CN102533741A - Swine pseudo attp site and use of swine pseudo attp site - Google Patents
Swine pseudo attp site and use of swine pseudo attp site Download PDFInfo
- Publication number
- CN102533741A CN102533741A CN201110409456XA CN201110409456A CN102533741A CN 102533741 A CN102533741 A CN 102533741A CN 201110409456X A CN201110409456X A CN 201110409456XA CN 201110409456 A CN201110409456 A CN 201110409456A CN 102533741 A CN102533741 A CN 102533741A
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- carrier
- promotor
- seq
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a swine pseudo attp site and use of the swine pseudo attp site. More specifically, the invention relates to a separate oligonucleotide capable of being recognized by a phiC31 integrase, a vector suitable for transforming a swine cell, a group of vectors suitable for transforming the swine cell, a transgenic swine cell or a culture of the transgenic swine cell, a method for preparing the transgenic swine cell and a sequence for determining the pseudo attp site in a swine genome, wherein the separate oligonucleotide capable of being recognized by the phiC31 integrase contains a nucleotide sequence shown as SEQ ID NO:3. According to the invention, exogenous genes can be effectively imported into the swine cell under the mediation of the phiC31 integrase.
Description
Technical field
The present invention relates to technical field of bioengineering.Particularly, the present invention relates to the false attp of pig site and uses thereof.More specifically; The present invention relates to a kind of isolating can be by the oligonucleotide of Phi C 31 integrase identification; A kind of carrier that is suitable for transforming pig cell, one group of carrier that is suitable for transforming pig cell, a kind of transgenic pig cell or its culture; A kind of method for preparing the transgenic pig cell, and false attp site sequence in a kind of definite pig genome.
Background technology
Existing animal transgenic technology major part is based on random integration, and integration efficiency is low on the one hand, and is random integration, and the site is unpredictable; Heredity is unstable on the other hand, and causing easily goes down to posterity loses, and is unfavorable for cultivating stable strain; At last, the at random insertion of transgenic in host genome possibly cause the destruction or the inactivation of native gene, also possibly activate the gene of closing under some standard state, causes animal anomaly easily.These all greatly influence the application of transgenic technology.
Present animal transgenic technology still remains to be improved.
Summary of the invention
The present invention is intended to solve at least one of technical problem that exists in the prior art.For this reason, one object of the present invention is to propose a kind of means that can in pig cell, introduce foreign gene effectively.
According to a first aspect of the invention, the present invention proposes and a kind ofly isolatingly can be it is characterized in that it comprises the nucleotide sequence shown in SEQ ID NO:3 by the oligonucleotide of Phi C 31 integrase identification.Thus, the present invention proposes the false attp of boar site, it can introduce foreign gene in pig cell effectively under the mediation of Phi C 31 integrase.
According to a second aspect of the invention; The present invention proposes a kind of carrier that is suitable for transforming pig cell; It is characterized in that; Comprise: first nucleotide sequence, said first nucleotide sequence are suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3; And goal gene.Thus, utilize this carrier, can be under the mediation of Phi C 31 integrase through with the reorganization in the false attp of pig site, goal gene is incorporated in the pig cell effectively.
According to a third aspect of the invention we, the present invention proposes one group of carrier that is suitable for transforming pig cell.According to embodiments of the invention, this group carrier that is suitable for transforming pig cell comprises:
First carrier, said first carrier comprises:
First nucleotide sequence, said first nucleotide sequence are suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3; And
Goal gene,
Second carrier, said second carrier comprise the nucleotide sequence of coding Phi C 31 integrase or its functional equivalent body.
Utilization can realize goal gene is incorporated in the pig cell according to one group of carrier that is suitable for transforming pig cell of the embodiment of the invention effectively.
According to a forth aspect of the invention; A kind of transgenic pig cell of the present invention or its culture; It is characterized in that, on No. 1 karyomit(e) of said transgenic pig cell, comprise the nucleotide sequence of expression alien gene, said nucleotide sequence inserts in the said No. 1 chromosomal false attp site.Thus, can effectively utilize pig cell or its culture, expression alien gene, and can not influence the normal physiological activity of pig cell.
According to a fifth aspect of the invention, the present invention proposes a kind of method for preparing aforementioned transgenic pig cell, it is characterized in that, comprise following: use foregoing one group of carrier conversion pig cell that is suitable for transforming pig cell, so that obtain the transgenic pig cell; And separation transgenic pig cell.Utilize this method, can obtain on No. 1 karyomit(e), to comprise the transgenic pig cell of foreign gene effectively.
According to a sixth aspect of the invention, the present invention proposes the method for false attp site sequence in a kind of definite pig genome.According to embodiments of the invention, this method comprises the following steps: to prepare the transgenic pig cell according to foregoing method; The genomic dna that separates said transgenic pig cell; Use restriction enzyme that said genomic dna is carried out enzyme and cut digestion, so that obtain to have the dna fragmentation of sticky end; Said dna fragmentation is linked to each other with corresponding joint, so that obtain to connect product; Use a PCR primer sets, said connection product is carried out first pcr amplification, so that obtain first amplified production; Use the 2nd PCR primer sets, said first amplified production is carried out second pcr amplification, so that obtain second amplified production; Said second amplified production is checked order,, wherein, comprise the partial sequence in said false attp site in the said sequencing result so that obtain sequencing result; Based on said sequencing result, confirm the sequence in said false attp site.Utilize this method, can confirm the sequence in false attp site in the pig genome effectively.
Additional aspect of the present invention and advantage part in the following description provide, and part will become obviously from the following description, or recognize through practice of the present invention.
Description of drawings
Above-mentioned and/or additional aspect of the present invention and advantage obviously with are easily understood becoming the description of embodiment from combining figs, wherein:
Fig. 1 is according to one embodiment of present invention, confirms the schematic flow sheet of the method for false attp site sequence in the pig genome;
Fig. 2 is according to one embodiment of present invention, the electrophoresis photo of Splinkerette pcr amplification product, and wherein Fig. 2 A is the electrophorogram of Splinkerette PCR first round amplified production, Fig. 2 B is that Splinkerette PCR second takes turns the amplified production electrophorogram.
Embodiment
Describe embodiments of the invention below in detail, the example of said embodiment is shown in the drawings, and wherein identical from start to finish or similar label is represented identical or similar elements or the element with identical or similar functions.Be exemplary through the embodiment that is described with reference to the drawings below, only be used to explain the present invention, and can not be interpreted as limitation of the present invention.
If do not specify that employed in this article term all is the common implications understood of those skilled in the art.Employed in the present invention term " first ", " second " only are to distinguish different compositions for ease, and can not be interpreted as importance or otherwise difference by any way.
1, the false attp of pig site
According to embodiments of the invention, a kind of isolating oligonucleotide has been proposed, it comprises nucleotide sequence:
CAACCCCACAGGTGCTGGTGCTCTTCCAGAGGGGGAAGA(SEQ?ID?NO：3)。
The contriver finds that this isolating oligonucleotide can be discerned by streptomycete phage phi C31 (being also referred to as " phage phi C31 " in this article) intergrase; Thereby can be used as the core area in false attp site; Mediation is incorporated into foreign DNA in the pig genome effectively, is implemented in effectively in the pig cell to continue, express efficiently foreign gene.
According to embodiments of the invention; Both sides at above-mentioned oligonucleotide sequence as the attp core area; Can further include flanking region, the isolating oligonucleotide that promptly can be used as false attp site according to an embodiment of the invention can have following nucleotide sequences:
CCAAAATGATCAGTGTGGTCCTTTGTGTTCAAAAGGTGAGGGACTCCTCACAAGAACTTATTCCCGATCCAAATACAGAGAGGTTGGAGGAGGGGCGGTGTAGAACTCAGGGCTTTTGACTCCTCCGCAAAAGCCTCTCACCAAAAAAAGAGGGTGTTAATTTGTCCTTCCATTCAACAAACAGTGACTGAGTGCTTATTAGAGGTCCAATGAGTAGAAAATGGGAGACACAGGGACTCACAGCTGAGCAGGAAGACAGCCACATCGCTCAACAGAAAGTGACTCAGGTGAG
CAACCCCACAGGTGCTGGTGCTCTTCCAGAGGGGGAAGAGGGTTTGGGGGGGAACCTCATAAACCTTACAGTTCTTGCTTTTATGGACTATTTATTTAATGCCTATGTGTTATACTTACAAAATGTGCTTACTTTATGTTTATTTGTGTCTTTCAACTTAGGGTATTAAATTTCTCTACAATCAGCCCTTTCACTACTTTCAAACCTCTTACACCACAGCATCATTTCCCCTAGCTTGACGGTACTCAAGAAATATTTCTTTGATAATAATGACAGGTGGTTTGTACTTTTTCCACTTAGATGACAATCTCATCATAAATCCCTATTGGATTTCATTTCG(SEQ?ID?NO：2)
Wherein, the sequence that is marked in the underscore part is the nucleotide sequence of attp core area, i.e. SEQ ID NO:3.The contriver finds, by this oligonucleotide sequence, can more effectively mediate foreign DNA is incorporated in the pig genome effectively, is implemented in effectively in the pig cell to continue, express efficiently foreign gene.In addition, the contriver finds by this oligonucleotide and phage phi C31 intergrase, can foreign DNA be incorporated in No. 1 chromosomal specific site of pig genome; And be surprised to find; After foreign DNA is incorporated into this specific site, can't causes adverse influence for other genetic expressions in the pig genome, thereby can not influence the normal physiological activity of pig cell; Be convenient to pig is carried out genetic modification the research of being correlated with.
2, be suitable for transforming the carrier of pig cell
After separating the genomic attp of pig site, the contriver has proposed a kind of carrier that is suitable for transforming pig cell.Utilizing this carrier, can be goal gene with foreign DNA by pig genomic attp site and phage phi C31 intergrase effectively, is incorporated in the pig cell, and realizes effectively foreign DNA and the genomic integration of pig.Need to prove that employed in this article term " conversion " can exchange use with " transfection ", all is meant exogenous nucleic acid sequences is introduced the operation in the host cell.
According to embodiments of the invention, the carrier that is suitable for transforming pig cell comprises first nucleotide sequence and goal gene.This first nucleotide sequence is suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3.Thus, utilize this carrier, can be under the mediation of Phi C 31 integrase through recombinating with the false attp of pig site, thereby, can effectively goal gene be incorporated in the pig cell.
Broad understanding should be made in employed in this article term " carrier "; It can be anyly can nucleotide sequence be introduced the media in the pig cell; Including but not limited to plasmid, clay, virus, artificial chromosome, both can be the annular carrier, also can be wire; Both can be strand, also can be double-stranded.According to embodiments of the invention, preferred bearer type is a plasmid.
According to embodiments of the invention, the concrete sequence of first nucleotide sequence does not receive special restriction, as long as it can with the sequence shown in SEQ ID NO:2 or the SEQ ID NO:3 reorganization take place under the mediation of Phi C 31 integrase.According to one embodiment of present invention, said first nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO:4.The contriver finds that the sequence shown in the SEQ ID NO:4 can be recombinated with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3 effectively.Thus, can improve the efficient that reorganization takes place in the false attp of first nucleotide sequence and pig site effectively, goal gene is incorporated into the efficient in the pig cell thereby improve.
According to embodiments of the invention, this carrier can further include add ons, thereby can obtain, to give its additional function and effect.
According to one embodiment of present invention, this embodiment may further include the nucleotide sequence of coding selection markers.Thus, the pig cell that changes this carrier over to can be screened effectively, thus, the efficient of preparation transgenic cell can be improved.According to example of the present invention, the type of selection markers does not receive special restriction.According to examples more of the present invention, selection markers can be for being selected from least a of the proteic gene of encoded luminescent, drug resistance gene.Thus, can screen the pig cell of introducing carrier easily, for example through detecting luminous intensity and in substratum, adding corresponding medicine.According to concrete example of the present invention, luminescent protein can be for being selected from least a of GFP and EGFP.Thus, can successfully be introduced in the pig cell through detecting the green fluorescence that is sent, screening with checking carrier.According to concrete example of the present invention, said drug resistance gene is be selected from neomycin phosphotransferase and HYG resistant gene at least a.Thus, can be through in substratum, adding corresponding microbiotic, the cell under survival after the cultivation is carrier-containing pig cell.Thus, can carry out the screening of transgenic cell easily, further improve the efficient of preparation transgenic cell.
According to one embodiment of present invention, this carrier can further comprise promotor, and promotor can be operably connected with goal gene.Here broad understanding should be made in employed term " connection ", can also can link to each other indirectly for passing through media for directly linking to each other.The meaning of " exercisable connection " is meant that promotor can be brought into play its normal biological function, thereby influences the expression of goal gene.According to embodiments of the invention, the type of the promotor that can adopt does not receive special restriction.According to examples more of the present invention, said promotor can be the eukaryotic cell promotor.According to concrete example of the present invention, more preferably said eukaryotic cell promotor is be selected from CAG promotor and PGK promotor at least a.According to a concrete example of the present invention, most preferably said eukaryotic cell promotor is the CAG promotor.Thus, can improve the expression efficiency of goal gene in pig cell.The contriver is surprised to find, and when adopting the CAG promotor, can improve the expression of goal gene in pig cell significantly.According to other embodiments of the invention, said eukaryotic cell promotor is a tissue-specific promoter.Thus, can select suitable promotor, thereby obtain to realize the tissue specific expression of goal gene according to the type of pig cell.
According to one embodiment of present invention, this carrier can further comprise intron (Intron) sequence, and wherein, intron Intron sequence is operably connected with goal gene.Thus, can further improve the expression efficiency of goal gene in pig cell.According to embodiments of the invention, the type of intron does not receive special restriction.
3, one group of carrier that is suitable for transforming pig cell
In order to improve the conversion pig cell, express the efficient of goal gene, the invention allows for one group of carrier that is suitable for transforming pig cell.According to embodiments of the invention, this group carrier that is suitable for transforming pig cell comprises first carrier and second carrier.According to embodiments of the invention, first carrier comprises: first nucleotide sequence, said first nucleotide sequence are suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in the SEQ ID NO:3; And goal gene.According to embodiments of the invention, second carrier comprises the nucleotide sequence of coding Phi C 31 integrase or its functional equivalent body.Thus; After first carrier and second carrier all are incorporated into pig cell; Second carrier can be expressed Phi C 31 integrase or its functional equivalent body in cell, recombinate thereby can mediate first nucleotide sequence and the genomic false attp of the pig site that are comprised in first carrier, thereby the goal gene that first carrier is entrained is incorporated in the pig cell; And integrate with the pig genome, the specific site introducing foreign DNA that is implemented in the pig cell genome is a goal gene.Employed in this article " functional equivalent body " refers to and can bring into play similar function with Phi C 31 integrase; The protein of the false attp of mediation purpose first nucleotide sequence and pig genome site (in this article, also the false attp of pig genome site being abbreviated as " the false attp of pig site " sometimes) reorganization.
Facing first carrier and second carrier down is described in detail:
According to embodiments of the invention, the concrete sequence of first nucleotide sequence does not receive special restriction, as long as it can with the sequence shown in SEQ ID NO:2 or the SEQ ID NO:3 reorganization take place under the mediation of Phi C 31 integrase.According to one embodiment of present invention, said first nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO:4.The contriver finds that the sequence shown in the SEQ ID NO:4 can be recombinated with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3 effectively.Thus, can improve the efficient that reorganization takes place in the false attp of first nucleotide sequence and pig site effectively, goal gene is incorporated into the efficient in the pig cell thereby improve.
According to embodiments of the invention, the concrete sequence of the nucleotide sequence of coding Phi C 31 integrase or its functional equivalent body does not receive special restriction, as long as its coded product can mediate first nucleotide sequence and reorganization takes place in the false attp of pig site.According to one embodiment of present invention, said second carrier comprises the nucleotide sequence shown in SEQ ID NO:5.The contriver finds that this can significantly improve introduces the efficient in the pig genome with goal gene.
For the ease of utilizing these carriers to transform pig cell, first carrier and second carrier can also have other element respectively, to give its additional function and effect.
According to one embodiment of present invention, said first carrier further comprises the nucleotide sequence of first selection markers of encoding.According to embodiments of the invention, said selection markers is be selected from the proteic gene of encoded luminescent, drug resistance gene at least a.According to concrete example of the present invention, said luminescent protein is be selected from GFP and EGFP at least a, and said drug resistance gene is be selected from neomycin phosphotransferase and HYG resistant gene at least a.According to one embodiment of present invention, said second carrier further comprises the nucleotide sequence of second selection markers of encoding.According to embodiments of the invention, said second selection markers is be selected from the proteic gene of encoded luminescent, drug resistance gene at least a.According to concrete example of the present invention, said luminescent protein is be selected from GFP and EGFP at least a, and said drug resistance gene is be selected from neomycin phosphotransferase and HYG resistant gene at least a.About the effect of selection markers, describe in detail in front, repeat no more.According to embodiments of the invention, first selection markers can be different with second selection markers.Thus, can realize accepting effective check of first carrier and second carrier simultaneously.
According to one embodiment of present invention, first carrier may further include first promotor.This first promotor is operably connected with goal gene.According to embodiments of the invention, first promotor can be the eukaryotic cell promotor.According to examples more of the present invention, the eukaryotic cell promotor can be the CAG promotor.According to concrete example of the present invention, the eukaryotic cell promotor can be tissue-specific promoter.According to one embodiment of present invention, first carrier may further include first enhancer sequence, and said first enhancer sequence is operably connected with said goal gene.According to one embodiment of present invention, second carrier may further include second promotor.This second promotor is operably connected with the nucleotide sequence of coding Phi C 31 integrase or its functional equivalent body.According to embodiments of the invention, second promotor can be the eukaryotic cell promotor.According to examples more of the present invention, the eukaryotic cell promotor is the CAG promotor.According to concrete example of the present invention, the eukaryotic cell promotor is a tissue-specific promoter.Thus, can improve Phi C 31 integrase or the expression efficiency of its functional equivalent body in pig cell effectively, goal gene introduced the efficient in the pig genome thereby further improve.According to one embodiment of present invention, second carrier may further include second enhancer sequence.This second enhancer sequence is operably connected with said goal gene.Thus, can further improve Phi C 31 integrase or the expression efficiency of its functional equivalent body in pig cell, goal gene introduced the efficient in the pig genome thereby further improve.About promotor and enhanser, the front is described in detail, repeats no more.
4, transgenic pig cell or its culture and preparation method thereof
According to embodiments of the invention; The present invention proposes a kind of transgenic pig cell or its culture; It is characterized in that, on No. 1 karyomit(e) of said transgenic pig cell, comprise the nucleotide sequence of expression alien gene, said nucleotide sequence inserts in the said No. 1 chromosomal false attp site.Thus, can effectively utilize pig cell or its culture, expression alien gene, and can not influence the normal physiological activity of pig cell.According to embodiments of the invention, No. 1 chromosomal false attp of pig site has oligonucleotide sequence shown in SEQ ID NO:3 as core area.According to a particular embodiment of the invention; This transgenic pig cell is through by false attp site of pig genome and phage phi C31 intergrase; It is that false attp site obtains that foreign DNA is incorporated in No. 1 chromosomal specific site of pig genome, and is surprised to find, after foreign DNA is incorporated into this specific site; Other genetic expressions in the pig genome can't cause adverse influence; Thereby can not influence the normal physiological activity of pig cell, be convenient to pig is carried out genetic modification the research of being correlated with.Broad understanding should be done in employed in this article term " culture "; It can be meant transgenic cell resulting product after keeping certain hour under the state that is suitable for surviving; Operation during this time also can experimentize; For example culture can be that transgenic cell is carried out resulting product after the enlarged culturing, also can be the transgenic pig that obtains through manual cloning process, also can be from this transgenic cell differentiation or dedifferentes cell, tissue, the organ or individual that obtains.
In addition, according to another aspect of the invention, the present invention proposes a kind of method for preparing aforementioned transgenic pig cell and comprise following: use foregoing one group of carrier conversion pig cell that is suitable for transforming pig cell, so that obtain the transgenic pig cell; And separation transgenic pig cell.About described one group of carrier that is suitable for transforming pig cell, promptly foregoing first carrier and second carrier are described in detail in front, repeat no more.The contriver finds, utilizes this method, can obtain on No. 1 karyomit(e), to comprise the transgenic pig cell of foreign gene effectively.And be surprised to find; Through this method; After foreign DNA is incorporated into genomic No. 1 karyomit(e) of pig, can't causes adverse influence for other genetic expressions in the pig genome, thereby can not influence the normal physiological activity of pig cell; Be convenient to pig is carried out genetic modification the research of being correlated with.
Employed in this article term " conversion " can exchange use with " transfection ", all is meant exogenous nucleic acid sequences is introduced the operation in the host cell.According to embodiments of the invention; The order that first carrier and second carrier are introduced in the cell does not receive special restriction, can be to be introduced in simultaneously in the cell, and also can be to be incorporated in the cell successively; Both first carrier can be introduced earlier, also second carrier can be introduced earlier.According to embodiments of the invention, utilize first carrier and the said pig cell of the second carrier cotransformation.Promptly simultaneously first carrier and second carrier are incorporated in the pig cell.According to embodiments of the invention, realize utilizing the method for first carrier and the second carrier cotransformation not receive special restriction.According to a particular embodiment of the invention, can carry out said cotransformation through liposome method.Thus, can improve the efficient that trans-utilization first carrier and second carrier transform pig cell.In addition, the ratio of amount that is used to transform first carrier and second carrier of pig cell does not receive special restriction.According to embodiments of the invention, the mass ratio of first carrier and second carrier is 1: 1～5, preferred 1: 1.Thus, can realize higher cotransformation efficient, and can further improve goal gene is incorporated on No. 1 karyomit(e) of pig genome, thereby realize the stable expression that continue of goal gene in pig cell.
5, confirm the method for false attp site sequence in the pig genome
According to another aspect of the invention, the present invention proposes the method for false attp site sequence in a kind of definite pig genome.According to embodiments of the invention, with reference to figure 1, this method comprises the following steps:
S100: prepare the transgenic pig cell according to foregoing method; Promptly through will comprise can with the carrier of the nucleotide sequence of attp site reorganization, and the carrier cotransformation pig cell that comprises the Nucleotide of coding phage phi C31 intergrase obtains the transgenic pig cell; About how utilizing two kinds of carriers to transform pig cell; Obtain the transgenic pig cell, the front is described in detail, repeats no more.
S200: after obtaining the transgenic pig cell, from the transgenic pig cell, separate the genomic dna of transgenic pig cell.According to embodiments of the invention, the method for isolation of genomic DNA from cell does not receive special restriction, can use business-like test kit to carry out the extraction of genomic dna.
S300: behind the genomic dna that separates the transgenic pig cell, use restriction enzyme that resulting genomic dna is carried out enzyme and cut digestion, so that obtain to have the dna fragmentation of sticky end.Cut digestion through utilizing restriction enzyme that resulting genomic dna is carried out enzyme, can genomic dna be carried out fragmentation, thereby can obtain comprising the fragment that reorganization takes place.And have digestion with restriction enzyme at the end of resulting dna fragmentation and handle formed sticky end.According to embodiments of the invention, be used to carry out enzyme and cut the type and the quantity of the restriction enzyme of processing and do not receive special restriction.According to one embodiment of present invention, the said restriction enzyme combination that is BamH I and Bgl II.Thus; Can from the pig genome, isolate the fragment that contains the attp site effectively; In addition, the contriver is surprised to find, and carries out enzyme when the combination of adopting BamH I and Bgl II and cuts when digesting; The length of resulting dna fragmentation is suitable for follow-up operation, can be not long or too short and can't analyze.
S400: after obtaining dna fragmentation, can resulting dna fragmentation be linked to each other with corresponding joint, so that obtain to connect product.Owing to using restriction enzyme to carry out after enzyme cuts digestion, resulting dna fragmentation, it has sticky end, thereby can have with the corresponding joint of sticky end through use and be connected with this dna fragmentation.Here employed term " corresponding joint " refers to this joint and has the overhang that the sticky end with dna fragmentation is complementary, thereby, can utilize conventional means, this joint is connected with resulting dna fragmentation, so that follow-up operation.According to embodiments of the invention, the sequence of joint does not receive special restriction, can handle formed sticky end according to digestion with restriction enzyme and select corresponding joint.For example, carry out enzyme when the combination of adopting BamH I and Bgl II and cut when digesting, can adopt so a kind of joint.This joint is made up of first oligonucleotide chain and second oligonucleotide chain, and wherein, first oligonucleotide chain has the oligonucleotide sequence shown in SEQ ID NO:6, and second oligonucleotide chain has the oligonucleotide sequence shown in SEQ ID NO:7.Thus, can further improve the joint efficiency of joint and dna fragmentation, thereby further improve the efficient of confirming false attp site sequence.This joint can pass through to carry out anneal, and form after synthetic respectively first oligonucleotide chain and second oligonucleotide chain.
S500: after obtaining to connect product, through using a PCR primer sets, said connection product is carried out first pcr amplification, so that obtain first amplified production.Wherein, a PCR primer sets comprises first primer and second primer, said first primer specificity identification joint, and said second primer specificity is discerned first nucleotide sequence.Thus, can obtain to contain the amplified production of the false attp sequence of part effectively.According to concrete example of the present invention; When adopting the joint that constitutes by the oligonucleotide sequence shown in SEQ ID NO:6 and 7; And adopt when comprising first nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:4, said first primer has the nucleotide sequence shown in SEQ ID NO:8; And said second primer has the nucleotide sequence shown in SEQ ID NO:9.The contriver finds, adopts and should organize the PCR primer, can more effectively increase to connecting product.
S600: carrying out first pcr amplification, obtaining after first amplified production, using the 2nd PCR primer sets; Said first amplified production is carried out second pcr amplification; So that obtain second amplified production, wherein, the 2nd PCR primer sets comprises three-primer and the 4th primer; Said three-primer specific recognition joint, said the 4th primer specificity is discerned said first nucleotide sequence.Thus, can further improve the specificity of pcr amplification.When, said first primer has the nucleotide sequence shown in SEQ ID NO:8; And said second primer is when having the nucleotide sequence shown in SEQ ID NO:9, and preferred said three-primer has the nucleotide sequence shown in SEQ ID NO:10; Said the 4th primer has the nucleotide sequence shown in SEQ ID NO:11.
S700: after obtaining second amplified production, second amplified production is checked order, so that obtain sequencing result.Owing to comprise the partial sequence in the false attp of pig genome site in second amplified production, thereby comprise the partial sequence in said false attp site in the sequencing result.Method for amplified production checks order does not receive special restriction.According to embodiments of the invention, can pass through amplified production is connected with plasmid, and check order through the sequencing primer of plasmid.Thus, can obtain the sequence information of amplified production quickly and easily.
S800: owing to comprise the partial sequence in said false attp site in the sequencing result.Thereby, can confirm the sequence in false attp site based on this sequencing result at last.According to embodiments of the invention, after obtaining sequencing result, confirm that the sequence in false attp site may further include:, confirm the position of false attp site in the pig genome at first based on said sequencing result.For example can sequencing result be carried out the BLAST retrieval, locate false attp site in the chromosomal approximate region of genomic which number of pig.Next; Based on phage attp site sequence (SEQ ID NO:12:ACTGACGGACACACCGAAGCCCCGGCGGCAACCCTCAGCGGATGCCCCGG GGCTTCACGTTTTCCCAGGTCAGAAGCGGTTTTCGGGAGTAGTG
CGTAGGGTCGCCGACATGACACAAGGGGTTGTGACCGGGGTGGACACGTACGCGGG TGCTTACGACCGTCAGTCGCGCGAGCGCGA (black line partly is a core sequence)) and the position of said false attp site in the pig genome, confirm the sequence in said false attp site.For example can the phage attp site sequence and the sequence of the approximate region in determined false attp site before be compared, thereby can further improve the efficient of confirming false attp site sequence.
Confirm the sequence in said false attp site.Thus, can further improve the efficient of confirming false attp site sequence.
With reference to specific embodiment, the present invention will be described below, need to prove, these embodiment only are illustrative, and can not be interpreted as limitation of the present invention.
If do not specialize, the conventional means that the technique means that is adopted among the embodiment is well known to those skilled in the art can carry out with reference to " molecular cloning experiment guide " third edition or related prods, and the reagent that is adopted and product also are can commercial acquisition.
Embodiment 1, contain the structure of the pCMV-Int carrier of streptomycete phage Phi C 31 integrase gene
(1) synthetic streptomycete phage phi C31 integrase gene (Int gene): with the sequence shown in the SEQ ID NO:5; Submitting to Shanghai JaRa bio tech ltd to carry out the Int gene synthesizes; The synthetic Int of institute is gene constructed on the pGH carrier, obtain the pGH-Int plasmid.
(2) enzyme is cut the pGH-Int plasmid: get pGH-Int plasmid 20 microlitres (400-500ng/ul) and carry out enzyme and cut, the enzyme system of cutting is:
| The pGH-Int plasmid | 20 microlitres |
| 10xNEB?buffer2 | 5 microlitres |
| Restriction endonuclease NheI | 1 microlitre |
| Restriction endonuclease XhoI | 1 microlitre |
| 100xBSA | 0.5 microlitre |
| Distilled water | 22.5 microlitre |
| Total reaction volume | 50 microlitres. |
The above-mentioned enzyme system of cutting is placed under 37 ℃, and enzyme is cut and is spent the night.
(3) enzyme is cut the pcDNA3.1 plasmid: get pcDNA3.1 plasmid 10 microlitres and carry out enzyme and cut (400-500ng/ul), the enzyme system of cutting does
| The pcDNA3.1 plasmid | 10 microlitres |
| 10x_NEB?buffer2 | 5 microlitres |
| Restriction endonuclease NheI | 1 microlitre |
| Restriction endonuclease XhoI | 1 microlitre |
| 100x?BSA | 0.5 microlitre |
| Distilled water | 32.5 microlitre |
| Total reaction volume | 50 microlitres. |
The above-mentioned enzyme system of cutting is placed under 37 ℃, and enzyme is cut and is spent the night.
(4) fragment reclaims: the enzyme with the recovery of ZYMO RESEARCH test kit is cut the pGH-Int plasmid from enzyme is cut the fragment that contains the Int gene that reclaims 1.8kb the product;
With the carrier framework fragment behind the ZYMO RESEARCH test kit recovery pcDNA3.1 plasmid enzyme restriction.
(5) fragment connects acquisition pCMV-Int carrier: adopt the T4 ligase enzyme to be connected Int gene fragment that reclaims and pcDNA3.1 carrier framework fragment; Linked system is: pcDNA3.1 carrier framework fragment 1 microlitre; Int gene fragment 2 microlitres, T4 damping fluid 1 microlitre, T4 ligase enzyme 0.1 microlitre; Distilled water 5.9 microlitres, always connecting volume is 10 microlitres.4 ℃ of connections of spending the night.
(6) use connection product pCMV-Int carrier transformed into escherichia coli (E.coli) competent cell, and increase, reclaim purifying, obtain the pCMV-Int plasmid.
The structure of embodiment 2, pattB-CAG-Intron-EGFP carrier
(1) attB and Intron gene fragment are synthetic: it is synthetic to submit to Shanghai JaRa bio tech ltd to carry out gene sequence Intron (intron) sequence and the attB sequence shown in SEQ ID NO:4; Institute's synthetic gene is structured in respectively on the pGH carrier, obtains pGH-attB and pGH-Intron plasmid respectively.Wherein, the NCBI of employed intron is AF369966.1, and the sequence total length does
CGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTGGGAT(SEQ?ID?NO：13)。The applicant finds, through introducing this intron sequences, can significantly increase the stability and enhancing expression of exogenous gene of the exogenous gene expression of its back.
(2) enzyme is cut pGH-attB, pGH-Intron, pEGFP-N1 plasmid respectively: get plasmid 20 microlitres respectively and carry out enzyme and cut; The enzyme system of cutting is: plasmid 20 microlitres; Damping fluid 5 microlitres, each 1 microlitre of restriction endonuclease (pGH-attB, pGH-Intron, pEGFP-N1 plasmid are carried out enzyme to be cut the restriction endonuclease that is adopted and be respectively: BglII and MfeI, EcoRI and AgeI, HindIII and NotI), BSA0.5 microlitre; Distilled water 22.5 microlitres, total reaction volume 50 microlitres.The above-mentioned enzyme system of cutting is placed under 37 ℃, and enzyme is cut and is spent the night.
(3) enzyme is cut the pCAG carrier: get pCAG plasmid 10 microlitres and carry out enzyme and cut, the enzyme system of cutting is: pCAG plasmid 10 microlitres, 2 damping fluids, 5 microlitres, each 1 microlitre of restriction endonuclease (BglII and MfeI), BSA 0.5 microlitre, distilled water 32.5 microlitres, total reaction volume 50 microlitres.The above-mentioned enzyme system of cutting is placed under 37 ℃, and enzyme is cut and is spent the night.
(4) fragment reclaims: cut attB fragment, the Intron fragment of 508bp and the EGFP fragment of 768bp that product reclaims 306bp from the enzyme of pGH-attB, pGH-Intron, pEGFP-N1 respectively with ZYMO RESEARCH test kit; Reclaim the carrier framework fragment after pCAG carrier enzyme is cut with the ZYMORESEARCH test kit.
(5) connect: at first, be connected acquisition pattB-CAG carrier with the pCAG skeleton utilizing restriction endonuclease BglII and MfeI enzyme to cut to handle the attB fragment that obtains.Then restriction endonuclease EcoRI and AgeI enzyme are cut and handled the Intron fragment that obtains and be connected acquisition pattB-CAG-Intron carrier with the pattB-CAG carrier framework.Then, again restriction endonuclease HindIII is cut resulting EGFP fragment with the NotI enzyme and be connected, obtain the pattB-CAG-Intron-EGFP carrier with the pattB-CAG-Intron carrier framework.
(6) use connection product pattB-CAG-Intron-EGFP carrier transformed into escherichia coli competent cell, and increase, obtain the pattB-CAG-Intron-EGFP plasmid.
Embodiment 3, cell transfecting and screening
Pig renal epithelial cell PK15 clone is inoculated into 6 orifice plates with 30% density, and culturing cell to degree of converging is 70-80%, the beginning transfection.
(1) transfection: the pattB-CAG-Intron-EGFP plasmid of gained among the pCMV-Int plasmid of gained among the embodiment 1 and the embodiment 2 with different ratio mixed, is used liposome LF2000 test kit, according to the operation instructions that manufacturers provided, transfection PK15 cell.
(2) two plasmid percentage effects are explored: the constant mass with the pattB-CAG-Intron-EGFP plasmid is 1 microgram; Through the quality of choosing the pCMV-Int plasmid is 1 microgram, 2 micrograms, 3 micrograms, 4 micrograms, 5 micrograms; Realization is with the different ratio transfection PK15 cells of pattB-CAG-Intron-EGFP: pCMV-Int according to 1: 1,1: 2,1: 3,1: 4,1: 5; Fluorescence radiation intensity through detecting EGFP is judged the The Best Mixed ratio; Fluorescence radiation intensity was the strongest when its result was the two 1: 1 ratio corotation, so the two 1: 1 ratio corotation effect is best.
(3) screening: behind the transfection 24h cell is used tryptic digestion; On average be inoculated in 6 48 orifice plates and carry out the G418 screening; Behind the inoculation 24h, adopt the substratum [15%FBS (calf serum) and 85%DMEM] that contains 500 micrograms/ml G418 to cultivate screening, every subculture that changed at a distance from 1 day.Adopt 10 days left and right sides negative cells of G418 screening of medium all dead, the positive cell formation single cell clone of growing up, and can see and be green-emitting fluorescence.
(4) positive cell enlarged culturing: treat positive cell after 48 holes cover with, adopt 0.25% tryptic digestion to be passaged to 24 orifice plate enlarged culturing (substratum is 89%DMEM, 10%FBS, 1%Gln) it; Treat positive cell after 24 holes cover with, adopt 0.25% tryptic digestion to be passaged to 6 orifice plate enlarged culturing it.
Embodiment 4, goal gene integration efficiency are investigated
In the positive colony of anti-G418; Be not that all goal gene all takes place are integrated in the genome; Some is the promptly anti-G418 of false positive but do not express goal gene, and therefore the cell that fluoresces (expressing EGFP) through statistics is cloned in the integration efficiency that ratio in all anti-G418 cell clones is investigated goal gene.Through the integration efficiency of identifying goal gene is 69.7%.
The clone in embodiment 5, the false attP of pig genome site
(1) positive cell clone that the transfection screening is obtained is extended to 6 orifice plates and collects with tryptic digestion afterwards, adopts TIANGEN culturing cell total DNA extraction test kit, according to the specification sheets that manufacturers provided, extracts cell genomic dna.
(2) Splinkerette pcr amplification carrier flanking sequence:
At first synthetic following oligonucleotide:
SPLNK-GATC-TOP (first chain of Splink joint):
GATCCCACTAGTGTCGACACCAGTCTCTAATTTTTTTTTTCAAAAAAA(SEQ?ID?NO：6)
SPLNK-BOT (second chain of Splink joint):
CGAAGAGTAACCGTTGCTAGGAGAGACCGTGGCTGAATGAGACTGGTGTCGACAC?TAGTGG(SEQ?ID?NO：7)
SPLNK-1 (specific recognition Splink joint): CGAAGAGTAACCGTTGCTAGGAGAGACC (SEQ ID NO:8)
SPLNK-2 (specific recognition Splink joint): GTGGCTGAATGAGACTGGTGTCGAC (SEQ ID NO:9)
AttB-1 primer (specific recognition attB): ATTCGGCTTGGCTGTCGACATG (SEQ ID NO:10)
AttB-2 primer (specific recognition attB): GCCGTGACCGTCGAGAACCC (SEQ ID NO:11)
(b) preparation Splink joint.First chain and second chain through with the Splink joint carry out anneal, the Splink joint that acquisition can be used to connect.The annealing reaction system is:
SPLNK-BOT (150ng/ μ l) 50 microlitres,
SPLNK-GATC-TOP (150ng/ μ l) 50 microlitres,
10X NEB damping fluid 2:100 microlitre,
H
2O 800 microlitres,
TV 1000 microlitres.
Annealing conditions is: 95 degrees centigrade 3 minutes, room temperature was placed 30 minutes then.
(C) the positive cell genomic dna is screened in transfection and carries out enzyme and cut,
The enzyme system of cutting is:
Genomic dna (40ng/ μ l) 25 microlitres,
H
2O 1 microlitre,
10X BSA3.5 microlitre,
10XNEB damping fluid 3.5 microlitres,
BamH1 1 microlitre,
BglII 1 microlitre,
TV 35 microlitres.
The above-mentioned enzyme system of cutting is placed under 37 ℃, and enzyme is cut and is spent the night.
(d) enzyme of (c) is cut product and is connected with the annealing product of (b),
The ligation system is:
Enzyme is cut DNA 35 microlitres,
H
2O 2.5 microlitres,
10XNEB ligase enzyme damping fluid 5 microlitres,
Annealing product 6 μ l,
NEB T4DNA ligase enzyme (400U/ microlitre) 1.5 microlitres,
TV 50 microlitres.
Incubated at room was carried out ligation 2 hours.
(e) the Splinkerette PCR first round is increased reaction system:
The connection product of step (d) (20ng/ microlitre) 1 microlitre,
5 * UltraPFTMBuffer (no mg ion), 5 microlitres,
10 * MgSO
4(20mM) 2.5 microlitres,
DNTP 0.5 microlitre,
AttB-1 primer 0.5 microlitre,
SPLNK-1 primer 0.5 microlitre,
UltraPFTMDNA polysaccharase 1U,
H
2O 15.5 microlitres,
TV 25 microlitres.
Reaction conditions: 98 degrees centigrade of 1min, (98 degrees centigrade of 10sec, 62 degrees centigrade of 30sec, 72 degrees centigrade of 1min) 30 circulations of X, 72 degrees centigrade of 10min, 4 ℃ of end.Fig. 2 A has shown the electrophorogram of Splinkerette PCR first round amplified production.
(f) Splinkerette PCR second takes turns amplification,
Reaction system:
First round amplified production DNA 1 microlitre,
5 * UltraPFTMBuffer (no mg ion), 5 microlitres,
10 * MgSO
4(20mM) 2.5 microlitres,
DNTP 0.5 microlitre,
AttB-2 primer 0.5 microlitre,
SPLNK-2 primer 0.5 microlitre,
UltraPFTMDNA polysaccharase 1U,
H
2O 15.5 microlitres,
TV 25 microlitres.
Reaction conditions: 98 degrees centigrade of 1min, (98 degrees centigrade of 10sec, 62 degrees centigrade of 30sec, 72 degrees centigrade of 1min) 30 circulations of X, 72 degrees centigrade of 10min, 4 ℃ of end.Fig. 2 B is that Splinkerette PCR second takes turns the amplified production electrophorogram.Can find out that from Fig. 2 B and Fig. 2 A through two-wheeled PCR reaction, the specificity of amplification obviously is enhanced.
The order-checking and the analysis of embodiment 6, the false attP of pig genome site side series
The PCR product of (1) step (f) Splinkerette PCR second among the embodiment 5 being taken turns the amplification gained carries out agarose gel electrophoresis, and fragment is cut glue, and the specification sheets that adopts the agarose dna gel to reclaim test kit to provide according to manufacturers carries out fragment and reclaims.
(2) will reclaim fragment and be connected with the pEASY-Blunt carrier, the ligation system is: the PCR product reclaims fragment 4 microlitres, T carrier 1 microlitre, and T4 ligase enzyme 1 microlitre, T4 cushions 2 microlitres, distilled water 1 microlitre, TV 10 microlitres.Above-mentioned reaction system is placed 4 degrees centigrade, and connection is spent the night.
(3) will connect product transformed into escherichia coli competent cell; And increase; Be applied to then on the agarose solid medium and cultivate, obtain mono-clonal, the picking mono-clonal adopts; And pEASY-Blunt carrier universal primer identifies whether successful connection, changes the bacterium colony of confirming successful connection over to the LB substratum and increases.
(4) the connection product sample presentation that will identify successful connection and amplification checks order, and sequencing result is following:
ATGCCAAGAAGCATGACGGCAAGTGGACGATTGCCGTGACCGTCGAGAACCCGCTGACGCTGCCCCGCGTATCCGCACCCGCCGACGCCGTCGCACGTCCCGTGCTCACCGTGACCACCGCGCCCAGCGGTTTCGAGGGCGAGGCTCTTCCCCCTCTGGAAGAGCACCAGCACCTGTCCACTAGTGTCGACACCAGTCTCATTCAGCCACA(SEQ?ID?NO：1)。
(5) sequential analysis; Sequence shown in the sequencing result NO.1 is at first contrasted with the known carrier sequence; Confirm the part known array that comprises extension increasing sequence in the sequencing result and contain attB; Compare with the pig genome sequence of having delivered (Sus scofa) through BLAST (http://www.ensembl.org/Multi/blastview) in the Ensembl website then; Find to comprise No. 1 chromosomal partial sequence of pig in the sequencing result shown in the SEQ ID NO:1, and obtain the sequence shown in the SEQ ID NO:2.Next; Sequence shown in the SEQ ID NO:2 and known phage attP site core sequence CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG (SEQ ID NO:14) are compared, and the core sequence that obtains the genomic false attP of pig site is CAACCCCACAGGTGCTGGTGCTCTTCCAGAGGGGGAAGA (SEQ ID NO:3).The core sequence in the genomic false attP of this pig site is compared with the core sequence in phage attP site has 39% homology, suitable with the homology of attP core with other species.
Thus; The false attP site sequence that the contriver finds in the pig genome can fix a point to insert under the effect of Phi C 31 integrase with the entrained external source goal gene of attB sequence; Thereby external source goal gene site-directed integration in the pig genome, is improved the efficient of site-directed integration.Just method is used to prepare the transgenic pig of efficient fixed point, makes it obtain the transgenic pig that stability and high efficiency is expressed.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means the concrete characteristic, structure, material or the characteristics that combine this embodiment or example to describe and is contained at least one embodiment of the present invention or the example.In this manual, the schematic statement to above-mentioned term not necessarily refers to identical embodiment or example.And concrete characteristic, structure, material or the characteristics of description can combine with suitable manner in any one or more embodiment or example.
Although illustrated and described embodiments of the invention; Those having ordinary skill in the art will appreciate that: under the situation that does not break away from principle of the present invention and aim, can carry out multiple variation, modification, replacement and modification to these embodiment, scope of the present invention is limited claim and equivalent thereof.
Claims (10)
1. one kind isolatingly can be is characterized in that it comprises the nucleotide sequence shown in SEQ ID NO:3 by the oligonucleotide of Phi C 31 integrase identification.
2. oligonucleotide according to claim 1 is characterized in that, it comprises the nucleotide sequence shown in SEQ ID NO:2.
3. a carrier that is suitable for transforming pig cell is characterized in that, comprising:
First nucleotide sequence, said first nucleotide sequence are suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3; And
Goal gene,
Randomly, said first nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO:4,
Randomly; The nucleotide sequence that further comprises the selection markers of encoding; Said selection markers is preferably and is selected from least a of the proteic gene of encoded luminescent, drug resistance gene; Said luminescent protein is preferably and is selected from least a of GFP and EGFP, and said drug resistance gene is preferably and is selected from least a of neomycin phosphotransferase and HYG resistant gene
Randomly, further comprise promotor, said promotor is operably connected with said goal gene; Said promotor is preferably the eukaryotic cell promotor; Said eukaryotic cell promotor is preferably the CAG promotor, and said alternatively eukaryotic cell promotor is a tissue-specific promoter
Randomly, further comprise enhancer sequence, said enhancer sequence is operably connected with said goal gene.
4. one group of carrier that is suitable for transforming pig cell is characterized in that, comprising:
First carrier, said first carrier comprises:
First nucleotide sequence, said first nucleotide sequence are suitable under the mediation of Phi C 31 integrase, recombinating with the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3; And
Goal gene,
Second carrier, said second carrier comprise the nucleotide sequence of coding Phi C 31 integrase or its functional equivalent body,
Randomly, said first nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO:4,
Randomly; Said first carrier further comprises the nucleotide sequence of first selection markers of encoding; Said selection markers is preferably and is selected from least a of the proteic gene of encoded luminescent, drug resistance gene; Said luminescent protein is preferably and is selected from least a of GFP and EGFP, and said drug resistance gene is preferably and is selected from least a of neomycin phosphotransferase and HYG resistant gene;
Randomly; Said second carrier further comprises the nucleotide sequence of second selection markers of encoding; Said second selection markers is preferably and is selected from least a of the proteic gene of encoded luminescent, drug resistance gene; Said luminescent protein is preferably and is selected from least a of GFP and EGFP, and said drug resistance gene is preferably and is selected from least a of neomycin phosphotransferase and HYG resistant gene
Randomly, said first selection markers is different with said second selection markers,
Randomly; Said first carrier further comprises first promotor; Said first promotor is operably connected with said goal gene, and said first promotor is preferably the eukaryotic cell promotor, and said eukaryotic cell promotor is preferably the CAG promotor; Said alternatively eukaryotic cell promotor is a tissue-specific promoter
Randomly, said first carrier further comprises first enhancer sequence, and said first enhancer sequence is operably connected with said goal gene,
Randomly, said second carrier comprises the nucleotide sequence shown in SEQ ID NO:5,
Randomly; Said second carrier further comprises second promotor; Said second promotor is operably connected with the nucleotide sequence of said coding Phi C 31 integrase or its functional equivalent body, and said second promotor is preferably the eukaryotic cell promotor, and said eukaryotic cell promotor is preferably the CAG promotor; Said alternatively eukaryotic cell promotor is a tissue-specific promoter
Randomly, said second carrier further comprises second enhancer sequence, and said second enhancer sequence is operably connected with said goal gene.
5. a transgenic pig cell or its culture is characterized in that, on No. 1 karyomit(e) of said transgenic pig cell, comprise the nucleotide sequence of expression alien gene, and said nucleotide sequence inserts in the said No. 1 chromosomal false attp site.
6. transgenic pig cell according to claim 5 or its culture is characterized in that, the core area in said false attp site has the oligonucleotide sequence shown in SEQ ID NO:3.
7. a method for preparing claim 5 or 6 described transgenic pig cells is characterized in that, comprises following:
Use the described one group of carrier conversion pig cell that is suitable for transforming pig cell of claim 3; So that obtain the transgenic pig cell; Preferably utilize said first carrier and the said pig cell of the said second carrier cotransformation, randomly carry out said cotransformation through liposome method; And
Separate the transgenic pig cell.
8. method according to claim 7 is characterized in that, the mass ratio of said first carrier and said second carrier is 1: 1～5, preferred 1: 1.
9. the method for false attp site sequence in the definite pig genome is characterized in that, comprises the following steps:
Prepare the transgenic pig cell according to claim 7 or 8 described methods;
The genomic dna that separates said transgenic pig cell;
Use restriction enzyme that said genomic dna is carried out enzyme and cut digestion, so that obtain to have the dna fragmentation of sticky end;
Said dna fragmentation is linked to each other with corresponding joint, so that obtain to connect product;
Use a PCR primer sets, said connection product is carried out first pcr amplification, so that obtain first amplified production; Wherein, The one PCR primer sets comprises first primer and second primer, said first primer specificity identification joint, and said second primer specificity is discerned said first nucleotide sequence;
Use the 2nd PCR primer sets; Said first amplified production is carried out second pcr amplification; So that obtain second amplified production, wherein, the 2nd PCR primer sets comprises three-primer and the 4th primer; Said three-primer specific recognition joint, said the 4th primer specificity is discerned said first nucleotide sequence;
Said second amplified production is checked order,, wherein, comprise the partial sequence in said false attp site in the said sequencing result so that obtain sequencing result;
Based on said sequencing result, confirm the sequence in said false attp site,
Randomly, said restriction enzyme is the combination of BamH I and Bgl II,
Randomly; Said joint is made up of first oligonucleotide chain and second oligonucleotide chain, and wherein, said first oligonucleotide chain has the oligonucleotide sequence shown in SEQ ID NO:6; Said second oligonucleotide chain has the oligonucleotide sequence shown in SEQ ID NO:7
Randomly, said first primer has the nucleotide sequence shown in SEQ ID NO:8; And
Said second primer has the nucleotide sequence shown in SEQ ID NO:9,
Randomly, said three-primer has the nucleotide sequence shown in SEQ ID NO:10; And
Said the 4th primer has the nucleotide sequence shown in SEQ ID NO:11.
10. method according to claim 9 is characterized in that, based on said sequencing result, confirms that the sequence in said false attp site further comprises:
Based on said sequencing result, confirm the position of said false attp site in the pig genome; And
Based on phage attp site sequence and the said false attp site position in the pig genome, confirm the sequence in said false attp site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110409456.XA CN102533741B (en) | 2011-12-09 | 2011-12-09 | Swine pseudo attp site and use of swine pseudo attp site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110409456.XA CN102533741B (en) | 2011-12-09 | 2011-12-09 | Swine pseudo attp site and use of swine pseudo attp site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102533741A true CN102533741A (en) | 2012-07-04 |
| CN102533741B CN102533741B (en) | 2014-09-24 |
Family
ID=46341773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110409456.XA Active CN102533741B (en) | 2011-12-09 | 2011-12-09 | Swine pseudo attp site and use of swine pseudo attp site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533741B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001016345A2 (en) * | 1999-08-30 | 2001-03-08 | Droege Peter | Sequence-specific dna recombination in eukaryotic cells |
| CN101157934A (en) * | 2007-09-20 | 2008-04-09 | 复旦大学 | Gene clone plasmid based on Phi BT1 integrase and Phi C31 integrase |
| CN101624592A (en) * | 2008-07-11 | 2010-01-13 | 上海市儿童医院 | Bovine genome pseudo-attP site and application thereof |
-
2011
- 2011-12-09 CN CN201110409456.XA patent/CN102533741B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001016345A2 (en) * | 1999-08-30 | 2001-03-08 | Droege Peter | Sequence-specific dna recombination in eukaryotic cells |
| CN101157934A (en) * | 2007-09-20 | 2008-04-09 | 复旦大学 | Gene clone plasmid based on Phi BT1 integrase and Phi C31 integrase |
| CN101624592A (en) * | 2008-07-11 | 2010-01-13 | 上海市儿童医院 | Bovine genome pseudo-attP site and application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102533741B (en) | 2014-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11225649B2 (en) | Engineered nucleic-acid targeting nucleic acids | |
| CA3111432A1 (en) | Novel crispr enzymes and systems | |
| AU2020272668B2 (en) | Integration of nucleic acid constructs into eukaryotic cells with a transposase from oryzias | |
| US20200291395A1 (en) | Novel crispr-associated transposon systems and components | |
| JP2020507347A (en) | High fidelity CAS9 variants and their uses | |
| CN109072207A (en) | Improved method for modifying target nucleic acid | |
| US20200318135A1 (en) | Transposition of nucleic acid constructs into eukaryotic genomes with a transposase from amyelois | |
| CN103068995A (en) | Direct cloning | |
| CN108130342A (en) | Plant Genome fixed point edit methods based on Cpf1 | |
| CN116334037A (en) | Novel Cas enzymes and systems and uses | |
| EP3730616A1 (en) | Split single-base gene editing systems and application thereof | |
| WO2019173248A1 (en) | Engineered nucleic acid-targeting nucleic acids | |
| JP7233545B2 (en) | Cell selection methods based on CRISPR/Cas-controlled incorporation of detectable tags into target proteins | |
| JP2017029159A (en) | Compositions and methods for creating altered and improved cells and organisms | |
| CN102533741B (en) | Swine pseudo attp site and use of swine pseudo attp site | |
| US20170121723A1 (en) | Transformation method of sugar beet protoplasts by talen platform technology | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| CN115948397A (en) | sgRNA and CRISPR/Cas9 system for targeted knockout of chicken TET2 gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Yong Inventor after: Liu Huan Inventor after: Zhang Huanhuan Inventor after: Liu Chuxin Inventor after: Du Yutao Inventor after: Wang Jun Inventor after: Wang Jian Inventor after: Yang Huanming Inventor before: Li Yong Inventor before: Liu Huan Inventor before: Zhang Huanhuan Inventor before: Zhang Chuxin Inventor before: Du Yutao Inventor before: Wang Jun Inventor before: Wang Jian Inventor before: Yang Huanming |
|
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 518083 Complex Building of Beishan Industrial Zone, Yantian Street, Yantian District, Shenzhen City, Guangdong Province Co-patentee after: BGI SHENZHEN Co.,Ltd. Patentee after: BGI SHENZHEN Address before: Beishan Industrial Zone Building in Yantian District of Shenzhen city of Guangdong Province in 518083 Co-patentee before: BGI SHENZHEN Co.,Ltd. Patentee before: BGI SHENZHEN |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191216 Address after: 518120 A205, Peng Fei Road, Dapeng street, Dapeng New District, Shenzhen, Guangdong, China, 7 Patentee after: Shenzhen Huada Gene Agriculture Holding Co.,Ltd. Address before: 518083 Complex Building of Beishan Industrial Zone, Yantian Street, Yantian District, Shenzhen City, Guangdong Province Co-patentee before: BGI SHENZHEN Co.,Ltd. Patentee before: BGI SHENZHEN |