

45. the purposes of claim 44, wherein R₃It is methyl or butyl.

46. the purposes of claim 44, wherein R₄It is OH or methoxyl group.

47. the purposes of claim 44, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight chain or side chain₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyls;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

48. the purposes of claim 47, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

49. the purposes of claim 47, wherein R₇Being heteroaryl or the heteroaryl of replacement of definition in claim 47, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

50. the purposes of claim 49, wherein R₇Being the heteroaryl of heteroaryl or the replacement defined in claim 49, it comprises selected from following heteroaryl: pyridine radicals, thiazolyl, benzoAzoles base and benzothiazolyl.

51. the purposes of claim 49, wherein R₇Being the heteroaryl of the replacement of definition in claim 49, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

52. the purposes of claim 51, wherein R₇Being the heteroaryl of the replacement of definition in claim 51, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

53. the purposes of claim 47, wherein R₇Comprise nitrogen-containing hetero aryl, and formula (Ia) compound have the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

Or its officinal salt.

54. the purposes of claim 44, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-amino)-propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-phenylacetamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methyl) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-amino) acetylamino spectinomycin;

Or its officinal salt.

55. the purposes of claim 44, wherein said compound is officinal salt.

56. the purposes of claim 55, wherein said compound is hydrochlorate or hydrobromate.

57. the purposes of claim 44, wherein said compound is Orally administered or is used by suction.

58. the purposes of claim 44, its therapeutic compound also including using other to experimenter.

59. the purposes of claim 58, other therapeutic compound wherein said is antibiotic.

60. the purposes of claim 58, other therapeutic compound wherein said is antituberculosis therapy agent.

61. the purposes of claim 58, other therapeutic compound wherein said is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

62. the purposes of claim 44, wherein prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below:

A () has the m tuberculosis infection of the experimenter of infection risk;

The recurrence of (b) m tuberculosis infection; And

(c) its combination.

63. the purposes of claim 44, wherein use formula (I) compound to treat the m tuberculosis infection existed.

64. the purposes of claim 44, wherein use formula (I) compound to treat the infection of the multidrug resistance bacterial strain of mycobacterium tuberculosis.

65. the purposes of claim 44, wherein said formula (I) compound has 25 �� g/mL or less against mycobacterium tuberculosis minimal inhibitory concentration (MIC).

66. the compound selected from following:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

Or its officinal salt.

67. the compound or pharmaceutically acceptable salt thereof selected from following:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; With

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

Purposes in the medicine that preparation is infected for treatment antibacterial in the experimenter having treatment to need.

68. the purposes of claim 67, it is that enterococcus faecalis infects that wherein said antibacterial infects, and 3 '-dihydro-3 that wherein said pharmaceutical pack is containing effective dose '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin or its officinal salt.