CN102548552B - Spectinomycin amide as tuberculosis - Google Patents

Abstract

This application describes new 3 '-deoxidation-3 '-acyl amino spectinomycin compound. Also describe application 3 '-deoxidation-3-acyl amino spectinomycin and other spectinomycin analogue treatment tuberculosis and the method for the treatment of microorganism infection.

Description

Spectinomycinamide as an anti-tuberculosis agent

Cross References to Related Applications

The presently disclosed subject matter claims the benefit of US Provisional Patent Application 61/228,266, filed July 24, 2009, the disclosure of which is hereby incorporated by reference in its entirety.

Government interests

The subject matter disclosed herein was made with United States Government support under Grant No. R01AI062415 awarded by the National Institutes of Health. Accordingly, the United States Government has certain rights in the subject matter disclosed herein.

technical field

The presently disclosed subject matter provides a new class of spectinomycin analogs and describes their use in the treatment of tuberculosis and other microbial infections.

abbreviation

℃ = degrees Celsius

μg=microgram

μL=microliter

μM = micromolar

ATCC = American Type Culture Collection

CBz = carboxybenzyl

cfu = colony forming unit

DIPEA = Diisopropylethylamine

DMEM = Dulbecco's Modified Eagle's Medium

DMSO = dimethyl sulfoxide

ESI = Electrospray Ionization

EtOH = ethanol

FBS = fetal bovine serum

FIC = fractional inhibitory concentration

HBTU=O-benzotriazole-N,N,N',N'-tetramethyl-urea - Hexafluorophosphate

HIV = human immunodeficiency virus

hr = hour

IS = internal standard

IV = Intravenous

kg = kilogram

LC = liquid chromatography

MDR = multidrug resistance

MeOH = Methanol

mg = milligram

MIC = minimum inhibitory concentration

min=minute

mL=milliliter

mmol=mmol

MS = mass spectrometry

MW = molecular weight

rpm = revolutions per minute

PCR = polymerase chain reaction

Pd-C = palladium carbon

Spc = Spectinomycin

Stp = streptomycin

TB = tuberculosis

XDR = Extensively Drug Resistant

Background technique

Mycobacterium tuberculosis is the causative agent of tuberculosis, which remains one of the most successful and deadly infectious diseases worldwide. The World Health Organization estimates that more than 3 million active cases of tuberculosis occur each year, resulting in more than 1 million deaths. See World Health Organization WHO report 2007. HIV-infected individuals are more prone to become infected and develop the active form of the disease, and this has contributed significantly to the recent increase in the number of tuberculosis cases observed globally as the HIV epidemic has spread globally. See Centers for Disease Control , TB and HIV Coinfection, 2006. The currently recommended TB treatment is a four-drug regimen of rifampicin, isoniazid, pyrazinamide, and ethambutol for a minimum of 6 months. This long and cumbersome regimen has resulted in patient non-compliance. This in turn has led to an increase in the number of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains found in the clinic, for which effective treatment options are extremely limited.

Therefore, there is a clear need to develop new therapeutic agents for the treatment of tuberculosis. In particular there is a need for anti-tuberculosis therapeutics such as: strong anti-tuberculosis activity in vivo; activity against drug-resistant tuberculosis strains including MDR and XDR strains; excellent safety/low toxicity; There are no drug interactions or antagonisms with other drugs; activity against latent or slow-growing bacteria to help reduce treatment time; and a long serum half-life to reduce dosing frequency.

Summary of the invention

The presently disclosed subject matter provides, in some embodiments, a compound of formula (I) or a pharmaceutically acceptable salt or prodrug thereof:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R ₅ is -C(=O)R ₆ , wherein R ₆ is selected from (a) or (b):

(a) -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ )CH(CH ₃ ) _2. -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH ₂ NHC(=O)C ₆ H ₅ and -CH ₂ CH ₂ NHC(=O)CH ₂ C _{6H5 ;} or

(b) heteroaryl, substituted heteroaryl, 2-substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R ₇ is selected from aralkyl , substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl is selected from fluorine-substituted phenyl, alkyl-substituted phenyl, 2-substituted phenyl , ₃ -monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl in which two phenyl carbons are substituted together by alkylene; and wherein R is independently aryl or substituted aryl base.

_In some embodiments, each _of R and R is H. _In some embodiments, R and R are each aralkoxycarbonyl selected from benzyloxycarbonyl and benzyloxycarbonyl substituted with _one or more of halo, alkoxy, and nitro. In some embodiments, R ₁ and R ₂ are each benzyloxycarbonyl.

In some embodiments, R ₃ is methyl or butyl. _In some embodiments, R4 is H, OH, methyl or methoxy.

In some embodiments, R ₆ is 4-fluorophenyl or 2-fluorophenyl. _In some embodiments, R is heteroaryl selected from pyridyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, triazolyl, triazinyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₆ is -C(R ₈ ) ₂ , wherein each R ₈ is phenyl or substituted phenyl.

In some embodiments, the compound of formula (I) is a compound of formula (Ia) or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is selected from fluorine _- substituted phenyl, alkyl-substituted phenyl , 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and disubstituted phenyl in which two phenyl carbons are substituted together by an alkylene group.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl.

_In some embodiments, R is heteroaryl or substituted heteroaryl, comprising heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl.

In some embodiments, R ₇ is a substituted heteroaryl, wherein said heteroaryl is substituted with one or more of the following groups: NH ₂ , OH, alkylamino, arylamino, nitro, halogen, Alkyl, substituted alkyl, alkoxy, perhaloalkoxy, aralkyl, acyl, aryl, aryloxy, and substituted aryl. _In some embodiments, R is substituted heteroaryl, wherein said heteroaryl is substituted by one or more of the following groups: fluoro, chloro, bromo, methoxy, methyl, nitro, trifluoro Methoxy, phenylamino, phenyl and trifluoromethyl.

_In some embodiments, R is aralkyl or substituted aralkyl, wherein the aralkyl or substituted aralkyl comprises a heteroaryl or substituted heteroaryl group.

In some embodiments, R comprises a nitrogen _- containing heteroaryl, and the compound of formula (Ia) has the structure of one of formula (Ib), (Ic), or (Id):

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

_X2 and _X3 are each O, S or NH;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl, aryloxy, acyl and substituted aryl;

or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene; and

Each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aryl;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound of formula (I) is selected from:

3'-Dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-m-tolyl acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyrazin-2-yl)carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-fluorophen-1-yl)carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2,2-diphenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[2(S)-(2-aminoacetamido)-3-phenyl]propionyl-aminospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-3-benzamidopropionylaminospectinomycin; and

3'-Dihydro-3'-deoxy-4(R)-3-(2-phenylacetylamino)propionylamino spectinomycin;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is a pharmaceutically acceptable salt. In some embodiments, the compound is the hydrochloride or hydrobromide salt.

In some embodiments, the presently disclosed subject matter provides pharmaceutical compositions comprising: (a) a compound of formula (I) or a pharmaceutically acceptable salt or prodrug thereof:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R ₅ is -C(=O)R ₆ , wherein R ₆ is selected from (i) or (ii): (i) -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH (NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ )CH(CH ₃ ) ₂ , -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH _{2 CH2NHC} (= _O ) _C6H5 and _{-CH2CH2NHC (} =O _{) CH2C6H5 ;} or

(ii) selected from heteroaryl, substituted heteroaryl, 2-substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R ₇ is selected from aromatic Alkyl, substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl is selected from fluorine-substituted phenyl, alkyl-substituted phenyl, 2-substituted Phenyl, ₃ -monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl wherein two phenyl carbons are substituted together by alkylene; and wherein each R is independently aryl or Substituted aryl;

and (b) a pharmaceutically acceptable carrier.

In some embodiments, the pharmaceutically acceptable carrier is pharmaceutically acceptable in humans. In some embodiments, the pharmaceutical formulation further comprises other therapeutic and/or antibacterial compounds. In some embodiments, the other antibacterial compound is an anti-tuberculosis compound. In some embodiments, the additional antibacterial compound is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, linezolid, and streptomycin. In some embodiments, the pharmaceutical formulation is for oral or topical administration.

In some embodiments, the presently disclosed subject matter provides a method of treating a bacterial infection in a subject in need thereof, the method comprising administering to the subject an effective amount of a compound of formula (I) or an alternative Medicinal salts or prodrugs:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R ₅ is -C(=O)R ₆ , wherein R ₆ is selected from (a) or (b):

(a) -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ )CH(CH ₃ ) _2. -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH ₂ NHC(=O)C ₆ H ₅ and -CH ₂ CH ₂ NHC(=O)CH ₂ C _{6H5 ;} or

(b) heteroaryl, substituted heteroaryl, 2-substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R ₇ is selected from aralkyl , substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl is selected from fluorine-substituted phenyl, alkyl-substituted phenyl, 2-substituted phenyl , ₃ -monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl in which two phenyl carbons are substituted together by alkylene; and wherein each R is independently aryl or substituted Aryl.

_In some embodiments, each _of R and R is H. In some embodiments, R ₃ is methyl or butyl. _In some embodiments, R4 is H, OH, methyl or methoxy.

In some embodiments, R ₆ is 4-fluorophenyl. _In some embodiments, R is heteroaryl selected from pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl.

In some embodiments, the compound of formula (I) is a compound of formula (Ia) or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is selected from fluorine _- substituted phenyl, alkyl-substituted phenyl , 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and disubstituted phenyl in which two phenyl carbons are substituted together by an alkylene group.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl. _In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl.

In some embodiments, R ₇ is a substituted heteroaryl, wherein said heteroaryl is substituted with one or more of the following groups: NH ₂ , OH, alkylamino, arylamino, nitro, halogen, Alkyl, substituted alkyl, alkoxy, perhaloalkoxy, aralkyl, acyl, aryl, aryloxy, and substituted aryl. _In some embodiments, R is substituted heteroaryl, wherein said heteroaryl is substituted by one or more of the following groups: fluoro, chloro, bromo, methoxy, methyl, nitro, trifluoro Methoxy, phenylamino, phenyl and trifluoromethyl.

_In some embodiments, R is aralkyl or substituted aralkyl, wherein the aralkyl or substituted aralkyl comprises a heteroaryl or substituted heteroaryl group.

In some embodiments, R comprises a nitrogen _- containing heteroaryl, and the compound of formula (Ia) has the structure of one of formula (Ib), (Ic), or (Id):

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

_X2 and _X3 are each O, S or NH;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl, aryloxy, acyl and substituted aryl;

Or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene; and

Each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aryl;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is selected from:

3'-Dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-m-tolyl acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylamino spectinomycin; and

3'-dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylamino spectinomycin;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is administered orally or topically. In some embodiments, an additional therapeutic compound is administered to the subject before, after, or during administration of a compound of formula (I).

In some embodiments, the infection is a Gram-positive bacterial infection. In some embodiments, the infection is an infection selected from the group consisting of Mycobacterium infection, Bacillus anthracis infection, Enterococcus faecalis infection, and Streptococcus pneumoniae infection.

In some embodiments, the infection is a Bacillus anthracis infection, and the compound of formula (I) is 3'-dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin; 3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin; or 3'-dihydro-3'-deoxy-4(R)-(2-amino Thiazol-4-yl) acetamidospectinomycin; or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the infection is a Streptococcus pneumoniae infection, and the compound of formula (I) is selected from the group consisting of: 3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamido Mycin; 3'-dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl) acetamido spectinomycin; 3'-dihydro-3 '-Deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)- (Thiazol-2-yl)acetamidospectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin;3'-diHydrogen-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)Acetylaminospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-Phenylthiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylaminospecttinomycin;3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin;3'-Dihydro-3'-deoxy-4(R)-(2-(Phenylamino)-thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2 , 3-difluorophenyl)-acetylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)-pyridin-2-yl)acetamido Spectinomycin; 3'-dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin; 3 '-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((4-(trifluoro-methyl)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-(4-fluoroPhenyl)pyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetyl Aminospecttinomycin and 3'-dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin; or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the infection is an Enterococcus faecalis infection and the compound of formula (I) is selected from: 3'-dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl) Acetylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectin; 3'-dihydro-3'-deoxy-4( R)-(5-phenylpyridin-2-yl)acetamidospectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridine-2- Base) acetylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamido spectinomycin 3'-dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin; 3'-dihydro- 3'-deoxy-4(R)-(2-((3-fluorophenyl)-amino)thiazol-4-yl)acetamidospectinomycin; 3'-dihydro-3'-deoxy-4(R )-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin; 3'-dihydro-3'-deoxy-4(R)-( 2-((4-(trifluoromethyl)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-( 4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin; and 3'-dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridine-2 -yl) acetylaminospectinomycin; or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the infection is a Mycobacterium tuberculosis infection and the compound of formula (I) is selected from: 3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamido Spectinomycin; 3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)-acetamidospectinomycin;3'-Dihydro-3'-deoxy-4(R)-(Pyridin-3-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin; 3 '-Dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-Fluoropyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-Deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(thiazol-2-yl) acetamido spectinomycin; 3'-dihydro-3'- Deoxy-4(R)-(5-nitropyridin-2-yl)acetylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetyl Aminospectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-phenylamino)thiazol-4-yl)acetylAminospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin;3'-dihydro-3'-Deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethylyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;3'-dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl ) Acetylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetylamino spectinomycin; 3'- Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin; or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, a compound of formula (I) is administered prophylactically, thereby preventing or reducing the occurrence of one of: (a) bacterial infection in a subject at risk of infection; (b) recurrence of bacterial infection; and ( c) its combination. In some embodiments, compounds of formula (I) are administered to treat an existing bacterial infection.

In some embodiments, the presently disclosed subject matter provides a method of treating tuberculosis in a subject in need thereof, the method comprising administering to the subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable With a salt or prodrug:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R _is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, substituted aryl and acyl.

_In some embodiments, each _of R and R is H. In some embodiments, R ₃ is methyl or butyl. _In some embodiments, R4 is H, OH, methyl or methoxy.

In some embodiments, R ₅ is acyl. _In some embodiments, R has the structure _-C (=O)R, wherein R _is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aryl . In some embodiments, R is selected from heteroaryl, substituted heteroaryl, ₂ -substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; R ₇ is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl is selected from fluorine-substituted phenyl, alkyl-substituted phenyl, 2-substituted phenyl, ₃ -monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl in which two phenyl carbons are substituted together by alkylene; and each R is independently is aryl or substituted aryl. In some embodiments, R ₆ is selected from -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ ) CH(CH ₃ ) ₂ , -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH ₂ NHC(=O)C ₆ H ₅ and -CH ₂ CH ₂ NHC (=O _{) CH2C6H5 ;} or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound of formula (I) is a compound of formula (Ia):

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is selected from fluorine _- substituted phenyl, alkyl-substituted phenyl , 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl in which two phenyl carbons are substituted together by an alkylene group; and

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl. _In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. _In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, thiazolyl, benzo Azolyl and benzothiazolyl.

In some embodiments, R ₇ is a substituted heteroaryl, wherein the heteroaryl is substituted with one or more of the following groups: NH ₂ , OH, alkylamino, arylamino, nitro, halogen, alkane radical, substituted alkyl, alkoxy, perhaloalkoxy, aralkyl, acyl, aryl, aryloxy, and substituted aryl. _In some embodiments, R is substituted heteroaryl, wherein said heteroaryl is substituted with one or more of the following groups: fluoro, chloro, bromo, methoxy, methyl, nitro, trifluoromethyl Oxy, phenylamino, phenyl and trifluoromethyl.

_In some embodiments, R is aralkyl or substituted aralkyl, wherein the aralkyl or substituted aralkyl comprises a heteroaryl or substituted heteroaryl group.

In some embodiments, R comprises a nitrogen _- containing heteroaryl, and the compound of formula (Ia) has the structure of one of formula (Ib), (Ic), or (Id):

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

_X2 and _X3 are each O, S or NH;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl, aryloxy, acyl and substituted aryl;

Or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene; and

Each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aryl;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is selected from:

3'-Dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-m-tolyl acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-phenyl]propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-dodecylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-amino)-propionylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-phenylacetamido spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butylaminospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-dodecylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-fluoro)benzylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-methyl)benzylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-2-phenylethylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(4-methoxyphenyl)acetamidospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-[2(S)-aminopropionylaminospectinomycin; and

3'-dihydro-3'-deoxy-4(R)-(2-amino)acetamidospectinomycin;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is a pharmaceutically acceptable salt. In some embodiments, the compound is the hydrochloride or hydrobromide salt. In some embodiments, the compound is administered orally or by inhalation.

In some embodiments, the method further comprises administering to the subject an additional therapeutic compound. In some embodiments, the additional therapeutic compound is an antibiotic. In some embodiments, the additional therapeutic compound is an antituberculosis therapeutic. In some embodiments, the additional therapeutic compound is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, linezolid, and streptomycin.

In some embodiments, a compound of formula (I) is administered prophylactically, thereby preventing or reducing the occurrence of one of: (a) M. tuberculosis infection in a subject at risk of infection; (b) M. tuberculosis recurrence of infection; and (c) a combination thereof. In some embodiments, a compound of Formula (I) is administered to treat an existing M. tuberculosis infection. In some embodiments, a compound of formula (I) is administered to treat infection by a multidrug resistant strain of Mycobacterium tuberculosis. In some embodiments, the compound of formula (I) has a minimum inhibitory concentration (MIC) against Mycobacterium tuberculosis of 25 μg/mL or less.

In some embodiments, the presently disclosed subject matter provides compounds selected from the group consisting of:

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylamino spectinomycin;

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin;

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylamino spectinomycin;

3'-dihydro-3'-deoxy-4(R)-(4-fluoro)benzylaminospectinomycin; and

3'-Dihydro-3'-deoxy-4(R)-2-phenylethylamino spectinomycin;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the presently disclosed subject matter provides a method of treating a bacterial infection in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a compound selected from the group consisting of: 3'- Dihydro-3'-deoxy-4(R)-cyclopropylmethylaminospectinomycin; 3'-dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin 3'-dihydro-3'-deoxy-4(R)-(3-methoxy)benzylamino spectinomycin; 3'-dihydro-3'-deoxy-4(R)-(4 -fluoro)benzylaminospecttinomycin; and 3'-dihydro-3'-deoxy-4(R)-2-phenylethylaminospecttinomycin, or a pharmaceutically acceptable salt or prodrug thereof. In some embodiments, the bacterial infection is an Enterococcus faecalis infection, and the method comprises administering to the subject an effective amount of 3'-dihydro-3'-deoxy-4(R)-furan-2-yl - methylaminospectinomycin, or a pharmaceutically acceptable salt or prodrug thereof.

It is an object of the presently disclosed subject matter to provide novel spectinomycin derivatives, such as but not limited to 3'-dihydro-3'-(R)-acylamino spectinomycin derivatives, and for use in the treatment of microbial infections including Infectious compounds of the Mycobacterium tuberculosis complex.

The objects of the presently disclosed subject matter are pointed out above and are achieved in whole or in part by the presently disclosed subject matter, other objects as the description proceeds when connected with the drawings best described hereinafter. will be obvious.

Brief description of the drawings

Figure 1 is a schematic diagram of an exemplary method for synthesizing compounds of the presently disclosed subject matter.

Figure 2 is a schematic diagram of an exemplary method of synthesizing compounds of the presently disclosed subject matter.

Figure 3 is a bar graph showing the inhibition of protein synthesis in whole-cell M. bovis (M. bovis) BCG by compounds 1329, 1445 or the control antibiotic streptomycin after 4 hours of incubation with the compounds.

Figure 4 is a graph comparing inhibition of luciferase protein synthesis by compound 1329 (circles) or spectinomycin (triangles) in an E. coli S30 transcription/translation assay.

Figure 5 is a bar graph showing the comparative activity of spectinomycin analogs at 6.6 [mu]M (lighter bars) or 0.66 [mu]M (darker bars) in the E. coli transcription/translation assay.

Figure 6 is a graph showing the pharmacokinetic profile of Compound 1329 (iv, 10 mg/kg body weight) in rats. Each set of data is from one animal. Group 1 (circles) refers to data from animal 1. Group 2 (triangles) refers to data from animal 2. Group 3 (squares) refers to data from animal 3. Group 4 (diamonds) refers to data from animal 4.

Detailed description of the invention

The presently disclosed subject matter will be described more fully hereinafter with reference to the accompanying Examples, in which representative embodiments are shown. However, the presently disclosed subject matter may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the embodiments to those skilled in the art.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. All publications, patent applications, patents, and other references mentioned herein are hereby incorporated by reference in their entirety.

In the specification and claims, a given chemical formula or name shall include all optical and stereoisomers, as well as racemic mixtures, where such isomers and mixtures exist.

I. Definition

Following long-standing patent law convention, the term "a/an" means "one or more" when used in this application, including the claims. Thus, "a compound" may refer to multiple (ie, two or more) compounds.

Unless otherwise indicated, all numbers expressing amounts of components, reaction conditions, etc. used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, numerical parameters set in the specification and attached claims are approximations that vary depending upon the desired properties sought to be obtained by the disclosed subject matter. Thus, when referring to a value or quantity of mass, weight, time, temperature, volume or percentage, the term "about" as used herein is meant to include ± 20% or ± 10%, more preferably ± 5% from the specified amount , even more preferably ±1%, and more preferably ±0.1% as such variations are suitable for implementing the disclosed methods.

When used to describe two or more activities, circumstances or results, the term "and/or" refers to situations where both of the listed situations are included, or where only one of the two listed situations is included inside.

The term "comprising" is synonymous with "comprising", "comprising", or "characterized by", which is inclusive or open ended, and does not exclude other, non-recited elements or method steps.

"Comprising" is a term of art used in claim language to mean that the stated elements are essential but that other elements may be added and still form a construct within the scope of the claim.

As used herein, the phrase "consisting of excludes any element, step or component not specified in a claim. When the phrase "consisting of" appears in a clause of the body of a claim, rather than immediately following the preamble, it only qualifies the elements listed in said clause, other elements are not excluded as A whole claims outside.

As used herein, the phrase "consisting essentially of" limits the scope of a claim to the specified materials or steps plus basic and novel features that do not materially affect the claimed subject matter of those.

With respect to the terms "comprising", "consisting of" and "consisting essentially of", when one of these three terms is used herein, the invention disclosed and claimed The subject matter can include the use of either of the other two terms.

As used herein, the term "alkyl" refers to a C _1-20 (inclusive) linear (ie, "straight chain"), branched or cyclic, saturated or at least partially unsaturated and in some cases fully Unsaturated (i.e., alkenyl and alkynyl) hydrocarbon chains including, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, octyl, ethylene propenyl, butenyl, pentenyl, hexenyl, octenyl, butadienyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, and allenyl . "Branched"refers to an alkyl group in which a lower alkyl group such as methyl, ethyl or propyl is attached to a linear alkyl chain. "Lower alkyl" refers to an alkyl group having 1 to about 8 carbon atoms (ie, C _1-8 alkyl), for example 1, 2, 3, 4, 5, 6, 7 or 8 carbon atoms. "Higher alkyl" means an alkyl group having from about 10 to about 20 carbon atoms, eg, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 carbon atoms. In certain embodiments, "alkyl" especially refers to C _1-8 straight chain alkyl. In certain embodiments, "alkyl" especially refers to C _1-8 branched chain alkyl.

An alkyl group may be optionally substituted with one or more alkyl substituents ("substituted alkyl"), wherein the substituents may be the same or different. The term "alkyl substituent" includes, but is not limited to: alkyl, substituted alkyl (including, but not limited to, perhaloalkyl, such as perfluoroalkyl), aralkyl, substituted aralkyl, halogen, amino, Alkylamino, arylamino, aryl, substituted aryl, nitro, thio, acyl, hydroxy, aryloxy, alkoxy, perhaloalkoxy, alkylthio, arylthio, Aralkyloxy, aralkylthio, carboxy, alkoxycarbonyl, oxo and cycloalkyl. One or more oxygen, sulfur, or substituted or unsubstituted nitrogen atoms may optionally be inserted along the alkyl chain, wherein the nitrogen substituent is hydrogen, lower alkyl (also referred to herein as "alkylaminoalkyl") ) or aryl.

Thus, as used herein, the term "substituted alkyl" includes an alkyl group as defined herein, wherein one or more atoms or functional groups of the alkyl group are replaced by another atom or functional group (including, for example, alkyl, substituted alkyl yl, aralkyl, substituted aralkyl, halogen, aryl, substituted aryl, alkoxy, carboxy, acyl, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate, and mercapto )replace.

The term "aryl" as used herein refers to an aromatic substituent, which may be a single aromatic ring or multiple aromatic rings fused together. The term "aryl" specifically includes heterocyclic aromatic compounds. Aromatic rings may include, inter alia, phenyl, naphthyl, furyl, thienyl and pyridyl. In particular embodiments, the term "aryl" means an aromatic ring comprising about 5 to about 10 carbon atoms, such as 5, 6, 7, 8, 9 or 10 carbon atoms, and includes 5- and 6-membered Hydrocarbon aromatic rings and heterocyclic aromatic rings.

An aryl group can be optionally substituted with one or more aryl substituents ("substituted aryl"), wherein the aryl substituents can be the same or different. The term "aryl substituent" includes, but is not limited to: alkyl, substituted alkyl (including, but not limited to, perhaloalkyl (eg, perfluoroalkyl)), aryl, substituted aryl, aralkyl, hydroxy , alkoxy, perhaloalkoxy, aryloxy, aralkyloxy, carboxyl, acyl, halogen, nitro, alkoxycarbonyl, aryloxycarbonyl, aralkyloxycarbonyl, acyloxy, acyl Amino (e.g., aroylamino), amido, carbamoyl, alkylcarbamoyl, dialkylcarbamoyl, arylthio, alkylthio, alkylene, and -NR'R", where R' and R" each independently can be hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, and aralkyl.

Thus, as used herein, the term "substituted aryl" includes aryl groups as defined herein, wherein one or more atoms or functional groups of the aryl group are replaced by another atom or functional group (including, for example, alkyl, substituted alkyl , halogen, aryl, substituted aryl, alkoxy, aryloxy (eg, phenoxy), hydroxyl, nitro, amino, alkylamino (eg, phenylamino), dialkylamino, aryl amino, carboxyl, acyl (e.g., benzoyl), sulfate, and mercapto) substitutions. Thus, substituted aryl includes aryl-substituted aryl (ie, "biaryl").

Specific examples of aryl groups include, but are not limited to, cyclopentadienyl, phenyl, naphthyl; and heteroaryl groups including, but not limited to, furan, thiophene, pyrrole, Azole, triazole, pyran, pyridine, imidazole, benzimidazole, benzofuran, benzo Azole, benzothiazole, isothiazole, iso Azole, pyrazole, pyrazine, thiazole, triazine, pyrimidine, pyridazine, quinoline, isoquinoline, indole, carbazole, etc.

The term "heteroaryl" refers to an aryl group as defined above, wherein the backbone of the aromatic ring contains at least one heteroatom, such as, but not limited to, oxygen, sulfur, nitrogen or selenium. Exemplary heteroaryl groups include, but are not limited to: furan, thiophene, pyrrole, pyran, triazole (e.g., 1,2,3-triazolyl or 1,2,4-triazolyl), pyridine (e.g., 2-pyridyl, 3-pyridyl or 4-pyridyl), imidazole, benzimidazole, Azole, isothiazole, benzofuran, benzo azole, iso Azole, pyrazole, pyrazine, pyridazine, triazine, thiazole (for example, 4-thiazolyl or 5-thiazolyl), benzothiazole, benzotriazine, pyrimidine (for example, 4-pyrimidinyl or 2-pyrimidine base), quinoline, isoquinoline, indole and carbazole. "Nitrogen-containing heteroaryl" refers to a heteroaryl in which the backbone of the aromatic ring contains at least one nitrogen. Exemplary nitrogen-containing heteroaryl groups include, but are not limited to: pyrrole, triazole, pyridine, imidazole, benzimidazole, Azole, isothiazole, benzo azole, iso Azole, pyrazole, pyrazine, pyridazine, triazine, thiazole, benzothiazole, benzotriazine, pyrimidine, quinoline, isoquinoline, indole and carbazole.

As used herein, the term "acyl" refers to an organic acid group in which the -OH of the carboxyl group is replaced by another substituent. Thus, an acyl group may be represented by the general formula RC(=O)-, wherein R is alkyl, aralkyl or aryl as defined herein optionally substituted with one or more alkyl or aryl substituents. Thus, the term "acyl" specifically includes arylacyl (also referred to herein as "aroyl") wherein R is aryl (eg, furyl or phenyl) or substituted aryl. Specific examples of the acyl group include acetyl and benzoyl.

The term "acylamino" refers to the group -NHC(=O)R, where R is alkyl, aralkyl or aryl optionally substituted with one or more alkyl or aryl substituents.

"Cyclic" and "cycloalkyl" refer to non-aromatic monocyclic or polycyclic rings of about 3 to about 10 carbon atoms, for example 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms. ring system. Cycloalkyl groups can optionally be partially unsaturated. Cycloalkyl groups may also be optionally substituted with alkyl substituents, oxo and/or alkylene as defined herein. One or more oxygen, sulfur, or substituted or unsubstituted nitrogen atoms may optionally be inserted along the cycloalkyl chain, where the nitrogen substituent is hydrogen, alkyl, substituted alkyl, aryl, or substituted aryl , thus providing a heterocyclyl. Representative monocyclic cycloalkyl rings include cyclopentyl, cyclohexyl and cycloheptyl. Multicyclic cycloalkyl rings include adamantyl, octahydronaphthyl, decalin, camphor, camphane and noradamantyl.

"Alkylene" means having from 1 to about 20 carbon atoms such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, A linear or branched divalent aliphatic hydrocarbon group of 18, 19 or 20 carbon atoms. Alkylene groups can be linear, branched or cyclic. The alkylene group may also optionally be unsaturated and/or substituted with one or more "alkyl substituents." One or more oxygen, sulfur, or substituted or unsubstituted nitrogen atoms (also referred to herein as "alkylaminoalkyl") may optionally be inserted along the alkylene group, wherein the nitrogen substituents are as previously described alkyl. Exemplary alkylene groups include methylene (-CH ₂ -); ethylene (-CH ₂ -CH ₂ -); propylene (-(CH ₂ ) ₃ -); cyclohexylene (-C ₆ H ₁₀ -); -CH=CH-CH=CH-; -CH=CH-CH ₂ -; -(CH ₂ ) _q -N(R)-(CH ₂ ) _r -, wherein q and r are each independently is an integer from 0 to about 20, such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 , and R is hydrogen or lower alkyl; methylenedioxy (-O-CH ₂ -O-0; and ethylenedioxy (-O-(CH ₂ ) ₂ -O-). Alkylene can be Has about 2 to about 3 carbon atoms, and may further have 6-20 carbons.

"Alkoxy" or "alkyloxy" means an alkyl-O- group in which the alkyl group is as previously described. The term "alkoxy" as used herein may relate to C _1-20 (inclusive) linear, branched or cyclic, saturated or unsaturated oxygenated hydrocarbon chains, including for example methoxy, ethoxy, propoxy , isopropoxy, butoxy, tert-butoxy and pentoxy.

"Aryloxy" or "aryloxy" means an aryl-O- group in which the aryl group is as previously described, including substituted aryl groups. As used herein, the term "aryloxy" may refer to phenoxy or hexyloxy, as well as alkyl, substituted alkyl, halogen or alkoxy substituted phenoxy or hexyloxy.

"Aralkyl" means an aryl-alkyl- group in which aryl and alkyl are as previously described, and may include substituted aryl (as well as heteroaryl and substituted heteroaryl) and substituted alkyl. Exemplary aralkyl groups include, but are not limited to, benzyl, phenethyl, furylmethyl, pyridylmethyl, pyridylethyl, and naphthylmethyl.

"Substituted aralkyl" refers to an aralkyl group wherein the aryl portion, the alkyl portion, or both the aryl and alkyl portions of the aralkyl group are substituted with one or more alkyl or aryl substituents.

"Aralkyloxy" and "aralkoxy" refer to aralkyl-O-, wherein the aralkyl group is as previously described. The aralkyl group of the aralkyloxy group may be a heteroaryl group. An exemplary aralkoxy group is benzyloxy.

"Perhaloalkyl" means an alkyl group as defined above in which every hydrogen atom attached to the carbon chain has been replaced by a halogen. "Perfluoroalkyl" refers to a perhaloalkyl group wherein the halogen is fluorine (ie, -F), such as, but not limited to, trifluoromethyl (ie, _-CF3 ).

"Perhaloalkoxy" means -O-perhaloalkyl. Perhaloalkoxy includes, but is not limited to, "perfluoroalkoxy" (ie, -O-perfluoroalkyl). Exemplary perhaloalkoxy groups are trifluoromethoxy (ie, _-OCF3 ) and tribromomethoxy (ie, _-OCBr3 ).

"Alkylamino" means a -NRR' group where R and R' are hydrogen, alkyl as previously described, or substituted alkyl, so long as at least one of R and R' is other than H. Exemplary alkylamino groups include methylamino, tert-butylamino, ethylamino, isopropylamino, ethylmethylamino, dimethylamino, and diethylamino.

"Arylamino" refers to the group -NRR' where R and R' are hydrogen, aryl as previously described, or substituted aryl, so long as at least one of R and R' is other than H. Exemplary arylamino groups include phenylamino, p-chlorophenylamino, p-fluorophenylamino, m-fluorophenylamino, p-methoxyphenylamino, p-trifluoromethylphenylamino, and the like.

"Alkoxycarbonyl" means an alkyl-O-C(=O)- group. Exemplary alkoxycarbonyl groups include methoxycarbonyl, ethoxycarbonyl, butoxycarbonyl and t-butoxycarbonyl.

"Aryloxycarbonyl" means an aryl-O-C(=O)- group. Exemplary aryloxycarbonyl groups include phenoxy- and naphthyloxy-carbonyl.

"Aralkoxycarbonyl" means an aralkyl-O-C(=O)- group. An exemplary aralkoxycarbonyl group is benzyloxycarbonyl.

The term "amino" refers to a _-NH2 group.

The term "carbonyl" refers to a -C(=O)- group.

The term "carboxy" refers to a -C(=O)OH or -C(=O)O- group.

The term "acylamino" refers to a _-C (=O)NR group wherein each R is independently H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, or substituted Aryl.

As used herein, the term "halogen" or "halo" refers to fluoro, chloro, bromo and iodo groups.

The term "hydroxyl" refers to a -OH group.

The term "nitro" refers to a _-NO2 group.

The term "thio" refers to the group -SR, where R is H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, or substituted aryl.

When the term "independently selected from" is used, the substituents referred to ₍ eg R, such as groups R1 and R2, or groups X and Y ₎ may be the same or different. For example, _{both R1} and R2 can be substituted alkyl, or _R1 can be _hydrogen and R2 can be substituted alkyl, etc.

Unless the context indicates otherwise, a named "R", "R'" or "X" group will generally have the art-recognized structure corresponding to the group bearing that designation. For purposes of illustration, certain representative "R" and "X" groups described above are defined below. These definitions are for supplementary and explanatory purposes, not exclusive; such definitions will be apparent to those skilled in the art on the basis of this disclosure.

II. General Considerations

Spectinomycin (MW332) is the lowest molecular weight member of the aminoglycoside antibiotics. It selectively binds to a unique binding site in bacterial ribosomes (in RNA helix 34 of the head domain of the 30S ribosomal subunit), blocking translocation and consequently protein synthesis. This is a position distinct from the binding sites of other ribosomally active anti-TB therapeutics, including streptomycin, kanamycin, capreomycin, and linezolid. Spectinomycin is primarily used as a second-line treatment option for the treatment of N. gonorrhoeae in patients who are intolerant to more clinically effective first-line anti-Neisserial agents such as cephalosporins or fluoroquinolones ( Neisseriagonorrhoeae) infection. See Holloway , The Medical Clinics of North America, 66(1), 169-173 (1982); and Novak et al ., Antimicrob. Agents Chemother., 34(12), 2342-2347 (1990).

Due to the discovery and development of spectinomycin, the structurally similar compounds spectinomycin and acmimycin have been evaluated clinically, among which spectinomycin has entered phase III clinical trials for the treatment of general Gram-positive bacterial infections. See Gismondo et al., Drugs Exp. Clin. Res., 17(2), 101-104 (1991). Spectinomycin, betaspectinomycin and acmimycin are shown in Table 1 below.

Chart 1. Structures of Spectinomycin, Spectinomycin and Acmimycin

III. 3'-Acylamino and 3'-Alkylamino Spectinomycin Derivatives

The presently disclosed subject matter relates in part to 3'-deoxy3'-acylamino and 3'-deoxy3'-alkylamino spectinomycin analogs. In some embodiments, the presently disclosed subject matter provides a compound of formula (I) or a pharmaceutically acceptable salt or prodrug thereof:

in

R and R _are each independently selected from, but not limited to, H, alkoxycarbonyl, and aralkoxycarbonyl _;

R ₃ is an alkyl group;

R is independently selected from, but not limited to, H, hydroxy, alkyl or alkoxy _; and

R _is selected from, but not limited to, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, substituted aryl, and acyl.

_In some embodiments, each _of R and R is H. In some embodiments, _one or _both of R1 and R2 are nitrogen protecting groups. Nitrogen protecting groups that can be used in accordance with the presently disclosed subject matter are described, for example, in Greene and Wuts , Protective Groups in Organic Synthesis, Third Edition; New York, John Wiley & Sons, Inc., 1999. _In some embodiments, R and/or R is _an alkoxycarbonyl or aralkoxycarbonyl group that can form a carbamate with a spectinomycin nitrogen atom. In some embodiments, R ₁ and/or R ₂ are groups that are removable by catalytic hydrogenation. For example, various aralkoxycarbonyl groups can be used to mask amino groups and can be removed by catalytic hydrogenation (eg, using a palladium catalyst). _In some embodiments, R and/or R are _{aralkoxycarbonyl} selected from benzyloxycarbonyl and benzyloxycarbonyl substituted with one or more of halo, alkoxy and nitro. Such groups include, but are not limited to, benzyloxycarbonyl (CBz), p-methoxybenzyloxycarbonyl (Moz), p-nitrobenzyloxycarbonyl (PNZ), p-bromobenzyloxycarbonyl, p-chlorobenzyloxycarbonyl, 2, 4-dichlorobenzyloxycarbonyl and 3,4-dimethoxy-6-nitrobenzyloxycarbonyl. Other aralkoxycarbonyl protecting groups include, but are not limited to, diphenylmethyloxycarbonyl, 5-benziso Azolylmethyloxycarbonyl (Bic) and 9-anthracenylmethyloxycarbonyl. _In some embodiments, _both R and R are CBz.

In some embodiments, R ₃ is C ₁ -C ₈ alkyl (eg, methyl, ethyl, or branched, linear, or cyclic propyl, butyl, pentyl, hexyl, heptyl, or octyl base). In some embodiments, R ₃ is methyl or butyl (eg, n-butyl).

_In some embodiments, R4 is selected from H, OH, methyl and methoxy. _In some embodiments, R4 is hydroxyl.

_In some embodiments, R is alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, or substituted aryl. In some embodiments, R ₅ includes heteroaryl or cycloalkyl (eg, -CH ₂ -heteroaryl or -CH ₂ -cycloalkyl). In some embodiments, the compound of formula (I) is selected from:

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylaminospectinomycin (1419);

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin (1422);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylaminospectinomycin (1423);

3'-Dihydro-3'-deoxy-4(R)-(4-fluoro)benzylaminospectinomycin (1424); and

3'-Dihydro-3'-deoxy-4(R)-2-phenylethylaminospectinomycin (1450);

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, R ₅ is acyl and the compound of formula (I) is a 3'-acylamino spectinomycin derivative, which may also be referred to as "spectinomycin amide". Thus, R ₅ may have the structure —C(=O)R ₆ , wherein R ₆ is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aryl. _In some embodiments, R6 is or comprises heteroaryl.

In some embodiments, R is selected from heteroaryl, substituted heteroaryl, ₂ -substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R is selected from _aralkyl , substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is one or more of the groups that can be classified as Phenyl: fluorine-substituted phenyl, alkyl-substituted phenyl, 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and two phenyl carbons in which are disubstituted phenyl substituted with alkylene; and wherein each R ₈ is independently aryl or substituted aryl. In some embodiments, R ₆ is alkyl, alkylaminoalkyl or alkylaminoacyl selected from -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ ) CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ )CH(CH ₃ ) ₂ , -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH _{2 NHC} (=O _{) C6H5} and _{-CH2CH2NHC (} =O _{) CH2C6H5} .

In some embodiments, R ₆ is 2-fluorophenyl or 4-fluorophenyl. _In some embodiments, R is heteroaryl or substituted heteroaryl, wherein said heteroaryl is selected from pyridyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, triazolyl, triazinyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. When _R is a substituted heteroaryl, the heteroaryl ring may be substituted by one or more substituents selected from the group consisting of halogen, nitro, hydroxyl, amino, alkylamino, arylamino, alkyl , alkoxy, substituted alkyl (eg, perhaloalkyl), perhaloalkoxy, aralkyl, aralkoxy, aryl, aryloxy, substituted aryl, carboxy, acyl, and amido. For example, heteroaryl substituents can be fluoro, chloro, bromo, methyl, methoxy, _NH2 , _NO2 , trifluoromethoxy, phenyl, substituted phenyl (eg, halogen substituted phenyl) Or trifluoromethyl etc.

In some embodiments, R ₆ is diarylmethylene having the structure —C(R ₈ ) ₂ , wherein each R ₈ is independently aryl or substituted aryl. Thus, _R8 may be phenyl or heteroaryl (such as one of the _heteroaryls described above for R6), substituted phenyl or substituted heteroaryl. In some embodiments, both R ₈ are phenyl.

_In some embodiments, R6 has the structure _-CH2R7 and the compound of _formula (I) is a compound of formula (Ia) or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from _aralkyl , substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl can be classified as one or more of the following: fluorine-substituted Phenyl, alkyl substituted phenyl, 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted in which both phenyl carbons are substituted together with an alkylene group phenyl.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl.

_In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ comprises a heteroaryl selected from pyridyl, thiazolyl, benzo Azolyl and benzothiazolyl.

_In some embodiments, R is a substituted heteroaryl, wherein the heteroaryl is substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxy, carboxy, Acyl, alkyl, substituted alkyl (eg, perhaloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy, and substituted aryl. Thus, _R7heteroaryl may be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl or trifluoromethyl. _In some embodiments, R heteroaryl can be substituted with aryl or aryl _- containing groups such that R as a whole is _biaryl (i.e., R heteroaryl with another aryl or substituted aryl group directly, or to another aryl or substituted aryl through a linker, such as an alkylene (e.g., methylene), -O-, -C(=O)-, or -NH -). The aryl _- containing group attached to R heteroaryl can be, for example, phenyl, benzyl, phenoxy, benzoyl, halogen-substituted phenyl (e.g., p-fluorophenyl), alkoxy-substituted phenyl (e.g. m-methoxyphenyl) etc., or phenylamino or substituted phenylamino (e.g. halo-, alkyl-, alkoxy-, perhaloalkyl- or perhaloalkoxy-substituted phenylamino).

_In some embodiments, R is aralkyl or substituted aralkyl, which includes heteroaryl or substituted heteroaryl. In some embodiments, an aralkyl or substituted aralkyl group may comprise a heteroaryl group selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ is a group comprising pyridyl, thiazolyl, benzo Aralkyl or substituted aralkyl of azolyl or benzothiazolyl. The heteroaryl portion of the aralkyl group may be substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxycarboxyl, acyl, alkyl, substituted alkyl (e.g., per haloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy and substituted aryl. For example, a heteroaryl group can be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl, or trifluoromethyl. Furthermore, the alkyl portion of the aralkyl _R7 can also be substituted by, for example, alkyl, acyl, amino, acylamino, halogen, hydroxy or other alkyl substituents.

In some embodiments, _R7 is nitrogen-containing heteroaryl optionally substituted with one or more aryl substituents. In some embodiments, at least one nitrogen atom of the nitrogen-containing heteroaryl is adjacent (ie, at the 2-position) to the atom directly attached to the acylmethylene group in the structure of Formula (Ia). In some embodiments, the compound of Formula (Ia) is a compound of Formula (Ib), (Ic) or (Id), or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

X2 and _X3 are O, S or NH _;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl (e.g., phenyl or heteroaryl), aryloxy, acyl (e.g., aroyl), and substituted aryl (e.g., , substituted heteroaryl or substituted phenyl); or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene (eg, -CH=CH-CH=CH-); and

wherein each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl (e.g., phenyl or heteroaryl), and substituted aryl (e.g., substituted phenyl or substituted heteroaryl).

In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is N(R ₁₅ ) ₂ , eg, one of R ₁₅ is aryl or substituted aryl. In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is aryl or substituted aryl.

In some embodiments, the compound is of formula (Ib), wherein X ₁ is CH, and wherein R ₁₀ is other than H (eg, wherein R ₁₀ is selected from aryl, substituted aryl, halo, or nitro). In some embodiments, the compound is of formula (Id), wherein X ₃ is S and R ₁₃ is H. In some embodiments, R ₁₄ is N(R ₁₅ ) ₂ .

In some embodiments, the compound of formula (I) is selected from:

3'-dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylaminospectinomycin (1299);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin (1329);

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin (1364);

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin (1365);

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin (1367);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin (1368);

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin (1370);

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin (1399);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin (1400);

3'-dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin (1411);

3'-Dihydro-3'-deoxy-4(R)-m-tolylacetamidospectinomycin (1412);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin (1413);

3'-dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)acetamidospectinomycin (1439);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443);

3'-dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin (1444);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin (1447);

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin (1448)

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin (1449);

3'-Dihydro-3'-deoxy-4(R)-(pyrazin-2-yl)carboxamidospectinomycin (1453);

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin (1465);

3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin (1466);

3'-Dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylaminospectinomycin (1487);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin (1489);

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin (1490);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-Dihydro-3'-deoxy-4(R)-(2-fluorophen-1-yl)carboxamidospectinomycin (1492);

3'-dihydro-3'-deoxy-4(R)-(2,2-diphenyl)acetamidospectinomycin (1514);

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin (1516);

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin (1517);

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylaminospectinomycin (1518);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin (1520);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylaminospectinomycin (1536);

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin (1537);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542);

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543);

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin (1544);

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin (1351);

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylaminospectinomycin (1369);

3'-Dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylaminospectinomycin (1485);

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylaminospectinomycin (1486);

3'-dihydro-3'-deoxy-4(R)-[2(S)-(2-aminoacetamido)-3-phenyl]propionyl-aminospectinomycin (1502);

3'-Dihydro-3'-deoxy-4(R)-3-benzamidopropionylaminospectinomycin (1503); and

3'-Dihydro-3'-deoxy-4(R)-3-(2-phenylacetamido)propionylaminospectinomycin (1504);

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound of formula (I) has increased cellular uptake into Mycobacterium tuberculosis, other bacteria, or infected host tissue compared to spectinomycin. In some embodiments, the compound has better bioavailability after oral administration than spectinomycin. In some embodiments, the compound has increased affinity for the M. tuberculosis 30S ribosome as compared to spectinomycin. In some embodiments, the compound has reduced susceptibility to excretion by drug efflux mechanisms as compared to spectinomycin.

IV. Prodrugs

In some representative embodiments, the compounds disclosed herein are prodrugs. Prodrug means a compound which, upon administration to a recipient, is capable of providing (directly or indirectly) a compound of the presently disclosed subject matter or an active metabolite or residue thereof. Prodrugs can increase the bioavailability of compounds of the presently disclosed subject matter when such compounds are administered to a subject (e.g., by making orally administered compounds more readily absorbed into the blood), or can enhance compounds to specific biological compartments Delivery of (eg, cells, tissues, biological systems).

Prodrugs of the disclosed compounds of the present invention may include one of the hydroxyl groups of the compounds of formula (I), (Ia), (Ib), (Ic) and/or (Id) in combination with an acid halide, acid anhydride or activated ester (e.g., five The ester formed by the reaction of fluorophenyl ester). Esters of prodrugs can be cleaved in vivo by esterases present in plasma or tissues, or can be hydrolyzed in aqueous conditions at physiological pH. Prodrugs of the disclosed compounds of this invention can also be formed by derivatizing the amino or hydroxyl groups of compounds of formula (I), (Ia), (Ib), (Ic) and/or (Id) to form carbamates, Carbonates, phosphates, azo groups or amides, which can be cleaved under physiological conditions (eg, at a specific pH or by enzymes).

V. Pharmaceutically acceptable salts

The compounds described herein can be administered as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are described, for example, in Berge et al., (J. Pharm. Sci., 66(1), 1-19 (1977)), which is hereby incorporated by reference in its entirety. The term "pharmaceutically acceptable" may relate to a salt (or carrier) that is pharmaceutically acceptable in humans.

Pharmaceutically acceptable salts include, but are not limited to, gluconate, lactate, acetate, tartrate, citrate, phosphate, maleate, borate, nitrate, sulfate, and hydrochloride salts. Salts of compounds described herein can be prepared, for example, by reacting a base compound with the desired acid in solution. After the reaction is complete, the salt is crystallized from solution by adding an appropriate amount of a solvent in which the salt does not dissolve. In some embodiments, the hydrochloride salt is prepared by passing hydrogen chloride gas through an ethanolic solution of the free base. In some embodiments, the pharmaceutically acceptable salt is hydrochloride or hydrobromide.

VI. Methods of Treating Microbial Infections

In some embodiments, the presently disclosed subject matter relates to a method of treating a microbial infection in a subject in need thereof, wherein the method comprises administering to the subject a spectinomycin derivative (e.g., formula (I), (Ia), (Ib), (Ic) and/or (Id) compounds, or prodrugs and/or pharmaceutically acceptable salts thereof).

Infections treatable by the presently disclosed subject matter can be caused by a variety of microorganisms, including fungi, algae, protozoa, bacteria and viruses. In some embodiments, the infection is a bacterial infection. Exemplary bacterial infections treatable by the methods of the presently disclosed subject matter include, but are not limited to, infections caused by Staphylococcus aureaus, Enterococcus faecalis, Bacillus anthracis, Streptococcus Streptococcus species (eg, Streptococcus pyogenes and Streptococcus pneumoniae), Escherichia coli, Pseudomonas aeruginosa, Burkholderia cepacia, Proteus Proteus species (eg, Proteus mirabilis and Proteus vulgaris), Klebsiellapneumoniae, Acinetobacterbaumannii, Strenotrophomonas maltophilia , Mycobacterium tuberculosis, Mycobacterium bovis, other mycobacteria of the tuberculosis complex, and non-tuberculous mycobacteria, including Mycobacterium ulcerans.

The methods of the presently disclosed subject matter are useful for treating these disorders, as they inhibit the onset, progression, or spread of the disorder, cause regression of the disorder, cure the disorder, or otherwise improve the health of a patient suffering from, at risk of having, or infected with the disorder. general health. Thus, in accordance with the presently disclosed subject matter, the term "treatment" and its grammatical conjugations, as well as the phrase "method of treatment" are intended to include any desired therapeutic intervention, including but not limited to methods of treating an infection present in a subject, as well as prophylaxis ( That is, methods of preventing infection, such as in a subject who has been exposed or is expected to be exposed to a microorganism disclosed herein.

In some embodiments, the spectinomycin derivative is provided in a pharmaceutical formulation for oral, intravenous, intramuscular, nasal or topical administration. Thus, in some embodiments, the formulations may be prepared in dosage forms such as, but not limited to, tablets, capsules, liquids (solutions or suspensions), suppositories, ointments, creams, or aerosols. In some embodiments, the presently disclosed subject matter provides said compounds and/or formulations which have been lyophilized and reconstituted into pharmaceutically acceptable formulations for administration, eg, by intravenous or intramuscular injection.

In some embodiments, the Spectinomycin Derivative is administered to the subject before, after, or simultaneously with one or more other therapeutic compounds. Other therapeutic compounds may be known antimicrobial compounds or therapeutic agents that reduce pain and/or fever (eg, anti-inflammatory compounds). For example, other therapeutic compounds may be antibiotics such as penicillins such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; cephalosporins such as cefaclor, ceftizolin carbapenems; monocyclic lactam antibiotics; tetracyclines; macrolides; lincomycin; polymyxins; sulfonamides; quinolones; cloramphenical; metronidrine Pyridazole; Trimethoprim; Vancomycin; Streptomycin, etc. In some embodiments, the additional compound is a known anti-tuberculosis compound such as, but not limited to, isoniazid, ethambutol, and rifampicin (ie, Rifampicin).

In some embodiments, the spectinomycin derivative has selective activity against specific types of bacterial infections. For example, in some embodiments, the compound has selective activity against Mycobacterium tuberculosis, Bacillus anthracis, Enterococcus faecalis, Streptococcus pneumoniae, Acinetobacter baumannii, or Stenotrophomonas maltophilia. "Selective activity" means that the compound exhibits higher activity against a particular type of infection than against other types of infection. In some embodiments, the compound is 2, 5, 10, 20, 50, 100 or more times more active against one type of infection than another type of infection, as measured by the minimum inhibitory concentration (MIC) as measured.

In some embodiments, microbial infections include infections caused by mycobacteria, including the organism Mycobacterium tuberculosis. In some embodiments, the infection is caused by a multidrug resistant strain of Mycobacterium tuberculosis. Infections can also be caused by other mycobacteria, including but not limited to: M. bovis; other mycobacteria of the tuberculosis complex (e.g., M. africanum, M. canetti, vole Mycobacterium (M.microti)); or non-tuberculous mycobacteria such as but not limited to Mycobacterium ulcerans (M.ulcerans), Mycobacterium avium intracellulare (M.aviumintracellulare), Mycobacterium kansasii (M. kansasii), Mycobacterium fortuitum (M.fortuitum), Mycobacterium chelonae (M.chelonae), Mycobacterium leprae (M.leprae).

In some embodiments, a spectinomycin derivative is administered to a subject who already has a microbial infection. In some embodiments, the Spectinomycin Derivative is administered prophylactically to prevent microbial infection or prevent recurrence of microbial infection. Accordingly, in some embodiments, the spectinomycin derivative is administered prophylactically to prevent or reduce the occurrence of one of: (a) microbial infection in a subject at risk of infection; (b) recurrence of microbial infection and (c) combinations thereof.

In some embodiments, the presently disclosed subject matter provides a method of treating a bacterial infection in a subject in need thereof, wherein the method comprises administering to the subject a compound of formula (I) or a pharmaceutically acceptable salt thereof or Prodrugs:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R _is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, substituted aryl and acyl.

_In some embodiments, each _of R and R is H. In some embodiments, R ₃ is C ₁ -C ₈ alkyl (eg, methyl, ethyl, or branched, linear, or cyclic propyl, butyl, pentyl, hexyl, heptyl, or octyl base). In some embodiments, R ₃ is methyl or butyl (eg, n-butyl). _In some embodiments, R4 is selected from H, OH, methyl and methoxy. _In some embodiments, R4 is hydroxyl.

In some embodiments, the compound of Formula (I) is spectinomycin amide (ie, wherein R ₅ is acyl). In some embodiments, R ₅ is -C(=O)R ₆ , wherein R ₆ is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted aralkyl. In some embodiments, R ₅ is -C(=O)R ₆ , wherein:

(a) R ₆ is selected from -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH(NH ₂ )CH (CH ₃ ) ₂ , -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH ₂ NHC(=O)C ₆ H ₅ and -CH ₂ CH ₂ NHC(=O _{) CH2C6H5 ;} or

(b) R ₆ is selected from heteroaryl, substituted heteroaryl, 2-substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R ₇ is selected from from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl is selected from fluorine-substituted phenyl, alkyl-substituted phenyl, 2- Substituted phenyl, ₃ -monosubstituted phenyl, 2,3-disubstituted phenyl, and disubstituted phenyl in which two phenyl carbons are substituted together by alkylene; and wherein R is independently aryl or substituted aryl;

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, R ₆ is 2-fluorophenyl or 4-fluorophenyl. _In some embodiments, R is heteroaryl or substituted heteroaryl, wherein said heteroaryl is selected from pyridyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, triazolyl, triazinyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. When _R is a substituted heteroaryl, the heteroaryl ring may be substituted by one or more substituents selected from the group consisting of halogen, nitro, hydroxy, amino, alkylamino, arylamino, alkyl , alkoxy, substituted alkyl (eg, perhaloalkyl), perhaloalkoxy, aralkyl, aralkoxy, aryl, aryloxy, substituted aryl, carboxy, acyl, and amido. For example, a heteroaryl substituent may be fluoro, chloro, bromo, methyl, methoxy, _NH2 , _NO2 , trifluoromethoxy, phenyl, substituted phenyl, or trifluoromethyl, and the like.

In some embodiments, R ₆ is diarylmethylene having the structure —C(R ₈ ) ₂ , wherein each R ₈ is independently aryl or substituted aryl. Thus, _R8 may be phenyl or heteroaryl (such as one of the _heteroaryls described above for R6), substituted phenyl or substituted heteroaryl. In some embodiments, both R ₈ are phenyl.

In some embodiments, R ₆ has the structure —CH ₂ R ₇ , and the compound of formula (I) is a compound of formula (Ia), or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is selected from: fluorine _- substituted phenyl, alkyl-substituted phenyl phenyl, 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and disubstituted phenyl in which two phenyl carbons are substituted together by an alkylene group.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl.

_In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ comprises pyridyl, thiazolyl, benzo Heteroaryl of azolyl and benzothiazolyl.

_In some embodiments, R is a substituted heteroaryl, wherein the heteroaryl is substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxy, carboxy, Acyl, alkyl, substituted alkyl (eg, perhaloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy, and substituted aryl. Thus, _R7heteroaryl may be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl or trifluoromethyl. In some embodiments, _R7heteroaryl is substituted with an aryl or aryl-containing group such that _R7 as a whole is biaryl (i.e., _R7heteroaryl with another aryl or substituted aryl directly, or to another aryl or substituted aryl through a linker, such as an alkylene (eg, methylene), -O-, -C(=O)-, or -NH- ). The aryl _- containing group attached to R heteroaryl can be, for example, phenyl, benzyl, phenoxy, benzoyl, halogen-substituted phenyl (e.g., p-fluorophenyl), alkoxy-substituted phenyl (e.g. m-methoxyphenyl) etc., or phenylamino or substituted phenylamino (e.g. halo-, alkyl-, alkoxy-, perhaloalkyl- or perhaloalkoxy-substituted phenylamino).

_In some embodiments, R is aralkyl or substituted aralkyl comprising heteroaryl or substituted heteroaryl. In some embodiments, an aralkyl or substituted aralkyl group may comprise a heteroaryl group selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ is a group comprising pyridyl, thiazolyl, benzo Aralkyl or substituted aralkyl of azolyl or benzothiazolyl. The heteroaryl portion of the aralkyl group may be substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxy, carboxy, acyl, alkyl, substituted alkyl (e.g., perhaloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy and substituted aryl. For example, a heteroaryl group can be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl, or trifluoromethyl. Furthermore, the alkyl portion of the aralkyl _R7 can also be substituted by, for example, alkyl, acyl, amino, acylamino, halogen, hydroxy or other alkyl substituents.

In some embodiments, _R7 is nitrogen-containing heteroaryl optionally substituted with one or more aryl substituents. In some embodiments, at least one nitrogen atom of the nitrogen-containing heteroaryl is adjacent (ie, at the 2-position) to the atom directly attached to the acylmethylene group in the structure of Formula (Ia). In some embodiments, the compound of Formula (Ia) is a compound of Formula (Ib), (Ic) or (Id), or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

X2 and _X3 are O, S or NH _;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl (e.g., phenyl or heteroaryl), aryloxy, acyl (e.g., aroyl), and substituted aryl (e.g., , substituted phenyl or substituted heteroaryl); or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene (eg, -CH=CH-CH=CH-); and

wherein each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl (e.g., phenyl or heteroaryl), and substituted aryl (e.g., substituted phenyl or substituted heteroaryl).

In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is N(R ₁₅ ) ₂ , eg, one of R ₁₅ is aryl or substituted aryl. In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is aryl or substituted aryl.

In some embodiments, the compound is of formula (Ib), wherein X ₁ is CH, and wherein R ₁₀ is other than H (eg, wherein R ₁₀ is selected from aryl, substituted aryl, halo, or nitro). In some embodiments, the compound is of formula (Id), wherein X ₃ is S and R ₁₃ is H. In some embodiments, R ₁₄ is N(R ₁₅ ) ₂ .

In some embodiments, the compound of formula (I) is selected from:

3'-dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylaminospectinomycin (1299);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin (1329);

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin (1364);

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin (1365);

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin (1367);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin (1368);

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin (1370);

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin (1399);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin (1400);

3'-dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin (1411);

3'-Dihydro-3'-deoxy-4(R)-m-tolylacetamidospectinomycin (1412);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin (1413);

3'-dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)acetamidospectinomycin (1439);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443);

3'-dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin (1444);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin (1447);

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin (1448);

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin (1449);

3'-Dihydro-3'-deoxy-4(R)-(pyrazin-2-yl)carboxamidospectinomycin (1453);

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin (1465);

3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin (1466);

3'-Dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylaminospectinomycin (1487);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin (1489);

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin (1490);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin (1516);

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin (1517);

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylaminospectinomycin (1518);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin (1520);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylaminospectinomycin (1536);

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin (1537);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542);

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543);

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin (1544);

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin (1351);

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylaminospectinomycin (1369);

3'-Dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylaminospectinomycin (1485);

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylaminospectinomycin (1486);

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylaminospectinomycin (1419);

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin (1422);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylaminospectinomycin (1423);

3'-Dihydro-3'-deoxy-4(R)-(4-fluoro)benzylaminospectinomycin (1424); and

3'-Dihydro-3'-deoxy-4(R)-2-phenylethylaminospectinomycin (1450);

or a pharmaceutically acceptable salt or prodrug thereof.

In some embodiments, the compound is administered orally, topically, intravenously, or by inhalation. In some embodiments, an additional therapeutic compound is administered to the subject before, after, or during administration of a compound of formula (I).

In some embodiments, the infection is an infection with Gram-positive bacteria, such as, but not limited to, Mycobacterium infection, Bacillus anthracis infection, Enterococcus faecalis, and Streptococcus pneumoniae infection.

In some embodiments, the infection is Bacillus anthracis infection, and the compound of formula (I) is selected from: 3'-dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin ( 1368), 3'-dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443) or 3'-dihydro-3'-deoxy-4(R) -(2-Aminothiazol-4-yl)acetamidospectinomycin (1444).

In some embodiments, the infection is a Streptococcus pneumoniae infection, and the compound of formula (I) is selected from:

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin (1329);

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin (1465);

3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin (1466);

3'-Dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylaminospectinomycin (1487);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin (1489);

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin (1490);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-dihydro-3'-deoxy-4(R)-(pyrimidin-2-yl)acetamidospectinomycin (1439);

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin (1516);

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin (1517);

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylaminospectinomycin (1518);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin (1520);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin (1447);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin (1537);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542);

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543);

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin (1544);

3'-Dihydro-3'-deoxy-4(R)-(4-methoxyphenyl)acetamidospectinomycin (1446); and

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-phenyl]propionylaminospectinomycin (1515).

In some embodiments, the infection is an Enterococcus faecalis infection, and the compound of formula (I) is selected from:

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin (1422);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin (1537);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)-amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542); and

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543).

In some embodiments, the infection is a Mycobacterium tuberculosis infection and the compound of formula (I) is selected from:

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin (1329);

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin (1367);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin (1368);

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin (1399);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin (1400);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443);

3'-dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin (1444);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin (1466);

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl)acetamidospectinomycin (1465)

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin (1489);

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin (1490);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin (1516);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-dihydro-3'-deoxy-4(R)-(2-phenylamino)thiazol-4-yl)acetamidospectinomycin (1520);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542);

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543); and

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin (1544);

or a pharmaceutically acceptable salt or prodrug thereof.

VII. Methods of treating tuberculosis

It is believed that the present disclosure shows for the first time that 3'-aminospectinomycin derivatives and 3'-acylaminospecttinomycin derivatives are effective in the treatment of tuberculosis-associated infection. Accordingly, in some embodiments, the presently disclosed subject matter provides a method of treating tuberculosis in a subject in need thereof, wherein the method comprises administering to the subject an effective amount of a compound of formula (I) or an alternative Medicinal salts or prodrugs:

in

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R _is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, substituted aryl and acyl.

Accordingly, the methods of the presently disclosed subject matter are useful in the treatment of these tuberculosis because they inhibit the initiation, progression or spread of TB infection, cause regression of TB infection, cure TB infection, or otherwise improve suffering from, risk of having, or infection General health of subjects with tuberculosis.

_In some embodiments, each _of R and R is H. In some embodiments, R ₃ is C ₁ -C ₈ alkyl (eg, methyl, ethyl, or branched, linear, or cyclic propyl, butyl, pentyl, hexyl, heptyl, or octyl base). In some embodiments, R ₃ is methyl or butyl (eg, n-butyl). _In some embodiments, R4 is selected from H, OH, methyl and methoxy. _In some embodiments, R4 is hydroxyl.

In some embodiments, R ₅ is alkyl or aralkyl comprising heteroaryl or cycloalkyl (eg, -CH ₂ -heteroaryl or -CH ₂ -cycloalkyl). In some embodiments, R ₅ is a substituted aralkyl comprising a substituted phenyl.

In some embodiments, R ₅ is acyl and has the structure -C(=O)R ₆ , wherein R ₆ is selected from the group consisting of alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl, and substituted Aryl.

In some embodiments, R ₆ is selected from: -CH ₂ NHC(CH ₃ ) ₃ , -CH ₂ CH(CH ₃ ) ₂ , -CH(NH ₂ )CH(CH ₃ )CH ₂ CH ₃ , -CH( NH ₂ )CH(CH ₃ ) ₂ , -CH(CH ₂ C ₆ H ₅ )NHC(=O)CH ₂ NH ₂ , -CH ₂ CH ₂ NHC(=O)C ₆ H ₅ and -CH ₂ CH _{2 NHC} (=O _{) CH2C6H5} .

In some embodiments, R is selected from heteroaryl, substituted heteroaryl, ₂ -substituted phenyl, 4-halogen substituted phenyl, -CH ₂ R ₇ and -C(R ₈ ) ₂ ; wherein R ₇ is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl and substituted phenyl, wherein the substituted phenyl can be characterized as one or more of the following: fluorine-substituted Phenyl, alkyl substituted phenyl, 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and disubstituted in which two phenyl carbons are substituted together by an alkylene phenyl; and each R ₈ is independently aryl or substituted aryl.

In some embodiments, the compound of formula (I) is a compound of formula (Ia) or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _; and

R is selected from aralkyl, substituted aralkyl, heteroaryl, substituted heteroaryl, and substituted phenyl, wherein the substituted phenyl is selected from: fluorine _- substituted phenyl, alkyl-substituted phenyl phenyl, 2-substituted phenyl, 3-monosubstituted phenyl, 2,3-disubstituted phenyl and disubstituted phenyl in which two phenyl carbons are substituted together by an alkylene group.

In some embodiments, R is a substituted phenyl selected from ₄ -fluorophenyl, 4-methylphenyl, 3-methylphenyl, 3-methoxyphenyl, 2-methoxy Phenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl.

_In some embodiments, R is heteroaryl or substituted heteroaryl comprising a heteroaryl selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ comprises pyridyl, thiazolyl, benzo Heteroaryl of azolyl and benzothiazolyl.

_In some embodiments, R is a substituted heteroaryl, wherein the heteroaryl is substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxy, carboxy, Acyl, alkyl, substituted alkyl (eg, perhaloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy, and substituted aryl. For example, _R7heteroaryl can be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl, or trifluoromethyl. In some embodiments, _R7heteroaryl is substituted with an aryl or aryl-containing group such that _R7 as a whole is biaryl (i.e., _R7heteroaryl with another aryl or substituted aryl directly, or to another aryl or substituted aryl through a linker, such as an alkylene (eg, methylene), -O-, -C(=O)-, or -NH- ). The aryl _- containing group attached to R heteroaryl can be, for example, phenyl, benzyl, phenoxy, benzoyl, halogen-substituted phenyl (e.g., p-fluorophenyl), alkoxy-substituted phenyl (e.g. m-methoxyphenyl) etc. or phenylamino or substituted phenylamino (e.g. halo-, alkyl-, alkoxy-, perhaloalkyl- or perhaloalkoxy-substituted phenyl base amino).

_In some embodiments, R is aralkyl or substituted aralkyl comprising heteroaryl or substituted heteroaryl. In some embodiments, an aralkyl or substituted aralkyl group may comprise a heteroaryl group selected from the group consisting of pyridyl, triazolyl, triazinyl, pyrimidinyl, pyridazinyl, Azolyl, furyl, benzofuryl, thienyl, pyrrolyl, imidazolyl, thiazolyl, quinolinyl, isoquinolyl, benzo Azolyl and benzothiazolyl. In some embodiments, R ₇ is a group comprising pyridyl, thiazolyl, benzo Aralkyl or substituted aralkyl of azolyl or benzothiazolyl. The heteroaryl portion of the aralkyl group may be substituted with one or more of the following groups: amino, alkylamino, arylamino, nitro, halo, hydroxycarboxyl, acyl, alkyl, substituted alkyl (e.g., per haloalkyl), alkoxy, perhaloalkoxy, aralkyl, aryl, aryloxy and substituted aryl. For example, a heteroaryl group can be substituted with one or more of fluoro, chloro, bromo, methoxy, methyl, _NO2 , trifluoromethoxy, phenylamino, phenyl, or trifluoromethyl. Furthermore, the alkyl portion of the aralkyl _R7 can also be substituted by, for example, alkyl, acyl, amino, acylamino, halogen, hydroxy or other alkyl substituents.

In some embodiments, _R7 is nitrogen-containing heteroaryl optionally substituted with one or more aryl substituents. In some embodiments, at least one nitrogen atom of the nitrogen-containing heteroaryl is adjacent (ie, at the 2-position) to the atom directly attached to the acylmethylene group in the structure of Formula (Ia). In some embodiments, the compound of Formula (Ia) is a compound of Formula (Ib), (Ic) or (Id), or a pharmaceutically acceptable salt or prodrug thereof:

in:

R and R are each independently H, alkoxycarbonyl, or _{aralkoxycarbonyl ;}

R ₃ is an alkyl group;

R is H, hydroxy, alkyl or alkoxy _;

X1 is CH or N _;

X2 and _X3 are O, S or NH _;

R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ and R ₁₄ are independently selected from H, halogen, hydroxyl, nitro, N(R ₁₅ ) ₂ , alkyl, substituted alkyl, alkoxy, per Haloalkoxy, aralkyl, substituted aralkyl, aralkoxy, aryl (e.g., phenyl or heteroaryl), aryloxy, acyl (e.g., aroyl), and substituted aryl (e.g., , substituted phenyl or substituted heteroaryl); or wherein R ₉ and R ₁₀ together, or R ₁₁ and R ₁₂ together are alkylene (eg, -CH=CH-CH=CH-); and

wherein each R _is independently selected from H, alkyl, substituted alkyl, aralkyl, substituted aralkyl, aryl (e.g., phenyl or heteroaryl), and substituted aryl (e.g., substituted phenyl or substituted heteroaryl).

In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is N(R ₁₅ ) ₂ , eg, one of R ₁₅ is aryl or substituted aryl. In some embodiments, at least one of R ₉ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , and R ₁₄ is aryl or substituted aryl.

In some embodiments, the compound is of formula (Ib), wherein X ₁ is CH, and wherein R ₁₀ is other than H (eg, wherein R ₁₀ is selected from aryl, substituted aryl, halo, or nitro). In some embodiments, the compound is of formula (Id), wherein X ₃ is S and R ₁₃ is H. In some embodiments, R ₁₄ is N(R ₁₅ ) ₂ .

In some embodiments, the compound is selected from:

3'-dihydro-3'-deoxy-4(R)-(3-pyridin-3-yl)propionylaminospectinomycin (1299);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)acetamidospectinomycin (1329);

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin (1364);

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin (1365);

3'-Dihydro-3'-deoxy-4(R)-(4-fluorophenyl)acetamidospectinomycin (1367);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3-yl)acetamidospectinomycin (1368);

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin (1370);

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin (1399);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin (1400);

3'-dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamidospectinomycin (1411);

3'-Dihydro-3'-deoxy-4(R)-m-tolylacetamidospectinomycin (1412);

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4-yl)acetamidospectinomycin (1413);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin (1443);

3'-dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin (1444);

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin (1445);

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluorophenyl)acetamidospectinomycin (1447);

3'-Dihydro-3'-deoxy-4(R)-(2-methoxyphenyl)acetamidospectinomycin (1448);

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamidospectinomycin (1449);

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl) acetamido spectinomycin (1465);

3'-dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin (1466);

3'-Dihydro-3'-deoxy-4(R)-[3(R)-amino-3-(4-fluorophenyl)]propionylaminospectinomycin (1487);

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin (1489);

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin (1490);

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin (1491);

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-phenyl]propionylaminospectinomycin (1515);

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin (1516);

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin (1517);

3'-dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylaminospectinomycin (1518);

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin (1519);

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin (1520);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2-yl)acetamidospectinomycin (1535);

3'-Dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylaminospectinomycin (1536);

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin (1537);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1538);

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin (1539);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1540);

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)thiazol-4-yl)acetamidospectinomycin (1541);

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin (1542);

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetamidospectinomycin (1543);

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin (1544);

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)acetamidospectinomycin (1351);

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butyrylaminospectinomycin (1369);

3'-Dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino-3-methyl]pentanoylaminospectinomycin (1485);

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino-3-methyl]butyrylaminospectinomycin (1486);

3'-Dihydro-3'-deoxy-4(R)-dodecylamino spectinomycin (1366);

3'-Dihydro-3'-deoxy-4(R)-(3-amino)-propionylaminospectinomycin (1469);

3'-Dihydro-3'-deoxy-4(R)-phenylacetamidospectinomycin (1398);

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylaminospectinomycin (1419);

3'-dihydro-3'-deoxy-4(R)-(3-methyl)butylaminospectinomycin (1420);

3'-Dihydro-3'-deoxy-4(R)-dodecylaminospectinomycin (1421);

3'-Dihydro-3'-deoxy-4(R)-furan-2-yl-methylaminospectinomycin (1422);

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylaminospectinomycin (1423);

3'-Dihydro-3'-deoxy-4(R)-(4-fluoro)benzylaminospectinomycin (1424);

3'-Dihydro-3'-deoxy-4(R)-(4-methyl)benzylaminospectinomycin (1425);

3'-Dihydro-3'-deoxy-4(R)-2-phenylethylaminospectinomycin (1450);

3'-Dihydro-3'-deoxy-4(R)-(4-methoxyphenyl)acetamidospectinomycin (1446);

3'-Dihydro-3'-deoxy-4(R)-[2(S)-aminopropionylaminospectinomycin (1467); and

3'-dihydro-3'-deoxy-4(R)-(2-amino)acetamidospectinomycin (1470);

or a pharmaceutically acceptable salt or prodrug thereof.

The compounds may be administered by any suitable route: orally, topically, intravenously, and the like. In some embodiments, the compound is administered orally or by inhalation.

In some embodiments, an additional therapeutic compound is administered to the subject (eg, simultaneously with, or before or after, a compound of Formula (I)). In some embodiments, the additional therapeutic compound is an antibiotic or a therapeutic compound that reduces pain and/or fever (eg, an anti-inflammatory compound). Antibiotics include, but are not limited to: penicillins such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; penicillins in combination with beta-lactamase inhibitors; cephalosporins , such as cefaclor, cefazolin, cefuroxime, latamoxef, etc.; carbapenems; monobactam antibiotics; aminoglycosides; tetracyclines; macrolides; lincomycins; Colistins; sulfonamides; quinolones; cloramphenical; metronidazole; trimethoprim; vancomycin; streptomycin, etc. In some embodiments, the additional treatment is an anti-tuberculosis compound such as, but not limited to, isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, linezolid, and streptomycin.

In some embodiments, a compound of formula (I) is administered prophylactically, thereby preventing or reducing the occurrence of one of: (a) M. tuberculosis infection in a subject at risk of infection; (b) M. tuberculosis recurrence of infection; and (c) a combination thereof. In some embodiments, a compound of Formula (I) is administered to treat an existing M. tuberculosis infection. In some embodiments, the compound is administered to treat, prevent, or reduce infection associated with other mycobacteria of the tuberculosis complex (e.g., M. africanum, M. canetti, M. microti) or M. bovis happened.

Can be detected by various techniques such as sputum smear, chest x-ray, tuberculin skin test (ie, Mantoux test) and/or the presence of other clinical symptoms (eg, chest pain, hemoptysis, fever, night sweats, loss of appetite, fatigue, etc.) determined to suffer from Mycobacterium tuberculosis or other tuberculosis-related infections. If desired, bacterial RNA, DNA or protein can be isolated from a subject believed to be suffering from TB, analyzed by methods known in the art, and compared to known nucleic acid or amino acid sequences of the bacterial RNA, DNA or protein.

In some embodiments, a compound of formula (I) is administered to treat a multidrug-resistant strain of Mycobacterium tuberculosis (i.e., to two or more previously known anti-tuberculosis drugs such as isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, linezolid and streptomycin-resistant strains).

In some embodiments, the compound of Formula (I), (Ia), (Ib), (Ic) and/or (Id) has a minimum inhibitory concentration (MIC) against Mycobacterium tuberculosis of 25 μg/mL or less. MIC can be determined by methods known in the art, for example, as described in Hurdle et al., J. Antimicrob. Chemother., 62(5), 1037-1045 (2008).

VIII. Pharmaceutical preparations

Formula (I), (Ia), (Ib), (Ic) and (Id) compound, its pharmaceutically acceptable salt, corresponding to formula (I), (Ia), (Ib), (Ic) and (Id) Prodrugs of compounds and their pharmaceutically acceptable salts are referred to herein as "active compounds". Also provided herein are pharmaceutical formulations comprising the active compounds described above. These pharmaceutical formulations comprise the active compound as described herein in a pharmaceutically acceptable carrier. Pharmaceutical formulations can be prepared for oral, intravenous, intramuscular, topical or aerosol administration, as will be discussed in more detail below. Formulations can be prepared in dosage forms such as, but not limited to, tablets, capsules, liquids (solutions or suspensions), suppositories, ointments, creams, or aerosols. Furthermore, the presently disclosed subject matter provides said active compound which has been lyophilized and which can be reconstituted into a pharmaceutically acceptable formulation for administration eg by intravenous or intramuscular injection.

The therapeutically effective amount or dosage of any particular active compound whose use is within the scope of the embodiments described herein will vary somewhat from compound to compound, and from patient to patient, and will depend upon the condition of the patient and the route of delivery. . As a general suggestion, dosages of from about 0.1 to about 50 mg/kg will be therapeutically effective, wherein all weights are based on the weight of the active compound, including when salts are used. Higher levels of toxicity considerations may limit intravenous dosages to lower levels, such as up to about 10 mg/kg, where all weights are based on the weight of the active base, including also when salts are used. Doses of about 10 mg/kg to about 50 mg/kg can be used for oral administration. Generally, dosages of about 0.5 mg/kg to about 5 mg/kg are available for intramuscular injection. For intravenous or oral administration, representative dosages are 1 μmol/kg to 50 μmol/kg, and optionally 22 μmol/kg and 33 μmol/kg of compound.

The duration of treatment is usually once or twice daily for a period of two to three weeks, or until the condition is substantially controlled. Lower doses given less frequently may be used prophylactically to prevent or reduce the occurrence of relapses of infection.

For topical administration, formulations (e.g., solutions, pastes, creams, salves, ointments, etc.) containing from about 0.05 to about 5% by weight of active compound may be prepared and administered one or more times per day for a period of time. time (eg, one week, two weeks, or three weeks) or until the condition is substantially under control.

According to the methods of the invention, the pharmaceutically active compounds described herein can be administered orally as a solid or as a liquid, or can be administered intramuscularly or intravenously as a solution, suspension or emulsion. Alternatively, the compound or salt can also be administered by inhalation, intravenously or intramuscularly as a liposomal suspension. When administered by inhalation, the active compound or salt should be in the form of a plurality of solid particles or liquid droplets having a particle size of from about 0.5 to about 5 microns, and preferably from about 1 to about 2 microns.

Pharmaceutical formulations suitable for intravenous or intramuscular injection are other embodiments provided herein. The pharmaceutical formulation comprises a compound of Formula (I), (Ia), (Ib), (Ic) and/or (Id) described herein, a prodrug described herein, or a druggable thereof in any pharmaceutically acceptable carrier. Use salt. Water is the carrier of choice for water soluble compounds or salts, if solutions are desired. For water soluble compounds or salts, organic vehicles such as glycerol, propylene glycol, polyethylene glycol or mixtures thereof may be suitable. In the latter case, the organic vehicle may contain significant amounts of water. In either case, the solution can then be sterilized by suitable methods known in the art, and typically filtered through a 0.22-micron filter. Following sterilization, the solution may be dispensed into suitable containers, such as depyrogenated glass vials. Said dispensing is preferably accomplished by aseptic methods. A sterile closure can then be placed on the vial, and if desired, the contents of the vial can be lyophilized.

Besides the compounds of the formulas (I), (Ia), (Ib), (Ic) and/or (Id) or their salts or prodrugs, the pharmaceutical preparations may also contain other additives, such as pH regulators. In particular, useful pH adjusting agents include acids such as hydrochloric acid; bases or buffers such as sodium lactate, sodium acetate, sodium phosphate, sodium citrate, sodium borate or sodium gluconate. In addition, the formulations may contain antimicrobial preservatives. Useful antimicrobial preservatives include methylparaben, propylparaben and benzyl alcohol. When the formulation is presented in vials designed for multiple dose use, an antimicrobial preservative is generally employed. The pharmaceutical formulations described herein can be lyophilized using techniques well known in the art.

In yet another embodiment of the subject matter described herein, there is provided an injectable, stable, sterile formulation comprising the formula (I), (Ia), (Ib), (Ic) in unit dosage form in a sealed container ) and/or (Id) compounds or salts thereof. The compound or salt is provided as a lyophilizate which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid formulation suitable for injection into a subject. Such unit dosage forms will generally contain from about 10 mg to about 10 g of the compound salt. When the compound or salt is substantially insoluble in water, a sufficient amount of a physiologically acceptable emulsifier can be used in an amount sufficient to emulsify the compound or salt in the aqueous carrier. One such useful emulsifier is phosphatidylcholine.

Other pharmaceutical formulations, such as aqueous base emulsions, can be prepared from the water-insoluble compounds disclosed herein or salts thereof. In such cases, the formulation will contain a sufficient amount of a pharmaceutically acceptable emulsifier to emulsify the desired amount of the compound or salt thereof. Especially useful emulsifiers include phosphatidylcholine and lecithin.

Other embodiments provided herein include liposomal formulations of the active compounds disclosed herein. Techniques for forming liposomal suspensions are well known in the art. When the compound is a water-soluble salt, the salt can be incorporated into lipid vesicles using conventional liposome technology. In such cases, the active compound will be primarily entrapped in the hydrophilic center or core of the liposome due to its water solubility. The lipid layer used may be of any conventional composition and may contain cholesterol or may be cholesterol-free. When the active compound of interest is insoluble in water, again applying conventional liposome formation techniques, the salt can be primarily entrapped within the hydrophobic lipid bilayer forming the liposome structure. In either case, the liposomes produced can be reduced in size, such as by using standard sonication and homogenization techniques.

Liposomal formulations containing active compounds disclosed herein can be lyophilized to yield a lyophilizate, which can be reconstituted with a pharmaceutically acceptable carrier such as water to reconstitute a liposomal suspension.

Also provided are pharmaceutical formulations suitable for administration as an aerosol topically or by inhalation. These formulations may contain a solution or suspension of the desired compound described herein, or a salt thereof, or a plurality of solid particles of the compound or salt. The desired formulation can be placed in a small chamber and nebulized. Atomization can be accomplished by compressed air or by ultrasonic energy to form a multitude of small liquid droplets or solid particles comprising the compound or salt. The small liquid droplets or solid particles should have a particle size of about 0.5 to about 10 microns, more preferably about 0.5 to about 5 microns. Solid particles may be obtained by processing the solid compound or a salt thereof by any suitable method known in the art, such as by micronization. Most preferably, the solid particles or droplets will be about 1 to about 2 microns in size. In this regard, commercial nebulizers are available for this purpose. The compounds may be administered by an aerosol suspension of inhalable particles in the manner of US Patent No. 5,628,984, the disclosure of which is incorporated herein by reference in its entirety.

When a pharmaceutical formulation suitable for administration as an aerosol is in liquid form, the formulation may contain a water-soluble active compound in an aqueous carrier. A surfactant may be present which lowers the surface tension of the formulation sufficient to result in the formation of small droplets in the desired size range when nebulized.

As indicated, water soluble and water insoluble active compounds are provided. As used herein, the term "water soluble" is intended to define any component that is soluble in water in an amount of about 50 mg/mL or greater. Also, the term "water insoluble" as used herein is intended to define any component having a solubility in water of less than about 20 mg/mL. In some embodiments, water-soluble compounds or salts may be desired, while in other embodiments, water-insoluble compounds or salts may also be desired.

Subjects treated in the presently disclosed subject matter are desirably human subjects in many of its embodiments, but it is understood that the methods described herein are effective with respect to all vertebrate species, and all vertebrate species are intended to Included in the term "subject". The methods described herein are particularly useful for treating and/or preventing infectious diseases in warm-blooded vertebrates. Thus, the method is useful in the treatment of mammals and birds.

More specifically, provided herein is the treatment of mammals, such as humans, and the treatment of mammals due to endangerment (such as the Siberian tiger), economic importance (animals raised on farms for human consumption), and/or social importance (as pets). or kept in zoos) are important to humans, for example, non-human carnivores (such as cats and dogs), swine (pigs, hogs, wild boars) ), ruminants (such as cattle, oxen, sheep, llamas, giraffes, deer, goats, bison and camels) and horses. Also provided herein is the treatment of birds, including those that are endangered, in zoos, or kept as pets (e.g., parrots), and birds, more particularly domesticated birds, i.e. poultry, such as turkeys, chickens , ducks, geese, guinea hens, etc., as they are also economically important to humans. Accordingly, embodiments of the methods described herein include the treatment of livestock including, but not limited to, domesticated swine (pigs, hogs), ruminants, horses, poultry, and the like.

Example

The following examples are included by way of illustration of the subject matter disclosed herein. Those skilled in the art, given the present disclosure and their ordinary level of skill in the art, will recognize that the following examples are intended to be illustrative only and that many changes may be made without departing from the scope of the presently disclosed subject matter. Grooming and modification.

Example 1

Synthesis of Spectinomycin Analogs

General Methods: The 3'-deoxy3'-acylamino and 3'-deoxy3'(R)-alkylamino spectinomycins disclosed in the present invention were synthesized according to methods similar to those previously described. See Woitun et al. J. Antibiot (Tokyo), 34(1), 22-27 (1981); and Maier et al ., J. Antibiot (Tokyo), 34(1), 16-21 (1981). 1,3-Dibenzyloxycarbonyl-3'(R)-aminospectinomycin was synthesized from spectinomycin dihydrochloride pentahydrate as shown in Figure 1 in two steps. First, the methyl secondary amine in ring A was protected as benzyl carbamate with carboxybenzyl (CBz) using benzyl chloroformate and NaHCO ₃ in water. The protected intermediate was then reductively aminated with ammonium nitrate and sodium cyanoborohydride in methanol to afford the 3'-deoxy-3'-amino derivative.

The amines were then used in the synthesis of the target 3'-acylaminospectinomycin derivatives by coupling them to various acids by using HBTU in dichloromethane. See Figure 1. The CBz group was then removed by catalytic hydrogenation using palladium on carbon (Pd/C) for 2 h to afford the target amide. For aryl side chains that are sensitive to the hydrogenolysis conditions used to remove the CBz group, exposure to HBr 48% in water for 2 hours was applied as an alternative method to provide the deprotected final product.

3′-Deoxy-3′-alkylamino spectinomycin derivatives were obtained through two routes: for simple alkyl substituents, by TFA and di Reduction of the corresponding di-CBz protected amide (see Figure ₁ ) using NaBH in the presence of alkanes; or direct reductive alkylation of 1,3-dibenzyloxycarbonyl ₃ ′(R )-aminospectinomycin. See Figure 2. Both methods followed CBz deprotection using Pd/C-catalyzed hydrogenation for two hours to provide the target 3'-deoxy3'(R)-alkylaminospectinomycin.

General procedure for the synthesis of 3'-deoxy3'-acylaminospectinomycins: To a stirred solution of the acid of choice (3 mmol) in _{CH2Cl2 (} 10 mL) and DIPEA (6 mmol) was added HBTU (3 mmol) and dissolved in The mixture was stirred at room temperature for 1 h. Then 6,8-dibenzyloxycarbonyl 4(R)-aminospectinomycin (1 mmol) was added and stirred overnight at room temperature. The reaction solution was diluted with excess _CH2Cl2 and washed with water, dried _{( Na2SO4 )} and concentrated. The residue was purified by column chromatography using a petroleum/ethyl acetate gradient elution system to provide the corresponding protected amide. Deprotection of the amino protecting group was achieved by dissolving the protected amide in 1.25 M HCl in MeOH and EtOH (1 :1 ) containing 10% Pd—C (50% by mass). The mixture was hydrogenated under 30 Psi/ _H2 at room temperature for 2 hours, filtered and concentrated. The obtained solid was triturated in cold diethyl ether, filtered and washed with excess diethyl ether, and dried in vacuo to obtain the target 3'-deoxy3'-acylamino spectinomycin.

General method for the synthesis of 3'-deoxy3'-acylaminospectinomycins, method 2: To a stirred solution of the acid of choice ( ₃ mmol) in _CH2Cl2 (10 mL) and DIPEA (6 mmol) was added HBTU (3 mmol) , and the mixture was stirred at room temperature for 1 h. Then 6,8-dibenzyloxycarbonyl 4(R)-aminospectinomycin (1 mmol) was added and stirred overnight at room temperature. The reaction solution was diluted with excess _CH2Cl2 and washed with water, dried _{( Na2SO4 )} and concentrated. The residue was purified by column chromatography using a petroleum/ethyl acetate gradient elution system to provide the corresponding protected amide. Deprotection of the amino protecting group was achieved by dissolving the protected amide in 48% HBr(aq). The mixture was stirred at room temperature for 2 hours, then the solution was dried in vacuo. The residue was dissolved by methanol, diethyl ether was added to the solution, and the solid was filtered and washed with diethyl ether to obtain the target 3'-deoxy3'-acylamino spectinomycin.

Analytical data for individual 3'-deoxy3'-acylaminospectinomycin compounds:

3'-Dihydro-3'-deoxy-4(R)-(3-pyridin-3yl)propionylamino spectinomycin dihydrochloride (1299): ¹ HNMR (D ₂ O, 500MHz): δ8. 74-8.65(2H, m), 8.55-8.50(1H, m), 8.03(1H, dd, J1=8.0, J2=5.5Hz), 4.89(1H, s), 4.77-4.75(2H, m), 4.36(1H, t, J=10.5Hz), 4.109(1H, t, J=3.0Hz), 4.02-3.92(2H, m), 3.92-3.82(1H, m), 3.51(1H, dd, J1= 11.5Hz, J2=2.5Hz), 3.26(1H, dd, J1=10.0, J2=2.5Hz), 2.83(6H, brs), 2.81-2.76(2H, m), 1.90-1.80(1H, m), 1.60-1.52 (1H, m), 1.22 (3H, d, J=6.0Hz); MS (ESI): m/z 467 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2yl)acetamidospectinomycin dihydrochloride (1329): ¹ HNMR (D ₂ O, 500MHz): δ8.45 (1H , d, J = 6.0Hz), 8.57 (1H, t, J = 7.5Hz), 8.00 (1H, t, J = 7.0Hz), 7.97 (1H, d, J = 8.0Hz), 5.01 (1H, s ), 4.77-4.75(2H, m), 4.40(1H, t, J=10.5Hz), 4.23(1H, t, J=6.5Hz), 4.21(1H, m), 4.13-4.02(1H, m) , 4.04 (1H, t, J = 10.0Hz), 3.97 (1H, t, J = 10.0Hz), 3.52 (1H, dd, J1 = 11.5, J2 = 2.5Hz), 3.27 (1H, dd, J1 = 10.5 , J2=2.5Hz), 2.83(3H, s), 2.82(3H, s), 1.96-1.87(1H, m), 1.81-1.74(1H, m), 1.27(3H, d, J=6.0Hz) ; ¹³ CNMR (D ₂ O, 75MHz): δ146.7141.0, 138.2, 128.0, 125.492.6, 89.7, 69.53, 67.6, 65.6, 65.1, 61.1, 59.6, 58.0, 51.8, 33.7, 30.3, 30.2, 19.4; MS (ESI): m/z453(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(tert-butylamino)-acetamidospectinomycin dihydrochloride (1351): ¹ HNMR (D ₂ O, 500MHz): δ4.96( 1H, s), 4.78-4.76 (2H, m), 4.40 (1H, t, J=10.0Hz), 4.25-4.19 (1H, m), 4.09-4.01 (2H, m), 4.01-3.94 (1H, m), 3.92 (1H, d, J=8.0Hz), 3.54 (1H, dd, J1=10.5, J2=2.5Hz), 3.27 (1H, dd, J1=10.5, J2=2.5Hz), 2.85 (3H , s), 2.84(3H, s), 1.97-1.88(1H, m), 1.82-1.74(1H, m), 1.39(9H, s), 1.27(3H, d, J=6.0Hz); ¹³ CNMR (D ₂ O, 75MHz): δ92.6, 89.7, 69.6, 67.6, 65.6, 65.2, 59.7, 58.1, 57.4, 51.6, 42.2, 33.7, 30.4, 30.3, 24.4, 19.4; MS(ESI): m/z447 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-4-fluorobenzamidospectinomycin dihydrochloride (1364): ¹ HNMR (D ₂ O, 500MHz): δ7.82-7.76( 2H, m), 7.32-7.24 (2H, m), 5.13 (1H, s), 4.47 (1H, t, J=10.5Hz), 4.39 (1H, t, J=3.0Hz), 4.20-4.12 (1H , m), 4.08(1H, t, J=10.0Hz), 4.01(1H, t, J=10.0Hz), 3.58(1H, dd, J1=11.0, J2=2.5Hz), 3.31(1H, dd, J1=10.5, J2=2.5Hz), 2.88(3H, s), 2.87(3H, s), 2.05-1.96(1H, m), 1.96-1.88(1H, m), 1.30(3H, d, J= 6.0Hz); ¹³ CNMR (D ₂ O, 75MHz): δ129.6(d, J=9.4Hz), 115.3(d, J=22.1Hz), 92.7, 90.1, 69.6, 67.7, 65.6, 65.2, 61.2, 59.7, 58.1, 52.2, 34.0, 30.4, 30.3, 19.5; MS (ESI): m/z 456 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-furan-2-carboxamidospectinomycin dihydrochloride (1365): ¹ HNMR (D ₂ O, 500MHz): δ7.70 (1H, d, J = 1.0Hz), 7.23 (1H, d, J = 3.5Hz), 6.65 (1H, dd, J1 = 3.5, J2 = 1.5Hz), 5.14 (1H, s), 4.43 (1H, t, J =10.5Hz), 4.38-4.33(1H, m), 4.22-4.13(1H, m), 4.05(1H, t, J=10.0Hz), 3.98(1H, t, J=10Hz), 3.55(1H, dd, J1=11.0, J2=2.5Hz), 3.28(1H, dd, J1=10.5, J2=2.5Hz), 2.85(3H,s), 2.84(3H,s), 2.02-1.93(1H,m) , 1.90-1.81 (1H, m), 1.27 (3H, d, J=6.0Hz); MS (ESI): m/z 427 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-dodecanoylaminospectinomycin dihydrochloride (1366): ¹ HNMR (D ₂ O, 500MHz): δ4.98 (1H, s) , 4.40 (1H, dd, J1 = 10.5, J2 = 10.0Hz), 4.16 (1H, t, J = 3.0Hz), 4.09-4.02 (1H, m), 4.02 (1H, t, J = 10.0Hz), 3.97(1H, t, J=10.0Hz), 3.52(1H, dd, J1=11.0, J2=3.0Hz), 3.26(1H, dd, J1=10.5, J2=3.0Hz), 2.84(3H, s) , 2.83(3H, s), 2.32(2H, t, J=7.0Hz), 1.94-1.85(1H, m), 1.75-1.68(1H, m), 1.66-1.55(2H, m), 1.32-1.24 (19H, m), 0.86 (3H, t, J=7.0Hz); MS (ESI): m/z 516 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(4-fluoro-phenyl)-acetylaminospectinomycin dihydrochloride (1367): ¹ HNMR (D ₂ O, 500MHz): δ7. 82-7.74(2H, m), 7.30-7.20(2H, m), 5.11(1H, s), 4.45(1H, t, J=11.0Hz), 4.37(1H, t, J=3.0Hz), 4.17 -4.10(1H, m), 4.06(1H, t, J=10.0Hz), 3.99(1H, t, J=10.0Hz), 3.52(1H, dd, J1=11.0, J2=3.0Hz), 3.28( 1H, dd, J1=10.0, J2=2.5Hz), 2.86(3H, s), 2.84(3H, s), 2.04-1.94(2H, m), 1.94-1.86(1H, m), 1.28(3H, d, J=6.0Hz); ¹³ CNMR (D ₂ O, 75MHz): δ129.5(d, J=9.4Hz), 115.3(d, J=22.2Hz), 92.7, 90.0, 69.6, 67.7, 65.6, 65.2, 61.1, 59.7, 58.1, 52.2, 33.9, 30.4, 30.3, 19.5; MS (ESI): m/z 470 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyridin-3yl)acetamidospectinomycin dihydrochloride (1368): ¹ HNMR (D ₂ O, 500MHz): δ8.80-8.70 (2H, m), 8.56-8.50 (1H, m), 8.07 (1H, dd, J1 = 7.5, J2 = 6.0Hz), 5.02 (1H, s), 4.40 (1H, t, J = 10.5Hz), 4.19 (1H, t, J = 3.5Hz), 4.14-3.94 (6H, m), 3.52 (1H, dd, J1 = 11.0, J2 = 2.5Hz), 3.27 (1H, dd, J1 = 10.0, J2 = 2.5 Hz), 2.83(3H, s), 2.82(3H, s), 1.96-1.86(1H, m), 1.80-1.70(1H, m), 1.26(3H, d, J=6.0Hz); MS(ESI ): m/z453(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)-butyrylaminospectinomycin dihydrochloride (1369): ¹ HNMR (D ₂ O, 500MHz): δ5.00 (1H, s), 4.40(1H, t, J=10.5Hz), 4.20-4.15(1H, m), 4.10-3.92(3H, m), 3.52(1H, dd, J1=11.0, J2=2.5Hz ), 3.26 (1H, dd, J1 = 10.0, J2 = 2.5Hz), 2.84 (3H, s), 2.83 (3H, s), 2.19 (2H, d, J = 8.0Hz), 2.04-1.96 (1H, m), 1.94-1.86 (1H, m), 1.76-1.68 (1H, m), 1.25 (3H, d, J=6.0Hz), 0.97-0.88 (6H, m); ¹³ CNMR (D ₂ O, 75MHz ): δ92.6, 90.0, 69.6, 67.6, 65.6, 65.1, 61.1, 59.6, 58.1, 51.3, 44.3, 34.00, 30.3, 30.2, 25.8, 21.4, 21.0, 19.4; MS (ESI): m/z418 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-pyridine-2-carboxamidospectinomycin dihydrochloride (1370): ¹ HNMR (D ₂ O, 500MHz): δ8.66 (1H, d, J = 4.5Hz), 8.10 (2H, d, J = 3.5Hz), 7.74-7.65 (1H, m), 5.16 (1H, s), 4.45 (1H, t, J = 11.0Hz), 4.39 ( 1H, t, J=3.5Hz), 4.25-4.15(1H, m), 4.07(1H, t, J=10.0Hz), 4.00(1H, t, J=10.5Hz), 3.56(1H, dd, J1 =11.0, J2=2.5Hz), 3.28(1H, dd, J1=10.0, J2=2.5Hz), 2.86(3H, s), 2.84(3H, s), 2.02-1.98(1H, m), 1.97- 1.91 (1H, m), 1.28 (3H, d, J=6.0Hz); ¹³ CNMR (D ₂ O, 75MHz): δ148.1, 138.8, 127.3, 122.5, 92.5, 69.63, 67.6, 65.6, 65.3, 61.1 , 59.7, 58.1, 33.7, 30.4, 30.2, 19.4; MS (ESI): m/z 439 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-phenylacetamidospectinomycin dihydrochloride (1398): ¹ HNMR (D ₂ O, 500MHz): δ7.41 (2H, t, J =7.3Hz), 7.31-7.36(3H, m), 5.45(1H, s), 4.39(1H, t, J=10.7Hz), 4.15(1H, brs), 3.94-4.05(3H, m), 3.64 -3.67(2H, m), 3.50-3.58(3H, m), 2.81(6H, s), 1.85-1.91(1H, m), 1.71(1H, d, J=14.6Hz), 1.24(3H, d , J=5.8Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ135.4, 128.7, 126.4, 93.5, 90.6, 70.4, 66.2, 61.7, 58.5, 52.3, 41.9, 37.5, 34.6, 30.0, 19.7; MS (ESI): m/z452(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-p-tolylacetamidospectinomycin dihydrochloride (1399): ¹ HNMR (D ₂ O, 500MHz): δ7.20 (4H, q, J=7.8Hz), 4.96(1H, s), 4.36(1H, t, J=10.5Hz), 4.12(1H, brs), 3.92-4.03(2H, m), 3.60(2H, s), 3.49( 2H, d, J = 10.7Hz), 3.24 (2H, d, J = 10.2Hz), 2.80 (6H, s), 2.30 (3H, s), 1.85 (1H, t, J = 11.4Hz), 1.68 ( 1H, d, J=14.1Hz), 1.21 (3H, d, J=5.86Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ175.7, 137.7, 133.8, 130.3, 130.29, 95.1, 92.2, 72.0, 68.5, 63.2, 60.0, 43.0, 39.0, 36.1, 31.9; MS (ESI): m/z 466 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy-phenyl)acetamidospectinomycin dihydrochloride (1400): ¹ HNMR (D ₂ O, 500MHz): δ7 .33(1H, t, J=8.0Hz), 6.93(3H, t, J=9.5Hz), 4.97(1H, s), 4.73(2H, s), 4.36(1H, t, J=10.5Hz) , 4.13(1H, s), 3.92-4.04(3H, m), 3.81(3H, s), 3.63(3H, s), 3.48-3.57(1H, m), 3.24(1H, d, J=10.0Hz ), 2.80 (6H, s), 1.86 (1H, t, J=11.4Hz), 1.69 (1H, d, J=14.1Hz), 1.22 (3H, d, J=6.3Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ175.3, 161.4, 138.3, 130.6, 122.5, 115.8, 113.5, 95.1, 92.2, 71.9, 67.8, 63.2, 55.7, 43.5, 39.0; MS (ESI): m/z482 (M ⁺ +H ).

3'-Dihydro-3'-deoxy-4(R)-[3,4-(methylenedioxy)phenyl]acetamido spectinomycin dihydrochloride (1411): ¹ HNMR (D ₂ O , 500MHz): δ6.76-6.86(3H, m), 5.95(2H, s), 4.96(1H, s), 4.36(1H, t, J=10.5Hz), 4.12(1H, s), 3.92- 4.02(4H, m), 3.48-3.56(3H, m), 3.23(1H, d, J=9.7Hz), 2.79(6H, s), 1.86(1H, t, J=11.4Hz), 1.69(1H , d, J=14.4Hz), 1.22 (3H, d, J=5.8Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ130.5, 123.4, 110.5, 102.4, 95.1, 72.0, 67.2, 63.2, 60.0 , 43.0, 39.0, 31.8, 21.3; MS (ESI): m/z 496 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-m-tolylacetamidospectinomycin dihydrochloride (1412): ¹ HNMR (D ₂ O, 500MHz): δ7.28 (1H, t, J=7.5Hz), 7.09-7.18(3H, m), 4.97(1H, s), 4.37(1H, t, J=10.7Hz), 4.12(1H, s), 3.92-4.02(2H, m), 3.61(2H, s), 3.49(2H, d, J=10.9Hz), 3.24(2H, d, J=10.0Hz), 2.79(6H, s), 2.31(3H, s), 1.85(1H, t , J=11.4Hz), 1.69 (1H, d, J=13.9Hz), 1.22 (3H, d, J=5.8Hz); MS (ESI): m/z 466 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyridin-4yl)acetamidospectinomycin dihydrochloride (1413): ¹ HNMR (D ₂ O, 500MHz): δ8.71(2H , t, J = 6.3Hz), 7.97 (1H, d, J = 5.8Hz), 7.89 (1H, d, J = 6.1Hz), 4.99 (1H, s), 4.36 (1H, t, J = 10.0Hz ), 4.17(1H, d, J=10.9Hz), 3.92-4.18(3H, m), 3.62(1H, q, J=7.0Hz), 3.50(1H, d, J=10.9Hz), 3.41(1H , d, J=11.9Hz), 3.24(1H, d, J=9.7Hz), 2.96-3.02(1H, m), 2.81(6H, s), 1.86-1.89(1H, m), 1.64-1.74( 1H, m), 1.23 (3H, d, J=5.3Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ139.4, 136.8, 130.9, 129.5, 128.7, 127.2, 95.1, 92.2, 72.0, 68.6, 67.8 , 63.2, 53.9, 49.7, 43.4, 39.0; MS (ESI): m/z 453 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyrimidin-2yl)acetamidospectinomycin dihydrochloride (1439): ¹ HNMR (D ₂ O, 500MHz): δ8.27(1H , d, J = 7.5Hz), 7.99 (1H, d, J = 6.35Hz), 7.00 (1H, t, J = 7.0Hz), 5.06 (1H, s), 4.35-4.43 (2H, m), 4.00 -4.08(2H, m), 3.89-3.98(1H, m), 3.54(2H, dd, J=10.9Hz), 3.43-3.46(1H, m), 3.35-3.40(1H, m), 3.25(1H , t, J=6.3Hz), 2.82 (6H, s), 2.14-2.15 (2H, m), 1.25 (3H, d, J=5.6Hz); MS (ESI): m/z454 (M ⁺ +H ).

3'-Dihydro-3'-deoxy-4(R)-(4-methoxy-phenyl)acetamidospectinomycin dihydrochloride (1446): ¹ HNMR (D ₂ O, 500MHz): δ7 .25(2H, d, J=8.5Hz), 6.98(2H, d, J=8.5Hz), 4.97(1H, s), 4.38(1H, t, J=10.1Hz), 4.13(1H, s) , 3.93-4.04(3H, m), 3.82(3H, s), 3.49-3.64(3H, m), 3.34(1H, s), 3.25(1H, d, J=7.57Hz), 2.80(6H, s ), 1.86 (1H, t, J=11.4Hz), 1.70 (1H, d, J=14.8Hz), 1.23 (3H, d, J=6.1Hz); MS (ESI): m/z 482 (M ⁺⁺ H).

3'-Dihydro-3'-deoxy-4(R)-(2,3-difluoro-phenyl)acetamidospectinomycin dihydrochloride (1447): ¹ HNMR (D ₂ O, 500MHz): δ7.23(1H, q, J=8.8Hz), 7.14(1H, q, J=8.0Hz), 7.09(1H, t, J=7.5Hz), 5.01(1H, s), 4.39(1H, t , J=10.5Hz), 4.17(1H, s), 3.94-4.10(3H, m), 3.77(2H, s), 3.50-3.58(2H, m), 3.34(1H, s), 3.25(1H, dd, J=2.6, 10.2Hz), 2.82(6H, s), 1.86-1.89(1H, m), 1.75(1H, d, J=14.6Hz), 1.25(3H, d, J=6.1Hz); MS(ESI): m/z488(M ⁺⁺ H).

3'-Dihydro-3'-deoxy-4(R)-(2-methoxy-phenyl)acetamidospectinomycin dihydrochloride (1448): ¹ HNMR (D ₂ O, 500MHz): δ7 .36 (1H, t, J = 7.32Hz), 7.24 (1H, d, J = 7.3Hz), 7.05 (1H, d, J = 8.3Hz), 7.00 (1H, t, J = 7.5Hz), 4.96 (1H, s), 4.37(1H, t, J=10.7Hz), 4.12(1H, s), 3.93-4.06(3H, m), 3.82(3H, s), 3.50-3.63(3H, m), 3.33(2H, s), 3.25(1H, dd, J=2.4, 10.5Hz), 2.80(6H, s), 1.84-1.90(1H, m), 1.72(1H, d, J=14.4Hz), 1.25 (3H, d, J=6.1Hz); MS (ESI): m/z 482 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(thiazol-4-yl)acetamidospectinomycin trihydrobromide (1443): ¹ HNMR (D ₂ O, 500MHz): δ9.00 (1H, s), 7.45(1H, s), 4.99(1H, s), 4.40(1H, t, J=10.0Hz), 4.17(1H, m), 4.08-3.94(3H, m), 3.90( 2H, s), 3.64 (1H, q, J = 7.0Hz), 3.51 (1H, dd, J ₁ = 11.0Hz, J ₂ = 2.5Hz), 3.25 (1H, dd, J ₁ = 10.0Hz, J ₂ =2.5Hz), 2.82(3H, s), 2.81(3H, s), 1.88(1H, m), 1.78(1H, m), 1.25(3H, d, J=6.0Hz).MS(ESI): m/z459(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-aminothiazol-4-yl)acetamidospectinomycin trihydrobromide (1444): ¹ HNMR (D ₂ O, 500MHz): δ6.61(1H, s), 4.98(1H, s), 4.39(1H, t, J=10.0Hz), 4.18(1H, t, J=3.0Hz), 4.05-3.94(3H, m), 3.77 (1H, m), 3.71 (1H, d, J = 6.5Hz), 3.63 (1H, q, J = 7.0Hz), 3.51 (1H, dd, J1 _{= 11.0Hz} , J2 = 2.5Hz), 3.22 (1H, dd, J ₁ =10.5Hz, J ₂ =2.5Hz), 2.83(3H,s), 2.82(3H,s), 1.93-1.87(1H,m), 1.77-1.74(1H,m), 1.25 (3H, d, J=6.0Hz). MS (ESI): m/z 474 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-fluoropyridin-2-yl)acetamidospectinomycin trihydrobromide (1445): ¹ HNMR (D ₂ O, 500MHz): δ8.46(1H, br), 7.76(1H, br), 7.53(1H, br), 5.00(1H, s), 4.40(1H, t, J=10.5Hz), 4.18(1H, t, J= 3.0Hz), 4.08-3.91 (5H, m), 3.64 (1H, q, J=7.0Hz), 3.51 (1H, dd, J ₁ =11.0Hz, J ₂ =2.5Hz), 3.25 (1H, dd, J ₁ =10.0Hz, J ₂ =2.5Hz), 2.82(3H,s), 2.81(3H,s), 1.92-1.83(1H,m), 1.78-1.75(1H,m), 1.25(3H,d , J=6.5Hz). MS (ESI): m/z 471 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyridazin-3-yl)acetamido spectinomycin hydrobromide (1449): ¹ HNMR (D ₂ O, 500MHz): δ9.18 (1H, br), 7.90(2H, m), 5.01(1H, s), 4.39(1H, t, J=10.5Hz), 4.19(1H, m), 4.11(2H, m), 4.03(1H, t, J = 10.0Hz), 3.96 (1H, t, J = 10.0Hz), 3.77 (1H, t, J = 10.0Hz), 3.51 (1H, dd, J1 ₌ 11.3Hz, J2 = 2.5Hz ₎ , 3.41 (1H, t, J = 9.5Hz), 3.25 (1H, dd, J1 ₌ 10.3Hz, J2 = 3.0Hz), 3.22 (1H, dd, J1 = _10.75Hz , J2 = 2.5Hz), 2.82 (3H, s), 2.81 (3H, s), 1.92-1.86 (1H, m), 1.78-1.75 (1H, m), 1.25 (3H, d, J=5.5Hz). MS (ESI): m/ z454(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyrazin-2-yl)carboxamidospectinomycin tetrahydrobromide (1453): ¹ HNMR (D ₂ O, 400MHz): δ9 .20 (1H, d, J = 1.4Hz), 8.84 (1H, d, J = 2.5Hz), 8.75 (1H, dd, J = 2.5Hz, 1.5Hz), 5.16 (1H, s), 4.90 (1H , s), 4.51-4.36 (2H, m), 4.21 (1H, d, J=5.8Hz), 4.08 (1H, t, J=9.8Hz), 3.99 (1H, t, J=10.1Hz), 3.60 -3.53(1H, m), 3.29(1H, dd, J=10.2Hz, 2.8Hz), 2.85(6H, d, J=8.5Hz), 2.04-1.91(2H, m), 1.28(3H, d, J=6.1Hz). MS(ESI): m/z 440(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(benzo Azol-2-yl)acetamidospectinomycin trihydrobromide (1465): ¹ H NMR (D ₂ O, 400MHz): δ7.82-7.69 (1H, m), 7.67 (1H, dd, J=6.7 Hz, 2.3Hz), 7.46(2H, pd, J=7.5Hz, 3.8Hz), 5.02(1H, s), 4.48-4.35(1H, m), 4.22(1H, t, J=3.0Hz), 4.15 -4.05(2H, m), 4.05-3.93(2H, m), 3.53(1H, dd, J=11.1Hz, 2.6Hz), 3.26(1H, dt, J=15.6Hz, 7.9Hz), 2.83(8H , s), 1.96-1.85 (1H, m), 1.82 (1H, d, J=14.4Hz), 1.27 (3H, d, J=6.1Hz). MS (ESI): m/z 493 (M ⁺ +H ).

3'-Dihydro-3'-deoxy-4(R)-(1H-imidazol-4-yl)acetamidospectinomycin tetrahydrobromide (1466): ¹ HNMR (D ₂ O, 400MHz): δ8 .67 (1H, d, J = 1.4Hz), 7.36 (1H, d, J = 1.3Hz), 5.00 (1H, s), 4.90 (1H, s), 4.40 (1H, dd, J = 10.9Hz, 10.0Hz), 4.19(1H, t, J=3.0Hz), 4.13-3.90(3H, m), 3.88(2H, d, J=3.5Hz), 3.54(1H, dd, J=7.9Hz, 3.3Hz ), 3.27 (1H, dd, J = 10.2Hz, 2.7Hz), 2.83 (6H, s), 1.96-1.85 (1H, m), 1.76 (1H, dd, J = 12.3Hz, 2.3Hz), 1.26 ( 3H, d, J=6.1Hz). MS (ESI): m/z 442 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino]propionylamino spectinomycin trihydrochloride (1467): ¹ HNMR (D ₂ O, 400MHz): δ4. 23(2H, t, J=8.0Hz), 3.94-4.06(2H, m), 3.76-3.93(3H, m), 3.38(1H, d, J=10.3Hz), 3.22(1H, s), 3.11 (1H, d, J = 8.8Hz), 2.67 (6H, d, J = 2.6Hz), 1.70-1.80 (1H, m), 1.59 (1H, d, J = 14.1Hz), 1.36 (3H, d, J=7.0Hz), 1.09 (3H, d, J=6.0Hz); MS (ESI): m/z 405 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(3-amino)propionylamino spectinomycin trihydrochloride (1469): ¹ HNMR (D ₂ O, 400MHz): δ4.31 (2H , t, J=8Hz), 4.10(1H, s), 3.83-4.02(3H, m), 3.44(2H, d, J=8Hz), 3.14-3.24(3H, m), 2.75(6H, d, J=5.8Hz), 2.67(2H, t, J=8.0Hz), 1.76-1.86(1H, m), 1.66(1H, d, J=16Hz), 1.16(3H, d, J=4.0Hz); MS(ESI): m/z 405(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-amino)acetamidospectinomycin trihydrochloride (1470): ¹ HNMR (D ₂ O, 400MHz): δ4.26 (2H, t, J=8.0Hz), 4.08(1H, s), 3.71-3.96(4H, m), 3.36-3.47(1H, m), 3.24(2H, s), 3.13(1H, d, J=8.0Hz ), 2.70 (6H, d, J = 5.8Hz), 1.73-1.83 (1H, m), 1.64 (1H, d, J = 12Hz), 1.12 (3H, d, J = 4.0Hz); MS (ESI) : m/z391(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[(2S,3S)-2-amino, 3-methyl]pentanoylamino spectinomycin trihydrochloride (1485): ¹ HNMR (D ₂ O, 400MHz): δ4.39(2H, t, J=8Hz), 4.20(1H, s), 3.88-4.06(4H, m), 3.50(1H, d, J=12Hz), 3.23(1H, d, J=12Hz), 2.79(6H, d, J=8Hz), 1.85-2.01(2H, m), 1.70(1H, d, J=16Hz), 1.40-1.53(1H, m), 1.22(3H , d, J=4.0Hz), 1.10-1.19 (1H, m), 0.98 (3H, d, J=8Hz), 0.90 (3H, t, J=8Hz); MS (ESI): m/z447 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino, 3-methyl]butyrylaminospectinomycin trihydrochloride (1486): ¹ HNMR (D ₂ O, 400MHz): δ4.30(2H, t, J=8.0Hz), 4.14(1H, s), 3.80-4.00(4H, m), 3.44(1H, d, J=8.0Hz), 3.27(1H, s ), 3.17(1H, d, J=8.0Hz), 2.74(6H, d, J=4.0Hz), 2.08-2.20(1H, m), 1.79-1.90(1H, m), 1.64(1H, d, J=16.0Hz), 1.15(3H, d, J=6.0Hz), 0.92(6H, t, J=8.0Hz); MS(ESI): m/z 433(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[3(R)-amino, 3-(4-fluorophenyl)]propionylamino spectinomycin trihydrochloride (1487): ¹ HNMR (D ₂ O, 400MHz): δ7.42 (2H, d, J = 4.0Hz), 7.19 (2H, d, J = 4.0Hz), 4.26 (2H, t, J = 8.0Hz), 3.97 (1H, s), 3.90(2H, t, J=8.0Hz), 3.68-3.79(2H, m), 3.44(2H, d, J=12.0Hz), 3.19(2H, d, J=8.0Hz), 3.03( 2H, d, J-8.0Hz), 2.73 (6H, s), 1.74 (1H, t, J=12.0Hz), 1.47 (1H, d, J=12.0Hz), 1.13 (3H, d, J=4.0 Hz); MS(ESI): m/z499(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(thiazol-2-yl)acetamidospectinomycin tetrahydrobromide (1489): ¹ HNMR (D ₂ O, 400MHz): δ7.88 (1H, d, J = 3.6Hz), 7.74-7.65 (1H, m), 4.98 (1H, s), 4.74 (1H, t, J = 2.7Hz), 4.37 (1H, dd, J = 11.0Hz, 9.9Hz), 4.17(1H, t, J=3.1Hz), 4.10-3.89(4H, m), 3.52-3.47(1H, m), 3.24(1H, dd, J=10.1Hz, 2.9Hz), 2.81 (7H, s), 1.94-1.82 (1H, m), 1.79-1.71 (1H, m), 1.23 (3H, d, J=6.1Hz). MS (ESI): m/z 459 (M ⁺ +H) .

3'-Dihydro-3'-deoxy-4(R)-(5-nitropyridin-2-yl)acetamidospectinomycin trihydrobromide (1490): ¹ HNMR (D ₂ O, 400MHz) : δ9.34(1H, s), 8.64(1H, d, J=8.6Hz), 7.66(1H, d, J=8.6Hz), 5.02(1H, s), 4.76(1H, t, J=2.8 Hz), 4.46-4.31(1H, m), 4.20(1H, t, J=3.1Hz), 4.15-3.92(3H, m), 3.81-3.55(1H, m), 3.53(1H, dd, J= 11.2Hz, 2.7Hz), 3.33-3.22(1H, m), 2.83(6H, d, J=1.9Hz), 1.99-1.83(1H, m), 1.78(1H, d, J=14.5Hz), 1.26 (3H, d, J=6.1Hz). MS (ESI): m/z 498 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(benzothiazol-2-yl)acetamidospectinomycin trihydrobromide (1491): ¹ HNMR (D ₂ O, 400MHz): δ8 .03(2H, dd, J=17.1Hz, 8.1Hz), 7.65-7.57(1H, m), 7.57-7.48(1H, m), 5.03(1H, s), 4.77(1H, t, J=2.7 Hz), 4.44-4.37(1H, m), 4.23(1H, t, J=3.1Hz), 4.16-3.89(4H, m), 3.53(1H, dd, J=8.3Hz, 2.8Hz), 3.27( 1H, dd, J=10.1Hz, 2.8Hz), 2.83(6H, d, J=5.2Hz), 2.23(1H, s), 1.97-1.85(1H, m), 1.80(1H, dd, J=12.2 Hz, 2.3Hz), 1.26 (3H, d, J=6.1Hz). MS (ESI): m/z 509 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-fluorophen-1-yl)formylaminospectinomycin dihydrochloride (1492): ¹ HNMR (D ₂ O, 400MHz): δ7.62(2H, m), 7.38-7.24(2H, m), 5.05(1H, s), 4.77(1H, s), 4.47(1H, dd, J=10.9Hz, 10.0Hz), 4.40(1H , t, J=2.9Hz), 4.18-3.95(3H, m), 3.58(1H, m), 3.30(1H, dd, J=10.2Hz, 2.8Hz), 2.87(6H, d, J=7.8Hz ), 2.06-1.87 (2H, m), 1.30 (3H, d, J=6.1Hz). MS (ESI): m/z 456 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2(S)-4-amino-2-hydroxy)butyramide spectinomycin trihydrochloride (1493): ¹ HNMR (D ₂ O , 400MHz): δ5.03(1H, s), 4.76(1H, s), 4.45-4.34(2H, m), 4.19(1H, t, J=3.1Hz), 4.14-3.92(3H, m), 3.56-3.50(1H, m), 3.27(1H, dd, J=10.2Hz, 2.8Hz), 3.16(2H, t, J=6.7Hz), 2.84(6H, d, J=3.4Hz), 2.16( 1H, m), 2.07-1.89 (2H, m), 1.78 (1H, dd, J=12.4Hz, 2.2Hz), 1.26 (3H, d, J=6.1Hz). MS (ESI): m/z 435 ( M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[2(R)-amino]propionylamino spectinomycin trihydrochloride (1501): ¹ HNMR (D ₂ O, 400MHz): δ4. 34(2H, t, J=8.0Hz), 4.15(1H, s), 4.08(1H, d, J=8.0Hz), 3.88-4.04(2H, m), 3.46-3.52(1H, m), 3.31 (2H, s), 3.19-3.25 (1H, m), 2.79 (6H, d, J = 4.0Hz), 1.82-1.93 (1H, m), 1.71 (1H, d, J = 16.0Hz), 1.49 ( 3H, d, J=8.0Hz).1.21 (3H, d, J=8.0Hz). MS (ESI): m/z 405 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[2(S)-(2-aminoacetamido)-3-phenyl]-propionylaminospectinomycin trihydrochloride (1502): ¹ HNMR (D ₂ O, 400MHz): δ7.07-7.25 (5H, m), 4.26-4.36 (2H, m), 3.85-3.94 (2H, m), 3.70-3.83 (3H, m), 3.38- 3.50(1H, m), 3.31(2H, s), 3.15-3.23(2H, m), 2.96-3.08(2H, m), 2.77(6H, d, J=4.0Hz), 1.78-1.88(1H, m), 1.54-1.69 (1H, m), 1.18 (3H, d, J=8.0Hz). MS (ESI): m/z 538 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-3-benzamidopropionylamino spectinomycin dihydrochloride (1503): ¹ HNMR (D ₂ O, 400MHz): δ7.73( 2H, d, J = 8.0Hz), 7.57-7.63 (2H, m), 7.51 (2H, t, J = 8.0Hz), 4.34 (2H, t, J = 8.0Hz), 4.11 (1H, s), 3.93(2H,p,J=8.0Hz), 3.57-3.83(3H,m), 3.43-3.51(1H,m), 3.32(1H,s), 3.19-3.25(1H,m), 2.79(6H, s), 2.51-2.71 (2H, m), 1.71-1.82 (1H, m), 1.55 (1H, d, J = 12.0Hz), 0.97 (3H, d, J = 4.0Hz). MS (ESI): m/z509(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-3-(2-phenylacetylamino)propionylamino spectinomycin dihydrochloride (1504): ¹ HNMR (D ₂ O, 400MHz): δ7.23-7.42 (5H, m), 4.35 (2H, t, J=8.0Hz), 4.07 (1H, s), 3.83-4.01 (3H, m), 3.39-3.57 (3H, m), 3.17- 3.36(4H, m), 2.79(6H, s), 2.46(2H, br.s), 1.74-1.86(1H, m), 1.58(1H, d, J=12.0Hz), 1.18(3H, d, J=4.0Hz).MS(ESI):m/z523(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2,2-diphenyl)acetamidospectinomycin dihydrochloride (1514): ¹ HNMR (D ₂ O, 400MHz): δ7. 46-7.31(10H, m), 5.30(1H, s), 4.91(1H, s), 4.76(1H, s), 4.40(1H, dd, J=11.0Hz, 9.7Hz), 4.23(1H, t , J=3.0Hz), 4.05-3.90(3H, m), 3.53(1H, dd, J=11.1Hz, 2.7Hz), 3.27(1H, dd, J=9.9Hz, 2.7Hz), 2.84(6H, s), 1.97-1.86 (1H, m), 1.77 (1H, dd, J = 12.4Hz, 2.2Hz), 1.23 (3H, d, J = 6.1Hz). MS (ESI): m/z528 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-[2(S)-amino, 3-phenyl]propionylamino spectinomycin trihydrochloride (1515): ¹ HNMR (400MHz, D ₂ O): δ7.32-7.42 (3H, m), 7.22-7.29 (2H, m), 4.29 (2H, t, J=8HHz), 4.00 (1H, s), 3.83-3.94 (2H, m), 3.39-3.58(2H,m), 3.15-3.34(3H,m), 2.97-3.14(2H,m), 2.77(6H,s), 1.59-1.71(1H,m), 1.09-1.17(1H,m ), 1.06 (3H, d, J=4.0Hz). MS (ESI): m/z 481 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-bromopyridin-2-yl)acetamidospectinomycin trihydrobromide (1516): ¹ HNMR (D ₂ O, 400MHz): δ8.77(1H, s), 8.33(1H, s), 7.58(1H, s), 5.03(1H, s), 4.78(1H, s), 4.42(1H, dd, J=10.9Hz, 9.9Hz ), 4.20 (1H, d, J = 3.0Hz), 4.14-3.95 (5H, m), 3.55 (1H, dd, J = 11.2Hz, 2.5Hz), 3.29 (1H, dd, J = 10.1Hz, 2.7 Hz), 2.85(6H, d, J=1.6Hz), 1.96-1.88(1H, m), 1.79(1H, d, J=14.6Hz), 1.28(3H, d, J=6.1Hz).MS( ESI): m/z531, 533 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-phenylthiazol-4-yl)acetamidospectinomycin trihydrobromide (1517): ¹ HNMR (D ₂ O, 400MHz) : δ7.94 (2H, dd, J = 7.8Hz, 1.7Hz), 7.67-7.55 (3H, m), 7.51 (1H, s), 5.03 (1H, s), 4.48-4.38 (1H, m), 4.21 (1H, d, J = 3.1Hz), 4.14-3.92 (5H, m), 3.55 (1H, dd, J = 11.1Hz, 2.6), 3.29 (1H, dd, J = 10.1Hz, 2.8Hz), 2.85(6H, d, J=1.4Hz), 1.95-1.87(1H, m), 1.81(1H, d, J=14.4Hz), 1.27(3H, d, J=6.1Hz).MS(ESI): m/z535(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(pyridin-2-yl)propionylamino spectinomycin trihydrobromide (1518): ¹ HNMR (D ₂ O, 400MHz): δ8. 60-8.56(1H, m), 8.45(1H, td, J=8.0Hz, 1.6Hz), 7.88-7.82(2H, m), 4.84(1H, s), 4.76(1H, s), 4.29(1H , dd, J=10.9Hz, 9.8Hz), 4.03(1H, d, J=2.9Hz), 3.98-3.81(3H, m), 3.44(1H, d, J=11.2Hz), 3.29(2H, dd , J=11.6Hz, 4.5Hz), 3.22-3.15(1H, m), 2.83(2H, dd, J=10.2Hz, 4.4Hz), 2.75(6H, s), 1.83-1.73(1H, m), 1.52 (1H, d, J = 14.6Hz), 1.14 (3H, d, J = 6.1Hz). MS (ESI): m/z 467 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-phenylpyridin-2-yl)acetamidospectinomycin trihydrobromide (1519): ¹ HNMR (D ₂ O, 400MHz) : δ8.91(1H, s), 8.66(1H, m), 7.88(1H, m), 7.67(2H, m), 7.50(3H, m), 4.91(1H, s), 4.65(1H, s ), 4.28(1H, d, J=10.0Hz), 4.12(2H, d, J=8.2Hz), 4.03-3.71(3H, m), 3.41(1H, s), 3.14(1H, s), 2.70 (6H, d, J = 7.8Hz), 1.79 (1H, m), 1.68 (1H, d, J = 11.0Hz), 1.15 (3H, d, J = 6.1Hz). MS (ESI): m/z529 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-(phenylamino)thiazol-4-yl)acetamidospectinomycin trihydrobromide (1520): ¹ HNMR (D ₂ O , 400MHz): δ7.60-7.54(2H, m), 7.50-7.43(3H, m), 6.76(1H, s), 5.00(1H, s), 4.42(1H, dd, J=10.9Hz, 9.9 Hz), 4.21(1H, t, J=3.1Hz), 4.12-3.95(3H, m), 3.84-3.74(2H, m), 3.57(1H, dd, J=11.1Hz, 2.6Hz), 3.30( 1H, dd, J = 10.2Hz, 2.7), 2.86 (6H, d, J = 1.4Hz), 1.93 (1H, ddd, J = 15.0Hz, 10.3Hz, 3.9Hz), 1.78 (1H, dd, J = 12.3Hz, 2.2Hz), 1.28(3H, d, J=6.1Hz). MS(ESI): m/z550(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-(4-chlorophenyl)pyridin-2yl)acetamidospectinomycin trihydrobromide (1535): ¹ HNMR (D ₂ O, 400MHz): δ8.92 (1H, d, J = 2.2Hz), 8.66 (1H, dd, J = 8.4, 2.2Hz), 7.90 (1H, d, J = 8.4Hz), 7.69-7.62 (2H , m), 7.56-7.50 (2H, m), 4.94 (1H, s), 4.67 (1H, m), 4.34-4.28 (1H, m), 4.13 (2H, m), 4.07-3.85 (3H, m ), 3.56 (1H, q, J = 7.1Hz), 3.45 (1H, dd, J = 11.1, 2.6Hz), 3.19 (1H, dd, J = 10.2, 2.7Hz), 2.74 (6H, d, J = 0.9Hz), 1.90-1.78(1H, m), 1.70(1H, m), 1.19(3H, d, J=6.1Hz). MS(ESI): m/z563(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(quinolin-8-yl)carbonylamino spectinomycin trihydrobromide (1536): ¹ HNMR (D ₂ O, 400MHz): δ9. 10-9.05(1H, m), 9.02(1H, d, J=8.5Hz), 8.42(1H, d, J=7.3Hz), 8.39-8.31(1H, m), 7.98(1H, dd, J= 8.4, 5.3Hz), 7.89(1H, t, J=7.9Hz), 5.07(1H, s), 4.45(1H, t, J=3.0Hz), 4.42-4.34(1H, m), 4.16-4.05( 1H, m), 4.01(1H, t, J=10.0Hz), 3.91(1H, t, J=10.1Hz), 3.50(1H, d, J=11.2Hz), 3.21(1H, d, J=10.3 Hz), 2.77(6H, d, J=13.0Hz), 2.01-1.91(2H, m), 1.21(3H, d, J=6.1Hz). MS(ESI): m/z489(M ⁺ +H) .

3'-Dihydro-3'-deoxy-4(R)-2-(1-benzyl-1H-1,2,3-triazol-4-yl)acetamidospectinomycin tetrabromide (1537) : ¹ H NMR (D ₂ O, 400MHz): δ7.84 (1H, s), 7.34 (3H, ddd, J=8.1, 4.4, 1.5Hz), 7.28-7.24 (2H, m), 5.53 (2H, s ), 4.85(1H, s), 4.66(1H, t, J=2.5Hz), 4.35-4.25(1H, m), 4.05(1H, t, J=3.1Hz), 3.89(3H, dt, J= 24.4, 9.8Hz), 3.55 (2H, q, J = 7.1Hz), 3.43 (1H, d, J = 8.7Hz), 3.20-3.13 (1H, m), 2.73 (6H, d, J = 2.1Hz) , 1.82-1.73 (1H, m), 1.63 (1H, dd, J = 12.3, 2.4Hz), 1.13 (3H, d, J = 6.1Hz). MS (ESI): m/z 533 (M ⁺ +H) .

3'-Dihydro-3'-deoxy-4(R)-(2-((4-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin tribromide (1538): ¹ HNMR( D ₂ O, 400MHz): δ7.39-7.34 (2H, m), 7.20-7.14 (2H, m), 6.62 (1H, s), 4.87 (1H, s), 4.68-4.66 (1H, m), 4.30 (1H, dd, J = 10.9, 9.9Hz), 4.09 (1H, t, J = 3.0Hz), 3.91 (3H, m), 3.65 (1H, d, J = 3.8Hz), 3.55 (1H, q , J=7.1Hz), 3.46-3.41(1H, m), 3.18(1H, dd, J=10.2, 2.7Hz), 2.74(s, 6H), 1.86-1.77(1H, m), 1.66(1H, d, J=14.6Hz), 1.16 (3H, d, J=6.1Hz). MS (ESI): m/z 568 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(2-((3-fluorophenyl)amino)thiazol-4-yl)acetamidospectinomycin tribromide (1539): ¹ HNMR( D ₂ O, 400MHz): δ7.40(1H, td, J=8.2, 6.6Hz), 7.22-7.13(2H, m), 6.99(1H, td, J=8.6, 2.4Hz), 6.67(1H, s), 4.88(1H, s), 4.67(1H, t, J=2.8Hz), 4.35-4.21(1H, m), 4.09(1H, t, J=3.1Hz), 4.01-3.83(3H, m ), 3.66 (1H, d, J = 1.8Hz), 3.58-3.53 (1H, m), 3.44 (1H, dd, J = 7.7, 3.4Hz), 3.18 (1H, dd, J = 10.2, 2.7Hz) , 2.74(6H, s), 1.86-1.76(1H, m), 1.71-1.62(1H, m), 1.14(3H, d, J=6.1Hz). MS(ESI): m/z568(M ⁺⁺ H).

3'-Dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethoxy)phenyl)amino)-thiazol-4-yl)acetamidospectinomycin tribromide (1540): ¹ HNMR (D ₂ O, 400MHz): δ7.45-7.41 (2H, m), 7.35 (2H, d, J=8.5Hz), 6.65 (1H, s), 4.88 (1H, s) , 4.67(1H, t, J=2.8Hz), 4.30(1H, dd, J=10.9, 9.9Hz), 4.09(1H, t, J=3.1Hz), 4.00-3.83(3H, m), 3.66( 1H, d, J = 2.6Hz), 3.55 (1H, q, J = 7.1Hz), 3.44 (1H, dd, J = 7.7, 3.4Hz), 3.18 (1H, dd, J = 10.2, 2.8Hz), 2.74 (6H, s), 1.86-1.75 (1H, m), 1.71-1.63 (1H, m), 1.15 (3H, d, J=6.1Hz). MS (ESI): m/z634 (M ⁺ +H ).

3'-dihydro-3'-deoxy-4(R)-(2-((4-(trifluoromethyl)phenyl)amino)-thiazol-4-yl)acetamidospectinomycin tribromide ( 1541): ¹ HNMR (D ₂ O, 400MHz): δ7.71 (2H, d, J = 8.5Hz), 7.51 (2H, d, J = 8.6Hz), 6.71 (1H, s), 4.88 (1H, s), 4.68-4.66(1H, m), 4.30(1H, dd, J=11.0, 9.9Hz), 4.09(1H, t, J=3.0Hz), 3.98-3.84(3H, m), 3.67(1H , s), 3.55(1H, q, J=7.1Hz), 3.43(1H, m), 3.18(1H, dd, J=10.2, 2.7Hz), 2.74(s, 6H), 1.86-1.75(1H, m), 1.67(1H, d, J=14.5Hz), 1.14(3H, d, J=6.1Hz). MS(ESI): m/z618(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-(4-fluorophenyl)pyridin-2-yl)acetamidospectinomycin tribromide (1542): ¹ HNMR (D ₂ O , 400MHz): δ8.90 (1H, d, J = 2.2Hz), 8.66 (1H, dd, J = 8.4, 2.2Hz), 7.91 (1H, d, J = 8.4Hz), 7.74-7.66 (2H, m), 7.29-7.21(2H, m), 4.94(1H, s), 4.69-4.67(1H, m), 4.35-4.27(1H, m), 4.16(1H, d, J=4.6Hz), 4.14 -4.11(1H, m), 4.07-3.85(3H, m), 3.56(1H, q, J=7.1Hz), 3.49-3.42(1H, m), 3.19(1H, dd, J=10.2, 2.6Hz ), 2.75(s, 6H), 1.90-1.77(1H, m), 1.70(1H, d, J=14.6Hz), 1.19(3H, d, J=6.1Hz). MS(ESI): m/z547 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(5-(3-methoxyphenyl)pyridin-2-yl)acetyl-aminospectinomycin tribromide (1543): ¹ HNMR( D ₂ O, 400MHz): ¹ HNMR (400MHz, D ₂ O) δ8.90 (1H, s), 8.63 (1H, d, J = 8.3Hz), 7.87 (1H, d, J = 8.5Hz), 7.47 (1H, t, J = 8.0Hz), 7.29 (1H, d, J = 7.6Hz), 7.25 (1H, s), 7.10 (1H, d, J = 8.3Hz), 4.94 (1H, s), 4.31 (1H, t, J=10.4Hz), 4.13(2H, s), 4.06-3.87(3H, m), 3.83(s, 3H), 3.56(1H, dd, J=14.2, 7.1Hz), 3.44( 1H, d, J=3.9Hz), 3.18(1H, d, J=8.9Hz), 2.74(s, 6H), 1.87-1.81(1H, m), 1.70(1H, d, J=14.0Hz), 1.19 (3H, d, J=6.0Hz). MS (ESI): m/z 559 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(4-chloropyridin-2-yl)acetamidospectinomycin tribromide (1544): ¹ HNMR (D ₂ O, 400MHz): ¹ HNMR (400MHz, _D2O ) δ8.57 (1H, dd, J = 5.3, 1.8Hz), 7.87-7.85 (2H, m), 4.93 (1H, s), 4.69-4.66 (1H, m), 4.34- 4.28(1H, m), 4.11(1H, t, J=3.0Hz), 4.09-3.83(m, 5H), 3.45(1H, dd, J=11.1, 2.6Hz), 3.19(1H, dd, J= 10.2, 2.8Hz), 2.74 (6H, d, J = 0.9Hz), 1.87-1.78 (1H, m), 1.69 (1H, d, J = 14.5Hz), 1.18 (3H, d, J = 6.1Hz) .MS(ESI): m/z487(M ⁺⁺ H).

General method for the synthesis of 3'-deoxy3'-alkylaminospectinomycins (1419, 1420 and 1421): Addition of stirred NaBH4 ( ₁₀ mmol) and diCbz-protected amide (1 mmol) to anhydrous di Alkane (10mL) suspension was added in two _CF3COOH (10 mmol) in alkanes (2 mL). After gas evolution ceased, the mixture was heated to reflux for 2 h, cooled, poured into water (50 mL) and extracted with _CH2Cl2 ( _2x30 mL), washed with water (30 mL), dried ( _{Na2SO4 )} , evaporated and chromatographed by column Purify the residue. Deprotection of the amino protecting group was achieved by dissolving the protected amide in a mixture of 1.25M HCl in MeOH and EtOH (1:1) containing 10% Pd—C (50% by mass). The mixture was hydrogenated under 30 Psi/ _H2 at room temperature for 2 hours, filtered and concentrated. The obtained solid was triturated with cold diethyl ether, filtered and washed with excess diethyl ether, and dried in vacuo to obtain the target 3'-deoxy3'-alkylaminospectinomycin.

General method for the synthesis of 3'-deoxy3'-alkylaminospectinomycins (1422-1425): 6,8-dibenzyloxycarbonyl 4(R)-aminospectinomycin in anhydrous EtOH (10 mL) at room temperature Mymycin (1 mmol) and the corresponding aryl aldehyde (1.2 mmol) were stirred for 5 h. PtO ₂ (catalyst) was added and the mixture was hydrogenated overnight at room temperature in 30 Psi/H ₂ , filtered, concentrated, and purified by column chromatography. Deprotection of the amino CBz protecting group was achieved by dissolving the protected amide in a mixture of 1.25M HCl in MeOH and EtOH (1:1) containing 10% Pd-C (50% by mass). The mixture was hydrogenated under 30 Psi/ _H2 at room temperature for 2 hours, filtered and concentrated. The obtained solid was triturated with cold diethyl ether, filtered and washed with excess diethyl ether, and dried in vacuo to obtain the target 3'-deoxy3'-alkylaminospectinomycin.

Analytical data for individual 3'-deoxy3'-alkylaminospectinomycin compounds:

3'-Dihydro-3'-deoxy-4(R)-cyclopropylmethylaminospectinomycin trihydrochloride (1419): ¹ HNMR (CD ₃ OD, 500MHz): δ5.01 (1H, s ), 4.33 (1H, t, J = 10.2Hz), 3.99 (1H, t, J = 9.5Hz), 3.88 (1H, t, J = 10.0Hz), 3.62-3.67 (3H, m), 3.42-3.53 (1H, m), 3.05-3.11 (3H, m), 2.81 (3H, s), 2.78 (3H, s), 1.99-2.08 (1H, m), 1.62-1.82 (1H, m), 1.28 (3H , d, J=5.6Hz), 1.14-1.19 (1H, m), 0.72 (2H, d, J=5.3Hz), 0.43 (2H, d, J=16.6Hz); MS (ESI): m/z388 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(3-methyl)butylaminospectinomycin trihydrochloride (1420): ¹ HNMR (CD ₃ OD, 500MHz): δ5.04( 1H, s), 4.39 (1H, t, J=10.5Hz), 3.84-4.00 (3H, m), 3.67-3.77 (2H, m), 3.06-3.23 (4H, m), 2.89 (3H, s) , 2.85(3H, s), 2.12-2.22(2H, m), 1.62-1.74(3H, m), 1.34(3H, d, J=5.8Hz), 1.01(6H, brs); ¹³ CNMR (CD ₃ OD, 125MHz): δ93.2, 88.9, 75.5, 70.2, 69.0, 66.5, 66.2, 61.7, 61.5, 60.0, 58.4, 37.5, 34.1, 30.5, MS(ESI): m/z404(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-dodecylaminospectinomycin trihydrochloride (1421): ¹ HNMR (D ₂ O, 500MHz): δ5.03 (1H, s) , 4.28-4.37(1H, m), 4.03(2H, t, J=9.7Hz), 3.96(1H, t, J=10.0Hz), 3.75(1H, t, J=10.0Hz), 3.53(1H, d, J=8.5Hz), 3.84-3.42(1H, m), 3.09-3.26(3H, m), 3.02(1H, d, J=15.6Hz), 2.81(8H, s), 1.98-2.10(1H , m), 1.67-1.72 (1H, m), 1.28 (20H, brs), 0.82 (3H, d, J=6.5Hz); ¹³ CNMR (CD ₃ OD, 125MHz): δ94.8, 90.4, 71.9, 70.3, 67.6, 63.2, 61.0, 33.2, 30.8, 27.8, 23.8, 21.1; MS(ESI): m/z502(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-furan-2yl-methylaminospectinomycin trihydrochloride (1422): ¹ HNMR (D ₂ O, 500MHz): δ7.61 (1H , s), 6.68(1H, d, J=2.4Hz), 6.51(1H, s), 5.04(1H, s), 4.47(1H, s), 4.28-4.36(3H, m), 4.01-4.09( 2H, m), 3.90-3.97 (1H, m), 3.81-3.90 (1H, m), 3.46-3.54 (1H, m), 3.24-3.26 (1H, m), 2.81 (6H, s), 1.89- 2.17(2H, m), 1.28(3H, d, J=5.6Hz); MS(ESI): m/z 414(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(3-methoxy)benzylamino spectinomycin trihydrochloride (1423): ¹ HNMR (D ₂ O, 500MHz): δ7.44 (1H, t, J = 8.5Hz), 7.11 (3H, d, J = 7.8Hz), 5.02 (1H, s), 4.26-4.54 (3H, m), 3.92-4.06 (3H, m), 3.84 ( 3H, s), 3.40-3.54 (2H, m), 3.20-3.26 (2H, m), 2.80 (6H, s), 2.06 (1H, d, J=15.6Hz), 1.92-1.98 (1H, m) , 1.28 (3H, d, J=5.8Hz); MS (ESI): m/z 454 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-4-fluoro)benzylamino spectinomycin trihydrochloride (1424): ¹ HNMR (D ₂ O, 500MHz): δ7.52 (2H, t, J = 7.5Hz), 7.22 (2H, t, J = 8.5Hz), 5.02 (1H, s), 4.41 (2H, dd, J = 13.4Hz), 4.29 (1H, t, J = 10.5Hz) , 4.00-4.09(3H, m), 3.95(1H, t, J=10.0Hz), 3.49(2H, t, J=14.4Hz), 3.24(1H, d, J=10.2Hz), 2.80(3H, s), 2.78(3H, s), 2.09(1H, d, J=15.8Hz), 1.95-2.00(1H, m), 1.27(3H, d, J=5.8Hz); MS(ESI): m/ z442(M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-(4-methyl)benzylamino spectinomycin trihydrochloride (1425): ¹ HNMR (D ₂ O, 500MHz): δ7.35( 4H, dd, J=7.5Hz), 5.01(1H, s), 4.38(2H, dd, J=13.1Hz), 4.28(1H, t, J=10.5Hz), 4.00-4.09(3H, m), 3.94(1H, t, J=10.0Hz), 3.50(1H, d, J=10.9Hz), 3.42(1H, brs), 3.25(1H, d, J=10.0Hz), 2.80(3H, s), 2.77(3H, s), 2.35(3H, s), 2.06(1H, d, J=15.8Hz), 1.95(1H, t, J=11.7Hz), 1.27(3H, d, J=5.8Hz); MS (ESI): m/z 438 (M ⁺ +H).

3'-Dihydro-3'-deoxy-4(R)-2phenylethylaminospectinomycin trihydrochloride (1450): ¹ HNMR (D ₂ O, 400MHz): δ7.32-7.42 (3H , m), 7.22-7.29 (2H, m), 5.01 (1H, s), 4.38 (2H, dd, J=13.1Hz), 4.28 (1H, t, J=10.5Hz), 4.00-4.09 (3H, m), 3.94(1H, t, J=10.0Hz), 3.50(1H, d, J=10.9Hz), 3.42(1H, brs), 3.25(1H, d, J=10.0Hz), 2.62(2H, m), 2.77(3H, s), 2.35(3H, s), 2.06(1H, d, J=15.8Hz), 1.95(1H, t, J=11.7Hz), 1.27(3H, d, J=5.8 Hz); MS (ESI): m/z 438 (M ⁺ +H).

Example 2

General in vitro and in vivo methods

MIC determination: application according to Clinical Laboratory Standards Institute (Clinical Laboratory Standards Institute) (CLSI; National, CFCLS, Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically-Seventh Edition: Approved Standard M7-A7, CLSI, Wayne, Pennsylvania, U.S.A., 2008) micro broth was measured by method and diluted, Visually check the readings. 2-fold serial dilutions of antibiotics in 100 μL of appropriate broth medium were first prepared in 96-well round bottom microtiter plates (NalgeNunc International, Rochester, New York, USA). Add an equal volume (100 μL) of bacterial broth inoculum containing approximately ¹⁰⁵ bacterial cfu/mL to each well to obtain a final drug concentration starting at 200 μg/mL and incubate the plate aerobically at 37 °C . M. tuberculosis and M. bovis BCG microtiter plates were incubated for 7 days, while the other strains were incubated overnight. The MIC against M. tuberculosis was also estimated by a method based on the CLSI agar ratio method. Briefly, 24-well plates were equipped with 2-fold serial dilutions of antibiotics in 2 mL of 7H11 agar and inoculated with approximately 105 cfu and incubated for 3 weeks. After incubation, the MIC was recorded in all cases as the lowest drug concentration that prevented bacterial growth.

Checkered plate synergy test: Anti-Mycobacterium tuberculosis H37Rv of 1329 in combination with rifampicin, isoniazid and ethambutol was assessed in triplicate by a checkered plate titration method in a 96-well round bottom plate activity. A similar combination with streptomycin was evaluated for comparison. Plates contained bacterial inoculum (10 ⁵ cfu/mL) and 2-fold serial dilutions of each antibiotic in a total volume of 200 μL broth. The maximum and minimum concentrations of each diluted drug were at least ±4 times their MIC. After 7 days of incubation at 37°C, the MICs of the drug combinations were read by visual inspection and the Fractional Inhibitory Concentration (FIC) index against M. tuberculosis H37Rv was calculated as described by Eliopoulos et al. See Eliopoulos et al ., Antimicrobial Combinations, In Antibiotics in Laboratory Medicine, Williams and Wilkins, Co., Baltimore, Maryland, USA, 2000, pp. 432-449. The FIC index is interpreted as follows: <0.5, synergy; >0.5 to 4, additive; and >4, antagonism. See Odds, FC , J. Antimicrob. Chemother., 52, 1 (2003).

Selection and phenotypic characterization of drug-resistant mutants: The frequency of spontaneous mutations in resistant M. tuberculosis H37Rv was determined by plating 100 μL of saturated cultures on 7H11 agar plates containing drugs at 4, 8, and 16× agar MICs. Plates were incubated at room temperature for 3 weeks, and the number of drug-resistant clones divided by the total number of viable cells was recorded as the mutation frequency. Isolated clones were then randomly picked from the selection plate and inoculated into 7H9 broth containing the antibiotic concentration at which they were selected. Clones capable of regrowth were then grown to mid-log phase in the absence of drug and antibiotic MICs determined by broth microdilution.

Detection of Spectinomycin Resistance Mutations: To determine the genetic mechanism of spectinomycin resistance in M. tuberculosis, the 16S rRNA and rpsE genes were PCR amplified using respective oligonucleotide primers from Integrated DNA Technologies (Coralville, Iowa, USA). Under landing PCR cycle conditions, 16S-F (5'-CCGTTTGTTTTGTCAGGATA) (SEQ ID NO: 1) and 16S-R (TTTCTCAAACACACACCCCCCA) (SEQ ID NO: 2) were used to amplify 16S rRNA, and rpsE-F (5'-GGCGTGCCGGGTGACAAAAAGG) ( SEQ ID NO: 3) and rpsE-R (5'-GAATCCTTCGTAAGCCCA) (SEQ ID NO: 4) amplify rpsE. Amplicons were purified using Qiagen's MINELUTE ^™ PCR Kit (Qiagen, NV, Venlo, Netherlands) and sequenced by Molecular Resource Center, University of Tennessee Health Science Center (Memphis, Tennessee, United States of America) using ABI Model 3130XL Genetic Analyzer (Applied Biosystems, Foster City, California, USA). The sequence chromatograms were then analyzed using the software program CLCMainWorkbench (CLCbio, Aarhus, Denmark).

Cytotoxicity: Vero epithelial cells (from African green monkey; American Type Culture Collection (ATCC) CCL-81; Manassas, Virginia, USA), and kept in a humid incubator (37C, 5% _CO2 ). Cells were removed with a cell scraper, harvested by centrifugation, resuspended in fresh medium at ~ ¹⁰⁶ cells/mL, dispensed into 96-well microtiter plates (100 μL/well), and incubated at 37°C for 18 hours. 2-fold serial dilutions of test compounds (800-0.4 mg/L) in DMEM with FBS were then added and cells were incubated for an additional 72 hours. From triplicate studies, the cytopathic potency of compounds was assessed colorimetrically using the MTT cell proliferation assay (ATCC, Manassas, Virginia, USA). _IC50 data were obtained from dose response curves plotted using GraphPadprism5 (GraphPadSoftware, San Diego, California, USA).

E. coli S30 transcription/translation assay: A commercially available E. coli S30 assay (Promega, Madison, Wisconsin, USA) monitored luciferase production and was performed as described by the manufacturer. Reactions were performed in a 25 μL volume consisting of 10 D L Premix, 2.5 μL complexed amino acids, 7.5 μL S30 extract, 2.5 μL inhibitor or DMSO (2.5%), 1 μL pBESTluc plasmid (1 μg), and 1.5 μL nuclease-free water. Reactions were incubated for 30 minutes and then stopped by placing on ice for 5 minutes. Then, 50 μL of Luciferase Assay Reagent (Promega, Madison, Wisconsin, USA) was added and fluorescence readings were obtained in a BioTekSYNERGY ^™ HT plate reader (BioTek Instruments, Inc., Winooski, Vermont, USA). _IC50 data were obtained from dose response curves plotted using GraphPadprism5 (GraphPadSoftware, San Diego, California, USA). Using the determined micromolar _IC50 value of compound 1329, other spectinomycin derivatives were examined.

In vitro microsomal metabolic stability: The in vitro microsomal metabolic stability of compounds was evaluated using collected rabbit liver microsome preparations (Cellzdirect, Austin, Texas, USA). By adding 25 μL of microsomal protein solution (10 mg/mL) to 25 μL of test compound (20 μM) and 200 μL of NADPH regeneration solution (1.3 mM NADP+, 3.3 mM glucose- ₆ -phosphate, 3.3 mM MgCl and 1 unit/mL glucose-6-phosphate dehydrogenase) to start the reaction. The reaction mixture was incubated at 37°C and samples were taken at 0, 5, 10, 15, 30, 45, 60 and 90 minutes. A reaction mixture containing the above components but using inactivated microsomes was used as a control. All samples were analyzed using LC-MS/MS testing. The disappearance of the parent compound was monitored during the incubation period. The percentage of parent compound remaining intact was estimated by comparing the analyte concentrations before and after incubation.

Protein binding: The protein binding of compounds was determined using equilibrium dialysis. Biologically relevant concentrations of test compounds (low and high) were prepared in rat plasma. 200 μL of plasma samples were placed in the central chamber and 350 μL of blank isotonic phosphate buffer (pH 7.4) was added to the dialysis unit (MW cutoff 6000-8000D, device, Pierce Biotechnology Inc, Rockford, Illinois, USA) in the surrounding chamber. The chamber was covered with a seal and incubated for 4 hours at 37°C on a shaker set at 100 rpm. At the end of the incubation, measure the volumes of plasma and receiving buffer to determine and resolve volume shifts, if any. Aliquots of plasma and buffer were used to determine drug concentrations using LC-MS/MS assays. The free fraction of drug was calculated as the ratio of the concentrations in buffer and in plasma.

Pharmacokinetic studies: Cannulated male Sprague-Dawley rats weighing approximately 225 g were obtained from Harlan Bioscience (Indianapolis, Indiana, USA) (jugular vein only for oral studies, jugular and femoral vein for intravenous studies) vein). Animals were maintained on a 12 hour light/dark cycle with ad libitum access to food and water. Groups of rats (n=4) receive intravenous (IV) or oral doses of test compound at dose levels of 10 mg/kg or 100 mg/kg, respectively. For oral administration, animals were fasted overnight and until 4 hours after administration of the test compound. Serial blood samples (approximately 250 [mu]L) were collected prior to dosing and at predetermined time points up to 48 hours after dosing. Plasma was immediately separated by centrifugation (4°C, 10,000 rpm, 10 minutes) and stored at -80°C until analysis. Urine samples were collected during 48 hours after drug administration. The study protocol was approved by the Institutional Animal Care and Use Committee of the University of Tennessee Health Sciences Center (Memphis, Tennessee, USA).

Sample preparation and LC-MS/MS testing: A calibration curve was constructed for each test compound in the range of 7.81-1000 μg/L by spiking the test compound into 50 μL of blank rat plasma. Compound 1369, an analog structurally similar to the test compound, was used as an internal standard (IS) for all calibration standards and all plasma specimens. Plasma proteins were precipitated by adding 4 volumes of ice-cold methanol with IS. The samples were vortexed and kept on ice for 20 minutes. Afterwards, the samples were centrifuged at 10,000 rpm for 10 minutes at 4°C, and the supernatant was diluted if necessary and injected into LC-MS/MS for analysis. Chromatographic separation was performed using a Shimadzu liquid chromatograph (Shimadzu Corporation, Kyoto, Japan) consisting of two pumps, an on-line degasser, a system controller, and a CTCLeap autosampler (Leap Technologies, Carrboro, North Carolina, USA). A gradient of methanol and 10 mM ammonium acetate (pH 3.5) was used at a flow rate of 0.4 mL/min. Applications protected with a guard column A Luna 3μHILIC, 100x4.6mm column (Phenomenex, Torrance, California, USA) was used for separation. 10 μL of sample was injected into the column, and the eluate was directly introduced into an API3000 triple-quadrupole mass spectrometer (Applied Biosystems ABI/MDS-Sciex, Foster City, California, USA) equipped with an electrospray ion source. In positive ion mode, with 7psi nebulizer gas (NEB), 8psi curtain gas (CUR), 10psi collision gas (CAD), +4000V ion injection voltage (IS) and 500°C temperature (TEM) Operate the instrument. The resulting multiple reaction monitoring chromatograms were used for quantification by applying Analyst software version 1.4.1 (Applied Biosystems ABI/MDS-Sciex, Foster City, California, USA).

Pharmacokinetic Data Analysis: Plasma concentration-time data for oral doses were analyzed by non-compartmental analysis. A two-compartment open model with bolus input and first order output was applied for analysis of IV plasma concentration-time data. The area under the plasma concentration-time curve (AUCinf) from time 0 to infinity was calculated by extrapolating time to infinity by the trapezoidal rule. The mean residence time (MRT) of an IV dose, the average amount of time a particle remains in the system compartment, is calculated using MRT = AUMCinf/AUCinf, where AUMCinf is the moment curve (moment curve) when the concentration-time curve is extrapolated to infinity area. Systemic clearance (CL) was calculated using the equation CL=Doseiv/AUCinfiv, where Doseiv and AUCinf,iv are the IV dose and the corresponding area under the plasma concentration-time curve from time 0 to infinity, respectively. Estimates of the volume of distribution at steady state (Vss) were obtained from the IV data using Vss=MRT*CL. Oral availability (F) was calculated using F=(AUCinf,oral*Doseiv)/(AUCinf,iv*Doseoral), where Doseoral, Doseiv, AUCinf,iv and AUCinf,oral were the oral dose and IV dose, respectively, and the dose from time 0 to infinity the corresponding area under the plasma concentration-time curve. Physiological parameters of rats obtained by Davies et al . (Pharm. Res., 10(7), 1093-1095 (1993)) were used to calculate excretion ratio and liver extraction rate.

Example 3

Antituberculous activity

The anti-tuberculosis activity of spectinomycin analogs against Mycobacterium tuberculosis H37Rv was determined in Middlebrook 7H9 supplemented with 10% ADC medium by dilution in drug microbroth in 96-well plates. Plates were incubated at 37°C for 7 days and then read visually for growth inhibition according to a previously described method. See eg Hurdle et al ., J. Antimicrob. Chemother, 62(5), 1037-1045 (2008). The results are shown in Table 1 and Table 2.

Table 1.3'-deoxy3'(R)-acylamino spectinomycin anti-tuberculosis activity

Table 2.3'-Deoxy 3'(R)-Alkylamino Spectinomycin Anti-tuberculosis Activity

Multiple compounds showed good anti-tuberculosis MIC values, many of which had better anti-tuberculosis activity compared to spectinomycin. The structure-activity relationship of this series is very tight in terms of structural changes and MIC values. Without being bound by any one theory, it is believed that this dictates specific binding to the ribosomal receptor site and strict rules for the uptake of inhibitors into M. tuberculosis.

Example 4

antibacterial activity

The MICs of synthetic analogs of spectinomycin were determined against a variety of other clinically important Gram-positive and Gram-negative pathogens, including Staphylococcus aureus, Enterococcus faecalis, Bacillus anthracis, Streptococcus pyogenes , Streptococcus pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Burholderia cepacia, Proteus mirabilis, Proteus vulgaris, Klebsiella pneumoniae, Acinetobacter baumannii and Stenotrophomonas maltophilia. These results are shown in Tables 3 and 4.

Table 3. Activity against Gram-positive bacteria ^*

^* The full names of the test organisms listed in the table are as follows: Staphylococcus aureus 8325 or strain ATCC29213 (for 1471-1544); Streptococcus pyogenes ATCC700294; Streptococcus pneumoniae DAW27 or strain R6 (for 1443-1544); Enterococcus faecalis ATCC33186 and Bacillus anthracis Sterne34F2. NT - not tested.

Table 4. Activity against Gram-negative bacteria ^*

^* The full names of the test organisms listed in the table are as follows: Burholderia cepacia ATCC25416, Proteus mirabilis ATCC25933, Proteus vulgaris ATCC33420, Klebsiella pneumoniae ATCC33495, Acinetobacter baumannii ATCC19606, Stenotrophomonas maltophilia Bacteria ATCC13637, Pseudomonas aeruginosa PAO1, Escherichia coli K12 and Escherichia coli K12ΔtolC. NT - not tested.

As shown in Table 3, some organisms are more sensitive to certain derivatives than others. For example, compounds 1443, 1444, and 1368 showed MICs against B. anthracis of 1.6, 6.25, and 6.25 μg/mL, respectively, which indicated a 4-16-fold increase over spectinomycin. Similarly, compounds 1422, 1535 and 1543 showed a 4-16 fold improvement over spectinomycin against E. faecalis. Several compounds showed significant activity against Streptococcus pneumoniae. For example, 1329, 1446, 1447, 1491, 1515, 1516, 1517, 1519, 1520, 1535, 1537, 1538, 1539, 1540, 1541, 1542, 1543, and 1544 showed an 8-62.5-fold increase compared to spectinomycin activity against Streptococcus pneumoniae.

As shown in Table 4, the E. coli K12tolC knockout strain possessing a defective multidrug efflux pump was more sensitive to spectinomycin analogs than the parental E. coli K12, while the MIC of spectinomycin was not significantly affected. Without being bound by any one theory, it seems to suggest that the drug efflux system and/or cell permeability may be responsible for the relative inactivity of spectinomycin against most bacterial organisms, and that the spectinomycin amide compounds disclosed in the present invention are highly effective in both uptake and excretion. Bacterial cells differ from spectinomycin. Furthermore, spectinomycin was recently reported to be excreted by Mycobacterium tuberculosis (see Ramon-Garcia et al ., J. Antimicrobial Chemistry, 59(3), 544-547 (2007)), which could partly explain its general lack of anti-TB cell activity. Therefore, it is believed that the enhanced anti-tuberculosis activity of compounds 1329, 1443, 1444 and 1445 and their related analogs against other organisms reflects the increased penetration of these molecules into specific organisms. In addition, it appears that these inhibitors are less sensitive to excretion through drug-efflux mechanisms.

Example 5

Loss of cross-resistance and mode of action study

To determine whether the mode of action of spectinomycin amide against Mycobacterium tuberculosis is consistent with known information on spectinomycin, spontaneous resistance mutations of compound 1329 were selected on agar containing 4, 8 and 16 times the drug of its MIC strain. Mutants exhibiting resistance to 1329 occurred at a frequency of 1.9-3.7x10 ^-6 , which was comparable to the frequency of isoniazid-resistant mutations previously determined using the same method. See Hurdle et al ., J. Antimicrob. Chemother, 62(5), 1037-1045 (2008). However, this is higher than the mutation frequency of streptomycin-resistant mutants, which is 0.7-1.6x10 ^-7 . In the spirochete Borrelia burgdorferi (Borreliaburgdorfeti), spectinomycin resistance also occurs at a frequency of ^10-6 , while streptomycin occurs at a frequency of ^≥10-7 , and it arises from the same Mutations at those different loci for drug resistance. See Criswell et al., Antimicrob. Agents Chemother., 50(2), 445-452 (2006). Without being bound by any one theory, since both spectinomycin and streptomycin target 16S rRNA, it appears that the elevated mutation frequency observed for 1329 reflects mutations at off-target sites, such as those that control 1329 uptake. mutations in the gene. However, cross-resistance to streptomycin, kanamycin and other anti-tuberculosis antibiotics was examined for two stable mutants exhibiting high levels of resistance to 1329 and spectinomycin (MIC = > 200 μg/mL). See Table 5. No mutants were cross-resistant to the aminoglycoside streptomycin and kanamycin, capreomycin, and the 23S ribosomal inhibitor linezolid. Similarly, spontaneous mutants of streptomycin were highly susceptible to 1329, including the reference strain ATCC35820, which was resistant to streptomycin due to a mutation in ribosomal protein S12. See Nair et al ., Mol. Microbiol., 10(3), 521-527 (1993). Importantly, there was no cross-resistance between 1329 and the first-line TB drugs isoniazid, rifampicin, and ethambutol. See Table 5. Taken together, these results confirm that 1329 and spectinomycin appear to display novel modes of action against M. tuberculosis that are unlikely to confer resistance to other established TB antibiotics, including streptomycin and related aminoglycosides sexual mechanism.

Table 5. Activity of 1329 compared to streptomycin

^* Strains also susceptible to streptomycin, kanamycin, capreomycin, linezolid, rifampicin, ethambutol, and isoniazid.

To explore the genetic basis of drug resistance to 1329 and the reason for the lack of cross-resistance to aminoglycosides, molecular genetic analysis was performed on two high-level mutant strains of 1329. In nontuberculous organisms, mutations in helix 34 (spectinomycin-binding domain) are often associated with specific resistance to this antibiotic. See Galimand et al., Antimicrob. Agents Chemother., 44(5), 1365-1366 (2000); and O'Connor and Dahlberg , Current Microbiology, 45(6), 429-433 (2002). Similarly, mutations in the ribosomal protein S5 (encoded by rpsE), which interacts with the spectinomycin-binding domain, also confer spectinomycin resistance, resulting from altered conformational changes in the spectinomycin-binding domain in 16S rRNA of. To determine whether 1329 also binds to helix 34, and whether mutations in ribosomal protein S5 or 16SrRNA cause spectinomycin resistance in M. tuberculosis, two 1329-resistant mutants, HL-14 and 15, were tested against All of these genes were sequenced. No nucleotide changes were detected in the rpsE gene of the two mutants when compared to the rpsE derived from their wild-type ancestor, H37Rv, and the rpsE reference sequence represented by Rv0721 in the H37Rv genome. In contrast, mutant strains HL-14 and 15 contained single-site transversions in the 16S rRNA gene. A point mutation involving a C1057A nucleotide change confers drug resistance in HL-14, whereas mutant HL-15 contains the C1184A mutation in its 16S rRNA. The positions of these mutations associated with the spectinomycin binding domain were probed using BLAST sequence analysis and homology modeling of TB16SrRNA constructed from the crystal structure of the E. coli ribosome bound to spectinomycin. It was found that tuberculosis and Escherichia coli 16SrRNA were highly homologous, with 80% of the sequences identical. Moreover, these sequences were found around the spectinomycin binding site The core region was 100% identical, further supporting the use of E. coli to map the location of our M. tuberculosis 16S rRNA mutation associated with spectinomycin amide binding.

Mutations at position C1192 within helix 34 or its cross-helix partner G1064 are common sites of spectinomycin resistance in E. coli and other organisms. From primary sequence alignment and structural analysis, it was observed that position C1184 in the M. tuberculosis ribosome is homologous to position C1192 in E. coli. See Galimand et al ., Antimicrob. Agents Chemother., 44(5), 1365-1366 (2000); and O'Connor and Dahlberg , Current Microbiology, 45(6), 429-433 (2002). These positions all create equivalent direct H-bond contacts to spectinomycin. Thus, a mutation in M. tuberculosis that produces an adenine residue at position 1184 removes the H-bond contact that is critical for stabilizing spectinomycin within the M. tuberculosis ribosome. Similarly, position C1057 is also homologous to E. coli C1066, which also stabilizes spectinomycin through H-bond interactions. Mutations involving C1066U have been reported to confer spectinomycin resistance in Salmonella enterica serovar Typhimurium and Escherichia coli, supporting our finding that the equivalent locus (C1057) in M. high levels of drug resistance. See O'Connor and Dahlberg , Current Microbiology, 45(6), 429-433 (2002). Without being bound by any one theory, it is believed that the mutation resistance to 1329 localizes directly in M. tuberculosis 16S rRNA helix 34, which is consistent with the reported mode of action of spectinomycin and explains the lack of interaction with streptomycin and anti- Target-mediated cross-resistance to other ribosome inhibitors of Mycobacterium tuberculosis. Indeed, mutations in helix 44 (ie, the aminoglycoside binding site) are required for streptomycin resistance. Mutations in ribosomal protein S12 and/or helix 44 do not affect spectinomycin binding to helix 34.

To further explore the macromolecular basis of spectinomycin amide's inhibition of mycobacteria, macromolecular studies were carried out in mid-log phase cells of Mycobacterium bovis BCG using H ³ -leucine (GE Healthcare, LifeSciences, Piscataway, New Jersey, USA). Radiolabeled assays for protein synthesis. Protein synthesis was inhibited by 50% or more within 4 hours of adding 10-fold the MIC of 1329 or 1445. See Figure 3. The control antibiotic streptomycin also inhibits protein synthesis. This seems to suggest that spectinomycin amides act on their ribosomal targets in bacterial cells, thereby inhibiting protein synthesis.

In addition to having enhanced cellular uptake or resistance to egress mechanisms, 1329 may also be more potent than spectinomycin at the ribosomal level. Inhibition of protein synthesis by spectinomycin was tested using a commercially available cell-free E. coli S30 coupled transcription/translation system (Promega, Madison, Wisconsin, USA), which measures luciferase on E. coli ribosomes yield, and has been used previously to quantify the level activity of ribosomal inhibitor antibiotics against bacterial targets. See Murray et al ., Antimicrob. Agents Chemother., 42(4), 947-950 (1998). The concentrations of 1329 and spectinomycin that caused a 50% reduction in luciferase synthesis were found to be 0.66 μM and 0.90 μM, respectively. See Figure 4. These results suggest that 1329 is as potent as spectinomycin at the ribosomal level, but that 1329 penetrates mycobacteria better to reach its ribosomal targets.

Using the _IC50 of 1329 as a standard, the relative inhibitory activity of various other compounds was investigated at 0.66 and 6.6 [mu]M (ie, 1 and 10 times the IC50 of 1329). See Figure 5. These results indicate that these compounds inhibit the production of luciferase protein on E. coli ribosomes with varying levels of activity relative to 1329.

At 0.66 [mu]M, most of the compounds tested were not as effective as 1329. Compound 1351 was the second most potent. However, 1351 has an MIC value of 25 μg/mL, suggesting that this compound has relatively poor permeability and that selective transport into M. tuberculosis plays a major role in this series of activities. Likewise, the 3'-aminoalkyl series compounds 1420, 1422, 1423, 1424 and 1425 all inhibited well in cell-free assays, but had relatively poor anti-tuberculosis MIC activity compared with 1329, suggesting that they also had poor permeability. Benzamide compounds (1364, 1365, 1370), alkyl-substituted compounds (1421, 1369) and pyrimidine-substituted compounds (1439) were not as effective as 1329 in protein synthesis tests, suggesting that their lower antituberculosis activity was due to Poor target affinity.

To further compare the target-level activity of spectinomycinamide, the concentration of various compounds that caused a 50% reduction in luciferase synthesis (IC ₅₀ ) in the E. coli transcription/translation assay was determined. As shown in Table 6, the _IC50 of these compounds varied from 0.12-2.63 μg/mL. Compounds 1329, 1443, 1444 and 1445 all showed low IC50s comparable to _{spectinomycin} and streptomycin, suggesting that uptake of these molecules into bacterial cells was accompanied by potent inhibition of microbial protein synthesis. Compounds 1351 and 1447 also exhibited comparable low _IC50s , but their higher MICs against T. TB probably reflect reduced uptake into these cells, as described above. Taken together, these results indicate that the spectinomycin amides disclosed in the present invention are highly effective inhibitors of bacterial protein synthesis.

Table 6. Spectinomycin amide concentrations causing 50% inhibition of luciferase biosynthesis in the S30 assay

¹ Compounds with an MIC of ≤ 6.25 μg/mL for anti-tuberculosis activity and an IC ₅₀ for luciferase biosynthesis of ≤ 0.57 μg/mL are shown in bold.

From these results, it appears that the structure-activity relationship of spectinomycin-like M. tuberculosis and possibly other organisms is mediated by (i) the extent of their cellular uptake to reach their ribosomal drug targets and ( ii) The ability of the molecule to interact with key residues within the spectinomycin binding domain. The high activity of 1329, 1443 and 1445 appears to result from both high target affinity and good cellular uptake.

Example 6

Combination with other antibiotics

In some embodiments, a combination of anti-tuberculosis drugs may be effective. A standard checkered panel assay was performed to assess whether 1329, 1443 or 1445 in combination with a first-line antituberculosis drug exhibited enhanced activity against M. tuberculosis. A fractional inhibitory concentration (FIC) index of 0.5 to 4 suggests an additive effect. See Odds, FC ., J. Antimicrob. Chemother. 52, 1 (2003). Therefore, the results shown in Table 7 indicate that the combination of isoniazid, ethambutol or rifampicin with 1329 exhibits an additive effect. Therefore, the spectinomycins disclosed in the present invention seem most likely to be suitable for combination therapy with other anti-tuberculosis drugs.

Table 7. Combined treatment effect

combination FIC range 1329+ rifampicin 1-1.25 1329+ Isoniazid 1-1.5 1329+ ethambutol 1-1.5 streptomycin + rifampicin 0.62 streptomycin + isoniazid 0.62 streptomycin + ethambutol 1

Example 7

Pharmacokinetic data and in vivo activity

As with all antimicrobial drug candidates, it is important to assess the toxicity of lead compounds to ensure their selective killing of the target pathogen relative to the host cell. Therefore, the cytotoxicity of 1329 was assessed against VERO epithelial cells using the well-validated cell proliferation-based colorimetric MTT. See Hurdle et al ., J. Antimicrob. Chemother, 62(5), 1037-1045 (2008). The average cytotoxic _IC50 of spectinomycin, 1329, streptomycin and ethambutol were 1030, 2182.4, 1536.1 and 731.6, respectively. The therapeutic indices obtained by dividing the _IC50 by the MIC were 41.5, 5456, 7680.5, and 913.8, respectively, suggesting that, similar to streptomycin and ethambutol, 1329 is highly selective for killing M. tuberculosis. The poor index of unmodified spectinomycin reflects its poor anti-TB bacillus activity. To determine whether the lack of cytotoxicity was due to poor binding to mammalian ribosomes, the ability of compounds to inhibit mammalian protein synthesis was tested in rabbit reticulocytes (Promega, Madison, Wisconsin, USA). Compounds 1329, 1443 and 1445 had _IC50 's higher than the highest concentration tested (ie, >512 μg/mL). This indicates that these compounds are highly selective for bacterial ribosomes, as shown in Table 6.

The preliminary pharmacokinetic profile of 1329 (ie, Lee1329) was determined using the method described previously. See Budha et al ., The AAPS Journal, 10(1), 157-165 (2008); and Budha et al ., Curr. Med. Chem., 15(8), 809-825 (2008). After intravenous administration of 10 mg/kg in rats, 1329 produced a biexponential concentration/time curve with distinct distribution and excretion phases. See Figure 6. Plasma protein binding of the compound is approximately 30%. 1329 is widely distributed with a steady-state volume of distribution of 4.3 L/kg. It has a mean in vivo residence time of about 5.3 hours. In vitro experiments using liver microsomes suggested that 1329 is metabolically stable, with 95% of the parent drug remaining intact after 90 minutes of incubation.

Following intravenous administration in rats, 1329 had a mean systemic clearance of 0.8 L/hr/kg. The dose fraction for unchanged excretion by the kidneys was 0.46, with approximately 40% of the dose eliminated unchanged in the first 6 hours. The excretion ratio (renal clearance to glomerular filtration rate) of 1329 was 1.7, indicating filtration and active secretion as a net urinary excretion process. The molecule has a hepatic extraction rate of 0.13, indicating that 1329 can be classified as a low hepatic extraction drug.

It will be understood that changes may be made in various details of the presently disclosed subject matter without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing descriptions are for purposes of explanation only and not for purposes of limitation.

Claims (68)

1. formula (I) compound or pharmaceutically acceptable salt thereof:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

(a)�CCH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅And CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(b) heteroaryl, the heteroaryl of replacement, the phenyl of 2-halogen substiuted, the phenyl of 4-halogen substiuted ,-CH₂R₇With-CH (R₈)₂;

Wherein R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyls;

And each of which R₈Being aryl independently, it is selected from phenyl or naphthyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

2. the compound of claim 1, wherein R₃It is methyl or butyl.

3. the compound of claim 1, wherein R₄It is OH or methoxyl group.

4. the compound of claim 1, wherein R₆It is 4-fluorophenyl or 2-fluorophenyl.

5. the compound of claim 1, wherein R₆Heteroaryl, its selected from pyridine radicals, pyrimidine radicals, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

6. the compound of claim 1, wherein R₆It is CH (R₈)₂, each of which R₈It it is phenyl.

7. the compound of claim 1, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

The phenyl of wherein said replacement is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

8. the compound of claim 7, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

9. the compound of claim 7, wherein R₇Being the heteroaryl of heteroaryl defined in claim 7 or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

10. the compound of claim 7, wherein R₇Being the heteroaryl of replacement defined in claim 7, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

11. the compound of claim 10, wherein R₇Being the heteroaryl of replacement defined in claim 10, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

12. have the compound of the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂��C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, phenyl, phenyl oxygen base, C₁-C₆Acyl group; And

Each R₁₅Independently selected from H, C₁-C₆Alkyl, phenyl, wherein said phenyl is optionally replaced selected from following substituent group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkyl;

Or its officinal salt.

13. compound, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrazine-2-base) formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin; 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-fluorobenzene-1-base) formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,2-diphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-methyl] butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-(2-aminoacetylamino)-3-phenyl] propionyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-3-benzamido propanoylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-3-(2-phenylacetamido) propanoylamino spectinomycin;

Or its officinal salt.

14. the officinal salt of the formula of claim 1 (I) compound.

15. the officinal salt of claim 14, it is hydrochlorate or hydrobromate.

16. pharmaceutical preparation, it comprises:

The compound of (a) claim 1; And

(b) pharmaceutically suitable carrier.

17. the pharmaceutical preparation of claim 16, wherein said pharmaceutically suitable carrier is pharmaceutically useful in people.

18. the pharmaceutical preparation of claim 16, comprise other antimicrobial compound further.

19. the pharmaceutical preparation of claim 18, other antimicrobial compound wherein said is antitubercular compounds.

20. the pharmaceutical preparation of claim 18, other antimicrobial compound wherein said is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

21. the pharmaceutical preparation of claim 16, wherein said preparation is for orally or topically using.

22. the purposes that formula (I) compound or pharmaceutically acceptable salt thereof is in the medicine that preparation is infected for treatment antibacterial in experimenter:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

(a)�CCH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅And CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(b) heteroaryl, the heteroaryl of replacement, the phenyl of 2-halogen substiuted, the phenyl of 4-halogen substiuted ,-CH₂R₇With-CH (R₈)₂;

Wherein R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

The phenyl of wherein said replacement is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl;

And each of which R₈Being aryl independently, it is selected from phenyl or naphthyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

23. the purposes of claim 22, wherein R₃It is methyl or butyl.

24. the purposes of claim 22, wherein R₄It is OH or methoxyl group.

25. the purposes of claim 22, wherein R₆It it is 4-fluorophenyl.

26. the purposes of claim 22, wherein R₆Heteroaryl, its selected from pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

27. the purposes of claim 22, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

The phenyl of wherein said replacement is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

28. the purposes of claim 27, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

29. the purposes of claim 27, wherein R₇Being the heteroaryl of heteroaryl defined in claim 27 or replacement, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

30. the purposes of claim 27, wherein R₇Being the heteroaryl of replacement defined in claim 27, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

31. the purposes of claim 30, wherein R₇Being the heteroaryl of replacement defined in claim 30, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

32. the purposes of claim 27, wherein R₇Comprise nitrogen-containing hetero aryl, and formula (Ia) compound have the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂��C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, phenyl, phenyl oxygen base, C₁-C₆Acyl group; And

Each R₁₅Independently selected from H, C₁-C₆Alkyl, phenyl, wherein said phenyl is optionally replaced selected from following substituent group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkyl;

Or its officinal salt.

33. the purposes of claim 22, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-methyl] butyrylamino spectinomycin;

Or its officinal salt.

34. the purposes of claim 22, wherein said compound is Orally administered or local application.

35. the purposes of claim 22, wherein before using formula (I) compound, use other therapeutic compound after or during the period.

36. the purposes of claim 22, wherein said infection is gram positive bacteria infection.

37. the purposes of claim 22, wherein said infection is selected from: mycobacterial infections, infection due to Bacillus anthracis, enterococcus faecalis infect and streptococcus pneumoniae infection.

38. the purposes of claim 37, wherein said infection is infection due to Bacillus anthracis, '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin, 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin or 3 '-dihydro-3 and formula (I) compound is 3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin, or its officinal salt.

39. the purposes of claim 37, wherein said infection is streptococcus pneumoniae infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyrimidine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

Or its officinal salt.

40. the purposes of claim 37, wherein said infection is that enterococcus faecalis infects, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl)-amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

Or its officinal salt.

41. the purposes of claim 37, wherein said infection is m tuberculosis infection, and formula (I) compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

Or its officinal salt.

42. the purposes of claim 22, wherein prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below:

A () has the antibacterial of the experimenter of infection risk to infect;

B recurrence that () antibacterial infects; And

(c) its combination.

43. the purposes of claim 22, wherein use formula (I) compound and infect to treat the antibacterial existed.

44. formula (I) compound or pharmaceutically acceptable salt thereof is used for the purposes treating in the medicine of tuberculosis in experimenter in preparation:

Wherein

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₅It is C (=O) R₆, wherein R₆Selected from (a) or (b):

(a)�CCH₂NHC(CH₃)₃��-CH₂CH(CH₃)₂��-CH(NH₂)CH(CH₃)CH₂CH₃��-CH(NH₂)CH(CH₃)₂��-CH(CH₂C₆H₅) NHC (=O) CH₂NH₂��-CH₂CH₂NHC (=O) C₆H₅And CH₂CH₂NHC (=O) CH₂C₆H₅; Or

(b) heteroaryl, the heteroaryl of replacement, the phenyl of 2-halogen substiuted, the phenyl of 4-halogen substiuted ,-CH₂R₇With-CH (R₈)₂;

Wherein R₇Selected from the phenyl of aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement,

The phenyl of wherein said replacement is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyl;

And each of which R₈Being aryl independently, it is selected from phenyl or naphthyl;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

45. the purposes of claim 44, wherein R₃It is methyl or butyl.

46. the purposes of claim 44, wherein R₄It is OH or methoxyl group.

47. the purposes of claim 44, its Chinese style (I) compound is formula (Ia) compound or pharmaceutically acceptable salt thereof:

Wherein:

R₁And R₂It is H;

R₃It is the C of straight chain or side chain₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl; And

R₇Phenyl selected from aralkyl, the aralkyl of replacement, heteroaryl, the heteroaryl of replacement and replacement, the phenyl of wherein said replacement selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyl and 2,3-difluorophenyls;

Wherein said heteroaryl, the heteroaryl of replacement, aralkyl, replacement aralkyl in aryl moiety selected from pyridine radicals, pyrimidine radicals, pyrazinyl, pyridazinyl,Azoles base, furyl, triazolyl, triazine radical, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl;

Wherein said aralkyl, replacement the moieties of aralkyl be C₁-C₆Alkyl;

The heteroaryl wherein replaced and the aralkyl of replacement are replaced selected from following group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

48. the purposes of claim 47, wherein R₇Being the phenyl replaced, it is selected from 4-fluorophenyl, 4-aminomethyl phenyl, 3-aminomethyl phenyl, 3-methoxyphenyl, 2-methoxyphenyl, 3,4-methylenedioxyphenyls and 2,3-difluorophenyls.

49. the purposes of claim 47, wherein R₇Being heteroaryl or the heteroaryl of replacement of definition in claim 47, it comprises selected from following heteroaryl: pyridine radicals, triazolyl, triazine radical, pyrimidine radicals, pyridazinyl,Azoles base, furyl, benzofuranyl, thienyl, pyrrole radicals, imidazole radicals, thiazolyl, quinolyl, isoquinolyl, benzoAzoles base and benzothiazolyl.

50. the purposes of claim 49, wherein R₇Being the heteroaryl of heteroaryl or the replacement defined in claim 49, it comprises selected from following heteroaryl: pyridine radicals, thiazolyl, benzoAzoles base and benzothiazolyl.

51. the purposes of claim 49, wherein R₇Being the heteroaryl of the replacement of definition in claim 49, wherein said heteroaryl is replaced selected from following substituent group by one or more: NH₂��OH��C₁-C₆Alkyl amino, phenyl amino, nitro, halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, C₁-C₆Acyl group, phenyl and phenoxy group, wherein the phenyl moiety of phenyl amino, phenyl and phenoxy group is optionally replaced selected from following group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl and perhalogeno C₁-C₆Alkyl.

52. the purposes of claim 51, wherein R₇Being the heteroaryl of the replacement of definition in claim 51, wherein said heteroaryl is replaced selected from following substituent group by one or more: fluorine, chlorine, bromine, methoxyl group, methyl, nitro, trifluoromethoxy, phenyl amino, phenyl and trifluoromethyl.

53. the purposes of claim 47, wherein R₇Comprise nitrogen-containing hetero aryl, and formula (Ia) compound have the structure of one of formula (Ib), (Ic) or (Id):

Wherein:

R₁And R₂It is H;

R₃It is the C of straight or branched₁-C₆Alkyl;

R₄It is the C of hydroxyl or straight or branched₁-C₆Alkoxyl;

X₁It is CH or N;

X₂And X₃It is individually O, S or NH;

R₉��R₁₀��R₁₁��R₁₂��R₁₃And R₁₄Independently selected from H, halogen, hydroxyl, nitro, N (R₁₅)₂��C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, phenyl, phenyl oxygen base, C₁-C₆Acyl group; And

Each R₁₅Independently selected from H, C₁-C₆Alkyl, phenyl, wherein said phenyl is optionally replaced selected from following substituent group by one or more: halogen, C₁-C₆Alkyl, C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkoxyl, perhalogeno C₁-C₆Alkyl;

Or its officinal salt.

54. the purposes of claim 44, wherein said compound is selected from:

3 '-dihydro-3 '-deoxidation-4 (R)-(3-pyridin-3-yl) propionamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-4-fluorobenzoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-3-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-pyridine-2-formamido group spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-p-methylphenyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group-phenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3,4-(methylene-dioxy) phenyl] acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-tolyl acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridin-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazolamine-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-fluorine pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2,3-difluorophenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridazine-3-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzoAzoles-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(1H-imidazol-4 yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[3 (R)-amino-3-(4-fluorophenyl)] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(thiazol-2-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-nitropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(benzothiazole-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-phenyl] propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-bromopyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-phenyl thiazole-4-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(pyridine-2-base) propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-phenylpyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-(phenyl amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-chlorphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(quinoline-8-yl) carbonylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-(1-benzyl-1H-1,2,3-triazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((3-fluorophenyl) amino) thiazole-4-yl) acetyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethoxy) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(2-((4-(trifluoromethyl) phenyl) amino) thiazole-4-yl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(4-fluorophenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(5-(3-methoxyphenyl) pyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-chloropyridine-2-base) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(tert-butylamino) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[(2S, 3S)-2-amino-3-methyl] valeryl amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-amino-3-methyl] butyrylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-amino)-propanoylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-phenylacetamido spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methyl) butylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-dodecylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methyl) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-methoxyphenyl) acetylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-[2 (S)-aminopropionyl amino spectinomycins; And

3 '-dihydro-3 '-deoxidation-4 (R)-(2-amino) acetylamino spectinomycin;

Or its officinal salt.

55. the purposes of claim 44, wherein said compound is officinal salt.

56. the purposes of claim 55, wherein said compound is hydrochlorate or hydrobromate.

57. the purposes of claim 44, wherein said compound is Orally administered or is used by suction.

58. the purposes of claim 44, its therapeutic compound also including using other to experimenter.

59. the purposes of claim 58, other therapeutic compound wherein said is antibiotic.

60. the purposes of claim 58, other therapeutic compound wherein said is antituberculosis therapy agent.

61. the purposes of claim 58, other therapeutic compound wherein said is selected from isoniazid, ethambutol, rifampicin, kanamycin, capreomycin, Linezolid and streptomycin.

62. the purposes of claim 44, wherein prophylactically use formula (I) compound, thus the generation of prevention or minimizing one below:

A () has the m tuberculosis infection of the experimenter of infection risk;

The recurrence of (b) m tuberculosis infection; And

(c) its combination.

63. the purposes of claim 44, wherein use formula (I) compound to treat the m tuberculosis infection existed.

64. the purposes of claim 44, wherein use formula (I) compound to treat the infection of the multidrug resistance bacterial strain of mycobacterium tuberculosis.

65. the purposes of claim 44, wherein said formula (I) compound has 25 �� g/mL or less against mycobacterium tuberculosis minimal inhibitory concentration (MIC).

66. the compound selected from following:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; And

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

Or its officinal salt.

67. the compound or pharmaceutically acceptable salt thereof selected from following:

3 '-dihydro-3 '-deoxidation-4 (R)-Cyclopropyl-methyl-amino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(3-methoxyl group) benzylamino spectinomycin;

3 '-dihydro-3 '-deoxidation-4 (R)-(4-fluorine) benzylamino spectinomycin; With

3 '-dihydro-3 '-deoxidation-4 (R)-2-phenylethylcarbamate spectinomycin;

Purposes in the medicine that preparation is infected for treatment antibacterial in the experimenter having treatment to need.

68. the purposes of claim 67, it is that enterococcus faecalis infects that wherein said antibacterial infects, and 3 '-dihydro-3 that wherein said pharmaceutical pack is containing effective dose '-deoxidation-4 (R)-furan-2-base-methylamino spectinomycin or its officinal salt.