CN102533668B - Duck flavivirus, and vaccine and kit thereof - Google Patents

Abstract

The invention belongs to the field of bioengineering and discloses duck flavivirus. The amino acid sequence of an envelope protein E is shown as SEQ ID NO:4 or the homology of the amino acid sequence which is shown as the SEQ ID NO:4 is over 98 percent. The invention also discloses vaccine for preventing duck flavivirus, and a kit for detecting duck flavivirus; a new virus of duck flavivirus disease which causes output reduction and death of laying duck are separated and identified by various detection means, a method for diagnosing duck flavivirus disease is established, the vaccine for duck flavivirus disease is developed, important basis and means are provided for preventing duck flavivirus, and relative duck flavivirus diseases which cause the output reduction and death of laying duck can be prevented and diagnosed by using the vaccine and a diagnostic reagent which are developed by using the virus.

Description

A kind of duck flavivirus and vaccine thereof, test kit

Technical field:

The invention belongs to bioengineering field, relate in particular to a kind of virus, is a kind of duck flavivirus and vaccine thereof, test kit specifically.

Background technology:

China is a Ge Yang fowl big country, aviculture fast development, and the year number of animals raised of poultry has reached 12,000,000,000 plumages, occupies first place in the world.The proportion of the economy of aviculture in national economy rises gradually, and its economy accounts for a big chunk of farmers' income.As can be seen here, the healthy state of bird has a very important effect to the development of Chinese national economy and the stable of society.In recent years, China aquatic bird aquaculture is continuing steady-state growth always.According to Food and Argriculture OrganizationFAO (FAO), add up, the year of China duck, goose raise total amount and reached nearly 5,000,000,000 plumages, duck, goose annual production reach 5,500,000 tons, the more than 75% of Jun Zhan world total amount, and the consumption proportion of the aquatic bird such as duck, goose meat, egg is also in continuous rising, and China has become the first in the world aquatic bird cultivation big country and consumption big country.Although China aquatic bird number of animals raised was at increase year after year in recent years; mass-producing, industrialization management level also obtain fast lifting; but aquatic bird cultural technique is relatively backward; especially the generation of aquatic bird transmissible disease; cause the mortality of aquatic bird cultivation high; cause China's aquatic bird industry to be lost up to tens billion of yuans every year, become and perplexing the restraining factors that China's aquatic bird aquaculture develops in a healthy way.

The foster duck industry of China faces the serious threat of multiple communicable disease.Since in April, 2010, first in Shanghai, the ground such as Zhejiang and the Jiangsu death of egg duck and the egg drop reduction that by unknown virus, are caused that occur, cause the egg duck field of nearly all (except kind duck) all to suffer tremendous economic loss.This sick cardinal symptom is that egg duck occurs that appetite is absolutely useless, and egg drop reduction even stops, and causes egg duck Mortality, and mortality ratio can reach 5%～10%.Through cuing open the sick duck of inspection, find that this disease is take spleen enlargement as manifest symptom, morbidity liver in early stage has extravasated blood sample to become, and the hemorrhage serious meeting of later stage liver is with tip-like white spotty necrosis.This disease constantly spreads in China, and there is breaking out of this disease main Dan Ya production area, the whole nation at present.

Summary of the invention:

The object of the present invention is to provide a kind of duck flavivirus and vaccine thereof, test kit, described this duck flavivirus and vaccine thereof, test kit will solve in prior art egg duck is occurred to appetite is absolutely useless, egg drop reduction even stops, and causes the phenomenon treatment of egg duck Mortality and the limited technical problem of means of prevention.

The invention provides a kind of duck flavivirus, the aminoacid sequence of its membranin M gene as shown in SEQ ID NO:2 or with the homology of the aminoacid sequence shown in SEQ ID NO:2 more than 98%.

Further, the nucleotide sequence of its membranin M gene as shown in SEQ ID NO:1 or with the homology of the nucleotide sequence shown in SEQID NO:1 more than 98%.

Further, the aminoacid sequence of its envelope protein E protein gene as shown in SEQ ID NO:4 or with the homology of the aminoacid sequence shown in SEQ ID NO:4 more than 98%.

Further, the nucleotide sequence of its envelope protein E protein gene as shown in SEQ ID NO:3 or with the homology of the nucleotide sequence shown in SEQ ID NO:3 more than 98%.

Further, the aminoacid sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:6 or with the homology of the aminoacid sequence shown in SEQ ID NO:6 more than 98%.

Further, the nucleotide sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:5 or with the homology of the nucleotide sequence shown in SEQ ID NO:5 more than 98%.

The present invention also provides a kind of duck flavivirus, the aminoacid sequence of its envelope protein E protein gene as shown in SEQ ID NO:4 or with the homology of the aminoacid sequence shown in SEQ ID NO:4 more than 98%.

Further, the nucleotide sequence of its envelope protein E protein gene as shown in SEQ ID NO:3 or with the homology of the nucleotide sequence shown in SEQ ID NO:3 more than 98%.

Further, the aminoacid sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:6 or with the homology of the aminoacid sequence shown in SEQ ID NO:6 more than 98%.

Further, the nucleotide sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:5 or with the homology of the nucleotide sequence shown in SEQ ID NO:5 more than 98%.

The present invention also provides a kind of duck flavivirus, the aminoacid sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:6 or with the homology of the aminoacid sequence shown in SEQ ID NO:6 more than 98%.

Further, the nucleotide sequence of its Nonstructural Protein NS5 protein gene as shown in SEQ ID NO:5 or with the homology of the nucleotide sequence shown in SEQ ID NO:5 more than 98%.

The present invention also provides a kind of duck flavivirus, and its preserving number is: CCTCC NO.V201032.

The present invention also provides a kind of antibody, and it is produced by above-mentioned a kind of duck flavivirus immunity.

The present invention also provides a kind of antibody, anti-above-mentioned duck flavivirus antigen.

The present invention also provides a kind of diagnostic reagent, contains above-mentioned antibody.

The present invention also provides a kind of DNA molecular, its nucleotide sequence as shown in SEQ ID NO:1 or with the homology of the nucleotide sequence shown in SEQ ID NO:1 more than 98%.

The present invention also provides a kind of DNA molecular coded protein, its aminoacid sequence as shown in SEQ IDNO:2 or with the homology of the aminoacid sequence shown in SEQ ID NO:2 more than 98%.

The present invention also provides a kind of DNA molecular, its nucleotide sequence as shown in SEQ ID NO:3 or with the homology of the nucleotide sequence shown in SEQ ID NO:3 more than 98%.

The present invention also provides a kind of DNA molecular coded protein, its aminoacid sequence as shown in SEQ IDNO:4 or with the homology of the aminoacid sequence shown in SEQ ID NO:4 more than 98%.

The present invention also provides a kind of DNA molecular, its nucleotide sequence as shown in SEQ ID NO:5 or with the homology of the nucleotide sequence shown in SEQ ID NO:5 more than 98%.

The present invention also provides a kind of DNA molecular coded protein, its aminoacid sequence as shown in SEQ IDNO:6 or with the homology of the aminoacid sequence shown in SEQ ID NO:6 more than 98%.

The present invention also provides a kind of carrier, containing just like the nucleotide sequence shown in SEQ ID NO:1 or with the nucleotide sequence of homology more than 98% shown in SEQ ID NO:1.

The present invention also provides a kind of carrier, containing just like the nucleotide sequence shown in SEQ ID NO:3 or with the nucleotide sequence of homology more than 98% shown in SEQ ID NO:3.

The present invention also provides a kind of carrier, containing just like the nucleotide sequence shown in SEQ ID NO:5 or with the nucleotide sequence of homology more than 98% shown in SEQ ID NO:5.

The present invention also provides a kind of carrier, the albumen of its expression is containing just like the aminoacid sequence shown in SEQ ID NO:2 or SEQ IDNO:4 or SEQ ID NO:6, or with the homology of the aminoacid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 more than 98%.

The present invention also provides a kind of vaccine, contains above-mentioned carrier.

The present invention also provides a kind of vaccine, the above-mentioned a kind of duck flavivirus that contains deactivation.

The present invention also provides a kind of vaccine, contains the above-mentioned a kind of duck flavivirus that causes weak or attenuation.

The present invention also provides a kind of test kit that detects above-mentioned duck flavivirus, contain pair of primers and probe, the sequence of one of them primer is as shown in SEQ ID NO:7, and the sequence of another one primer is as shown in SEQ ID NO:8, and the sequence of described probe is as shown in SEQ ID NO:11.

The present invention also provides the test kit of the above-mentioned duck flavivirus of another kind of detection, contain pair of primers and probe, the sequence of one of them primer is as shown in SEQ ID NO:9, and the sequence of another one primer is as shown in SEQ IDNO:10, and the sequence of described probe is as shown in SEQ ID NO:12.

Further, 5 ' flag F AM fluorescence report group of described probe, 3 ' end TAMRA fluorescent quenching group.

A kind of duck flavivirus of the present invention, its preserving number is CCTCC NO.V201032, Classification And Nomenclature is Flavivirus Tembusu virus (101 strains of duck flavivirus Fengxian), this preservation is in Chinese Typical Representative culture collection center (CCTCC), the address at Chinese Typical Representative culture collection center is: Luojiashan, Wuchang, Wuhan City, Hubei Province (Wuhan University), preservation date is on December 8th, 2010.

The present invention adopts various analyzing and testing means, separate, identified the virus of the initiation egg duck underproduction that a strain is new and dead Duckling flavivirus disease, and its biological characteristics has been made and having been studied in great detail, obtain the Main Biological of this cause of disease and main gene order, set up for this sick diagnostic method, develop for this sick vaccine, for the control of Duckling flavivirus disease provides important evidence and means, utilize the vaccine of these virus research and development and diagnostic reagent can prevent and diagnose the relevant Duckling flavivirus disease that causes the underproduction of egg duck and death.

Accompanying drawing explanation:

Fig. 1 shown after duck flavivirus infected chicken embryo, causes that idiosome is hemorrhage, the phenomenon of oedema.

Fig. 2 has shown the electrophoresis picture of virogene and RNase and DNase digestion product, and a virogene is processed through RNase, and b virogene is processed through DNase, and c is without the virogene of enzyme processing.

Fig. 3 is that PCR identifies electrophorogram.

Fig. 4 is the Electronic Speculum picture of virus particle.

Fig. 5 has shown and has attacked the pathological change of malicious duck spleen, wherein A group and the obvious enlargement of B group duck spleen, and it is obviously unchanged that C organizes duck.

Fig. 6 shown and attacked the pathological change only of malicious duck, and A shows spleen lymphocyte necrosis; B shows liver hyperemia, hemorrhage, hepatic necrosis; C shows kidney hemorrhagic disease, renal cells necrosis; D shows Pulmonary hemorrhage, lymphocytic infiltration.

Fig. 7 is that fluorescence quantitative RT-RCR detects, and A is viral kinetic curve, and B is viral typical curve.

Fig. 8 is virus (PRRSV) TaqMan PCR method susceptibility test amplification curve diagram.

Fig. 9 has shown the typical curve of ELISA reagent.

Figure 10 is duck flavivirus strain isolated of the present invention and Tembusu virus N S5 gene nucleotide series comparison diagram.

Figure 11 is duck flavivirus strain isolated of the present invention and Tembusu virus N S5 Argine Monohydrochloride sequence comparison diagram.

Figure 12 is duck flavivirus of the present invention Fengxian 101 strain heredity derivation analytical results figure.

Embodiment:

Embodiment 1 pathogen separation

Get the spleen tissue of morbidity duck, add 1ml PBS (containing the Streptomycin sulphate of 100 unit penicillin and 50ug) to grind.After centrifugal, get supernatant, after the degerming of 0.2um filter, inoculation SPF chicken embryo.Discard chicken embryo dead in 24h; Dead chicken embryo after collection 24h, visible chorioallantoic membrane thickens, idiosome general hemorrhage (seeing Fig. 1); Collect respectively allantoic fluid, chicken embryo idiosome and chorioallantoic membrane thereof.

The evaluation of embodiment 2 viruses main location in chicken embryo

Get idiosome leach liquor and allantoic fluid respectively by ten doubling dilutions to 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, each titre 100ul, through 3 piece of 9 age in days SPF chicken embryo of allantoic cavity inoculation, is put in 37 ℃ of incubators and hatches, and observes and record chicken embryo death situation.Found that this virus is mainly present in chicken embryo idiosome and chorioallantoic membrane thereof, the viral level in allantoic fluid only has 1/10th of above-mentioned position.

Embodiment 3 virus amplification

After the idiosome of collecting and chorioallantoic membrane thereof grind, centrifuging and taking supernatant liquor after multigelation three times,, is put in 37 ℃ of incubators and hatches through 40 piece of 9 age in days SPF chicken embryo of allantoic cavity inoculation with ten times of sterilizing PBS dilutions.Discard chicken embryo dead in 24h; 48-120h after inoculation, chicken embryo is all dead; Collect respectively chicken embryo idiosome, chorioallantoic membrane and allantoic fluid thereof.

The purifying of embodiment 4 viruses

The idiosome of collecting and chorioallantoic membrane are fully ground and make suspension, multigelation three times.Adopt sucrose density gradient centrifugation purified virus, operation steps is as follows: 1), with 7500rpm high speed centrifugation 30min, obtain supernatant, then with 10000rpm high speed centrifugation 30min, obtain supernatant.2) by gained supernatant with 40000rpm ultracentrifugation 2h, will precipitate and dissolve with 10ml STE.3) the above-mentioned virus liquid dissolving through STE that first adds respectively 5ml to obtain in the ultracentrifugation pipe of two 38ml, then with minute hand head, from centrifuge tube bottom, add successively 30%, 45%, 60% sucrose solution, with 40000rpm ultracentrifugation 2.5h, result can be found a band clearly between 45% and 60%, draws the liquid of this band to the ultracentrifugation pipe of 38ml.4) remove sucrose: by the virus of STE damping fluid dilution purifying,, then with 40000rpm ultracentrifugation 3h, gained precipitation is dissolved with 2mlSTE damping fluid, is purified virus liquid.

Embodiment 5 viruses are identified

The evaluation of 5.1 cause of disease nucleic acid types

Virus concentrated purifying is extracted to viral RNA with QIAGEN RNeasy plus mini Kit, and 5ulRNA extract adds 37 ℃ of incubation 30min of 1ulRNase (20mg/ul); DNase digestion: 10 × buffer 1ul, RNase Inhibitor 0.5ul, DNase I 1ul, H20 (RNase-free) 2.5ul, RNA extract 5ul, 37C incubation 30min.As shown in Figure 2, through DNase digestion after product and all visible electrophoretic bands of viral genome, and the product digesting through RNase is without electrophoretic band for electrophoresis result.Analyzing known this virus is RNA viruses.

The PCR of 5.2 cause of diseases identifies

Utilize M-MLV ThermoScript II (Takara company) and random primer by viral RNA reverse transcription, take reverse transcription product as template, utilize respectively the Auele Specific Primer of avian influenza virus, Avian pneumo-encephalitis virus, the sick virus of RE hyperplasia, I type duck hepatitis virus, reovirus, parvovirus, birnavirus to carry out pcr amplification, PCR result is negative (figure slightly) all.Take reverse transcription product as template, the PCR primer special with duck flavivirus increases, and product, by agarose gel electrophoresis, can obtain special 250bp and the band of 300bp, sees Fig. 3.

The electron microscopic observation of 5.3 virus particle

Certain density virus liquid is through phosphoric acid tungsten negative staining, observes with JEM2100 transmission electron microscope.In this experimental result, under visible mirror, virus particle size is about 50nm, is shaped as icosahedron ball-like structure (Fig. 4).

The evaluation of 5.4 virus envelopes

Get the idiosome leach liquor of 1ml gained, add the analytically pure chloroform of 50ul, be placed in 4 ℃ of vibrations and mix 10min, 500rpm subsequently, centrifugal 5min, draws supernatant, and ten doubling dilutions are 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, each titre is got 100ul through 3 pieces of instar chicken embryos on the 9th of allantoic cavity inoculation, hatches observed and recorded chicken embryo death situation in 37 ℃ of incubators; Control group adds the physiological saline of same volume, processes equally and titration.Experimental result demonstration, chloroform is processed virus and is lost infection ability, and therefore, this virus has cyst membrane.

The genome sequence determination of 5.5 viruses

By purified virus, extract viral RNA with QIAGEN RNeasy plus mini Kit, utilize the cDNA Larbrary Construction Kit test kit construction cDNA library of Takara company, from library, take out part bacterium liquid, coat on LB/Amp Agar Plating and cultivate, random choose bacterial clone, after extracting plasmid, check order, utilize Seqman software (DNASTAR) to splice, remove after host's (chicken embryo) gene order, obtain this viral gene order.The nucleotide sequence of duck flavivirus membranin M gene is as shown in SEQID NO:1, the aminoacid sequence of duck flavivirus membranin M gene is as shown in SEQ ID NO:2, the nucleotide sequence of duck flavivirus Envelope Protein Gene E is as shown in SEQ ID NO:3, the amino acid acid sequence of duck flavivirus Envelope Protein Gene E is as shown in SEQ ID NO:4, the nucleotide sequence of duck flavivirus nonstructural protein gene NS5 is as shown in SEQ ID NO:5, and the amino acid acid sequence of duck flavivirus nonstructural protein gene NS5 is as shown in SEQ ID NO:6.

By studying the genetic evolution of relative conservative gene NS5, find that the homology of Tembusu virus in 101 strains of duck flavivirus Fengxian and flaviviridae Flavivirus is the highest, the nucleotide sequence homology of the two NS5 gene is 88.3%, sees Figure 10.The amino acid sequence homology of the two NS5 albumen is 95.7%, sees Figure 11.Flavivirus different virus strain isolated is carried out to evolutionary analysis, find that two strain virus sibships are nearest, on systematic evolution tree, drop in same branch, see Figure 12.Therefore, 101 strains of duck flavivirus of the present invention Fengxian are variation strains of Tembusu virus.

E albumen of the present invention is the main immunizing antigen of duck flavivirus, and therefore the foundation of vaccine development, diagnosis and antibody detection method is main relevant to the albumen of E genetic expression.We not only can contain the utilization duck flavivirus strain isolated consistent with the sequence SEQ ID NO:4 of our report, also can utilize to contain with us and report that sequence SEQ ID NO:4 homology is higher than 98% strain and at 4 of E protein 14s, 218 and 381 flavivirus strain isolateds consistent with the corresponding amino acid of sequence SEQ ID NO:4, develop inactivated vaccine, by Attenuation or artificial constructed infections clone, cause weak attenuated vaccine, and set up PCR, Real-time PCR, ELISA and fine jade and expand diagnostic method.Utilize expression vector, express the E albumen consistent with the sequence SEQ ID NO:4 of our report; Or express with us and report that sequence SEQ ID NO:4 homology is higher than 98% E albumen, this albumen while is at 144,218 albumen consistent with the corresponding amino acid of sequence SEQ ID NO:4 in annex with 381; And express the consistent or homology of 10 of partial continuous virus sequences 4 with upper amino acid and our report more than 98% and contain with annex sequence SEQ ID NO:4 in nucleotide sequence corresponding to the peptide sequence of one of 144,218 and 381 corresponding amino acid develop DNA vaccination, vector-viral vaccine (comprising paramyxovirus vector, poxvirus vector, adenovirus carrier, herpesvirus vector, baculovirus etc.) and prokaryotic expression and develop polypeptide vaccine.

Gene M is another immunizing antigen of duck flavivirus, not only can utilize and contain the duck flavivirus strain isolated consistent with the virus sequence SEQ ID NO:2 of our report, also can utilize contain with we report sequence SEQ ID NO:2 homology higher than 98% strain and also in 38, M albumen and 72 and annex the consistent flavivirus strain isolated of the corresponding amino acid of sequence SEQ ID NO:2, develop inactivated vaccine, by Attenuation or artificial constructed infections clone, cause weak attenuated vaccine, and set up PCR, Real-time PCR, ELISA and fine jade and expand diagnostic method.Utilize expression vector, express the M albumen consistent with the sequence SEQ ID NO:2 of our report; Or express and we report that sequence SEQ ID NO:2 homology is higher than 98% M albumen, 38 consistent albumen of amino acid corresponding to sequence in annex 2 72 of this albumen; And express the consistent or homology of 10 of partial continuous virus sequences 2 with upper amino acid and our report more than 98% and contain with annex sequence SEQ ID NO:2 in nucleotide sequence corresponding to the peptide sequence of one of 38 and 72 corresponding amino acid develop DNA vaccination, vector-viral vaccine (comprising paramyxovirus vector, poxvirus vector, adenovirus carrier, herpesvirus vector, baculovirus etc.) and prokaryotic expression and develop polypeptide vaccine.

Duck flavivirus nonstructural protein gene NS5 is relatively conservative, in virus replication, plays an important role.We not only can utilize contains the duck flavivirus strain isolated consistent with the virus sequence 6 of report, also can utilize contain with we report sequence SEQ ID NO:6 homology higher than 98% strain and also in NS5 protein 18 position, 131 and 247 and annex the consistent flavivirus strain isolated of the corresponding amino acid of sequence SEQ ID NO:6, develop inactivated vaccine, by Attenuation or artificial constructed infections clone, cause weak attenuated vaccine, and set up PCR, Real-time PCR, ELISA and fine jade and expand diagnostic method.Utilize expression vector, express the NS5 albumen consistent with the sequence SEQ ID NO:6 of our report; Or express with us and report that sequence 6 homologys are higher than 98% NS5 albumen, this albumen while is at 18,131 albumen consistent with the corresponding amino acid of sequence SEQ ID NO:6 in annex with 247; And express the consistent or homology of 10 of partial continuous virus sequences 6 with upper amino acid and our report more than 98% and contain with annex sequence SEQ IDNO:6 in nucleotide sequence corresponding to the peptide sequence of one of 18,131 and 247 corresponding amino acid develop DNA vaccination, vector-viral vaccine (comprising paramyxovirus vector, poxvirus vector, adenovirus carrier, herpesvirus vector, baculovirus etc.) and prokaryotic expression and develop polypeptide vaccine.

Embodiment 6 Animal Models

Get healthy sheldrake in nine week age, be divided into tri-groups of A, B and C, 10 every group.A group: 10 ⁴eLD ₅₀virus 100ul direct oral cavity infects, and normally raises; B group: 10 ⁴eLD ₅₀virus 100ul infects through intramuscular injection, normally raises; C organizes in contrast.Visible A and B group duck spirit are depressed two days later, and food consumption reduces; C group duck is asymptomatic.Attack after poison the 4th day every group cut open respectively three of inspections, A group and B organize duck liver surface obvious point-like ecchymosis, or white needle point sampling point shape necrosis region; The obvious enlargement of spleen, surface is piebald shape.C group duck is without this type of pathological change.Fig. 5 is shown in by the spleen picture of A and B group duck, and Fig. 6 is shown in pathological change.Titration of virus finds that this virus can copy in the tissues such as duck liver, spleen, lungs, tracheae, kidney and brain, produces higher virus titer.

A little less than the causing of embodiment 7 viruses

The idiosome of collecting and the aseptic grinding of chorioallantoic membrane are made to suspension, and the centrifugal 45min of 10000rpm, gets its supernatant for virus weakening.

A little less than 7.1 cells cause: 1) dilute this supernatant to 10 with sterilizing PBS ^-2, get 100ul and be added on well-grown CEF cell, be put in 37 ℃ of cell culture incubator internal adsorption 1～2h, with PBS, wash once subsequently, to wash the not virus of absorption off, rejoin fresh medium and be placed in 37 ℃ containing 5%CO ₂cell culture incubator in cultivate.2) after 48h, draw cell conditioned medium same method and make viruses adsorption in another well-grown CEF cell, be put in 37 ℃ containing 5%CO ₂cell culture incubator in cultivate.3) after 20 generations of continuous passage to the, results, containing viral cell conditioned medium liquid, are diluted to 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, three piece of 9 age in days SPF chicken embryo of each titre inoculation, is put in 37 ℃ of incubators and hatches, and discards chicken embryo dead in 24h; Remove the chicken embryo of non-specific death, collect dead chicken embryo, calculate ELD ₅₀, a little less than result shows that virus is significantly caused through going down to posterity on CEF cell after 20 times.

7.2 chicken embryos cause weak method: 1) by 100 times of viral suspension supernatant dilutions, through 10 piece of 9 age in days SPF chicken embryo of allantoic cavity inoculation, be put in 37 ℃ of incubators and hatch, discard chicken embryo dead in 24h, remove the chicken embryo of non-specific death, collect dead chicken embryo.2) get dead chick embryo allantoic liquid, after mixing by above-mentioned same method and serum, again inoculate 10 piece of 9 age in days SPF chicken embryo, be put in 37 ℃ of incubators and hatch, discard chicken embryo dead in 24h, remove the chicken embryo of non-specific death, collect dead chicken embryo, be more than 30 generations of continuous passage.

Idiosome and chorioallantoic membrane supernatant after 7.3 viral virulence experiment collecting cell supernatants or grinding, infect laying ducks in 26 week age, check virus weakening situation.Be divided into tri-groups of A, B and C, 10 every group.A group: 10 ⁴eLD ₅₀cell attenuated virus 100ul infects through intramuscular injection, normally raises; B group: 10 ⁴eLD ₅₀chicken embryo attenuated virus 100ul infects through intramuscular injection, normally raises; C organizes in contrast.All duck food consumptions are normal two days later, have no spirit depressed, and A group and B group egg productivity slightly decline; C group duck is asymptomatic.Attack after poison the 4th day every group cut open respectively three of inspections, A group and B organize duck liver and have no obvious pathology; Not enlargement of spleen.Titration of virus finds that virus has and necessarily copies in the tissues such as duck spleen and digestive tube, and virus titer is lower.

7.4 attenuated vaccine developments: after the virus a little less than above-mentioned causing is bred on corresponding SPF chicken embryo or cell, centrifugal removal impurity, packing after mixing with protective material, freeze-drying on Freeze Drying Equipment, for developing attenuated vaccine.By < < veterinary biologics standard > >, carry out attenuated vaccine development.

The preparation of embodiment 8 inactivated vaccines

8.1 virus multiplication

After the idiosome of collecting and chorioallantoic membrane thereof are ground, centrifuging and taking supernatant liquor after multigelation three times,, is put in 37 ℃ of incubators and hatches through 40 piece of 9 age in days SPF chicken embryo of allantoic cavity inoculation with ten times of sterilizing PBS dilutions.Discard chicken embryo dead in 24h; 72h after inoculation, chicken embryo is all dead; Collect respectively chicken embryo idiosome, chorioallantoic membrane and allantoic fluid thereof.

8.2 chicken embryo mean time to death (MDT) are measured

By the method for 49 pages of < < veterinary biologics standard > > appendix, undertaken.Calculation result MDT is 67.75 hours.

The toxicity test of 8.3 pairs of chicken embryos

To plant poison sterile saline and do 100 times of dilutions, 100 of inoculation 10 age in days SPF chicken embryos in allantoic cavity, every embryo 0.1mL, puts 37 ℃ and continues to hatch, and 6～8 hours photograph embryos once, record dead embryo number and idiosome pathology in 24～120 hours.The results are shown in Table 1.

Table 1: to the mensuration of embryo toxicity power

8.4 viral levels are measured

By making 10 times of serial dilutions containing virus liquid with sterile saline, get 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5five extent of dilution are inoculated respectively 10 age in days SPF chicken embryos in allantoic cavity, 3 pieces of embryos of each titre inoculation, every embryo 0.1mL, putting 37 ℃ continues to hatch, before 24 hours, dead embryo discards and disregards, and 48～120 hours dead chicken embryos are taken out in time, checks one by one chorioallantoic membrane and idiosome, remove non-specific dead embryo, calculate ELD ₅₀, the results are shown in Table 2.

Table 2: the mensuration of viral level

8.5 inactivation of virus

8.5.1 after the idiosome that inactivation test is collected the first step and chorioallantoic membrane grind, multigelation three times, 4 ℃ of centrifugal 45min of 10000rpm, get supernatant, add formalin solution, mix, the final concentration that makes formaldehyde is 3 ‰, add after formaldehyde in another bottle of impouring, with near the virus of avoiding adhering to bottleneck, fail to contact inactivator, be then put in 37 ℃ of deactivation 24h (reach 37 ℃ with temperature in bottle and start timing), jolting 3～4 times during deactivation, then take out, be placed in 4 ℃ and save backup.

8.5.2 inactivating efficacy check:

8.5.2.1 10 pieces of 10 age in days SPF chicken embryos are got in chick embryo method check, inoculate inactivation of viruses liquid 0.2ml for every piece through allantoic cavity, and shine egg 2 every day, Continuous Observation five days, and chicken embryo is without specificity death, and 120 as a child checked all chicken embryos, all without obvious pathology.

8.5.2.2 sheldrake method check: by 40 of sheldrakes in 9 week age, be divided into 4 groups, first group 10, the inactivation of viruses liquid 0.5mL of 5 times of amount of vaccine of every intramuscular inoculation; Second group 10, the inactivation of viruses liquid 0.5mL of 5 times of amount of vaccine of every collunarium inoculation; The 3rd group 10, every collunarium inoculation 0.5mL physiological saline in contrast; The 4th group 10, every intramuscular inoculation 0.5mL physiological saline in contrast; Under equal conditions in shield retaining, raise respectively for four groups, observe 10, record reaction.Four groups of ducks all, without dead, are cutd open and kill three after 4 days, and result shows that liver, the spleen of inactivation of viruses liquid inoculation group and control group duck is in the same size, there is no swelling and the pathology such as hemorrhage.Virus separating resulting shows, each internal organs of two groups of ducks are not all separated to virus that can lethal chicken embryo.

8.6 vaccine manufacture method

Get 92 parts of No. 10 white oils, add 6 parts of departments this 80, after mixing, add 2 parts of aluminum stearates, with add be stirred to transparent till, 115 ℃ of autoclaving 40min, cooling rear standby.Get 8 parts of Tween-80 and pack sterilizing in the bottle with granulated glass sphere into, cooling rear each 46 parts of deactivation blastochyle and the deactivation Frustrate blood and mycoplasma bacterium liquid that adds respectively, till shake well dissolves tween 80 completely.Getting 5 parts of oil phases is put in colloidal mill or emulsion tank, starting motor slow rotation stirs, slowly add 3 parts of waters simultaneously, after adding, with 10000rpm, stir 2 minutes again, then, add fast 1 part of water, with same speed emulsification 1.5min, stopping before emulsification adding 1% Thiomersalate solution, making its ultimate density is 0.01%, milky oil emulsion inactivated vaccine.By associated viscera, carry out quality test.

8.7 vaccine safety tests

For 2 different duck kind groups of every batch of vaccine test, 6 week age SPF egg duck, 4 week age each 10 of duckling, random packet.For 6 week age SPF egg duck, 4 week age duckling, adopt this oil-emulsion inactivated vaccine of subcutaneous multi-point injection 5mL/ plumage; In addition, control group is set, neck subcutaneous or intramuscular injection single-point or multiple spot physiological saline 0.5mL/ plumage or 1mL/ plumage, observe 30 days, has or not fervescence, lassitude, and appetite stimulator and other abnormal responses, the results are shown in Table 3.

Table 3: vaccine safety test

8.8 immuning effect test

1) 6 week age egg duck immuning effect test, every plumage neck subcutaneous injection 0.3mL.Test situation is in Table 4.

2) 4 week age duckling immuning effect test, every plumage neck subcutaneous injection 0.3mL.Test situation is in Table 4.

Table 4: vaccine immunity efficacy determinations

8.9 minimum immune dosages are measured

With 6 week age SPF egg duck and 4 week age duckling with 0.1mL, 0.2mL, 0.3mL, 0.5mL, the dosage neck subcutaneous vaccination that 1mL is different, 10 every group of SPF ducks, 4 week age 40 every group of ducklings.Every group of control group is 10.After blood sampling in 21 days, attack poison, attack latter 5 days isolated virals of poison.

8.10 immune kinetic determination

With 10 age in days SPF ducklings, every plumage neck subcutaneous injection 0.2mL, took a blood sample and attacked poison respectively at after immunity 3,7,10,14 and 21 days.

8.11 immune period is measured

Get 120 of SPF ducks, 80 of test group, 40 of control groups, test group is pressed the homemade oil-emulsion vaccine of dosage subcutaneous vaccination of 0.5ml/ plumage, control group inoculation physiological saline 0.5ml/ plumage, respectively at after inoculation every 60 duck vein separation serum of 3 days random acquisitions, after 30 days every blood sampling in 7 days 1 time, until inoculate latter 180 days, the serum of collection detects serum antibody.

8.12 protest test

Get the SPF duck of duration of immunity determination test group, respectively at after immunity 21,30,45,60,75,90,115,130,145,160 days, stochastic sampling, each 5, with 10 ⁴eLD ₅₀strong malicious intramuscular inoculation is attacked; Meanwhile, randomly draw 2 chickens of control group and attack with identical method, in attacking poison, within latter 10 days, slaughter test duck, record respectively this Virus Infection, measure protection ratio, and record attacks the variation of body weight and egg productivity in poison 10 days, protect effect in Table 5.

Table 5: deactivation vaccine is attacked poison protection effect measuring

Embodiment 9DNA vaccine development

The pcr amplification of 9.1M and E gene

By RNA extraction agent box extracting virus total RNA, through random primer reverse transcription, become cDNA Article 1 chain.With cDNA Article 1 chain, with Auele Specific Primer pcr amplification M gene and E gene respectively.Pcr amplification condition: 94 ℃ of denaturation 3min, 94 ℃ of sex change 30s, 53 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 30 circulations, last 72 ℃ of insulation 10min.PCR product is distinguished the band of visible 250bp and 1500bp size in 1.0% agarose gel electrophoresis, and size is consistent with expected results.By after the PCR product rubber tapping purifying of M and E gene, be connected in pMD19-T carrier, and send order-checking.Through sequencing result analysis, confirm that sequence is correct, without sudden change.

The Construction and identification of 9.2M and E gene eucaryon expression plasmid pCAGGS-M and pCAGGS-E

The PCR product of above-mentioned rubber tapping purifying, with after Hind III and Xho I double digestion, is connected in to the pCAGGS carrier of same double digestion processing.Linked system is as follows: 10 × buffer 1ul, and T4DNA ligase enzyme 1ul, enzyme is cut and is processed carrier pCAGGS and PCR product each 1 and 7ul, and room temperature connects 2h.The connection product of this M and E gene is transformed respectively to DH5 α competent cell, and 37 ℃ of cultivations on the LB flat board that contains penbritin.After 16-20h, the single bacterium colony of picking, extracting plasmid DNA is carried out enzyme and is cut evaluation (Hind III and Xho I).Enzyme is cut product and is observed in 1.0% agarose electrophoresis.Result is visible, can cut out respectively the band of size for 250bp and 1500bp after pCAGGS-M and pCAGGS-E recombinant plasmid double digestion.Then by pCAGGS-M and pCAGGS-E recombinant plasmid, send order-checking.Sequencing result confirmation, M and the E gene order of the pCAGGS carrier that inserts are errorless.These results prove that pCAGGS-M and pCAGGS-E recombinant plasmid successfully construct.

The development of 9.3M and E gene DNA vaccine

From LB solid culture, chosen single bacterium colony, be inoculated in the test tube that fills 3ml LB liquid nutrient medium, 37 ℃ of incubated overnight.The centrifugal supernatant of abandoning of bacterium liquid, bacterial sediment carries out ultrapure plasmid extraction with the intracellular toxin test kit that goes of OMEGA company.1) with transfering loop, dip and preserve glycerol stock (containing plasmid 3048-HA or 2842 or 2843 or 1238), containing Amp LB planar surface, ruling, 37 ℃ of hold over night; 2) picking list bacterium colony, is inoculated in 5mlAmp LB substratum, and 37 ℃ of shaking culture are to OD ₆₀₀value is 1.0-1.5; 3) balance pillar: add 2ml solution E 4, it is flowed down naturally; 4) collect 3ml overnight culture, centrifugal thorough removal substratum; 5) suspension thalline: the solution S olutionI suspension thalline with 0.25ml containing RNase A, until become homogenate shape; 6) a cracking bacterium: add again 0.25ml solution S olutionII, put upside down 5 times to mix gently (not concussion! ); 7) neutralization: add 0.125ml solution B ufferN3, put upside down at once 5 times to mix gently, until form white flocks, room temperature 12,000 × g, centrifugal 10min; 8) carefully supernatant is poured in clean 1.5ml centrifuge tube, added the ETR Solution (blueness) of 0.1 times of volume to supernatant liquor, put upside down 7-10 time, then ice bath 10min; 9) add 42 ℃ of water-bath 5min, again muddy, room temperature 12,000 × g, centrifugal 3min, ETR solution will form a blue layering in centrifuge tube bottom; 10) supernatant is moved in new 1.5ml centrifuge tube, adds the dehydrated alcohol of 0.5 times of volume, puts upside down 6-7 time, and room temperature is placed 1-2min; 11) above-mentioned mixed solution is poured a new HiBand DNAMini post into, be placed on the collection tube of a 2ml, and room temperature 10,000 × g, centrifugal 1min, makes lysate flow through pillar; 12) discard the liquid in collection tube, remaining mixed solution is joined in pillar, room temperature 10,000 × g, centrifugal 1min, makes lysate pass through pillar completely; Add 500ul BufferHB to pillar, 10,000 centrifugal 1min under room temperature, washing pillar, guarantees to remove remaining protein, to obtain high-quality DNA; 13) abandon liquid, with 700ulDNA Wash buffer washing pillar, 10,000 × g under room temperature, centrifugal 1min, discards liquid; 14) repeat, then add DNAWash buffer; 15) abandon liquid, idle running, the centrifugal 2min of room temperature 12,000 × g, removes liquid; 16) pillar is placed in to a clean 1.5ml centrifuge tube, adds the Endotoxin-Free Elution buffer of 30-50ul to pillar, the standing 2min of room temperature, the centrifugal 1min of room temperature 12,000 × g, with eluted dna, can wash twice; 17) electrophoresis detection, and measure OD260, OD280 with Nanodrop2000c ultra-violet and visible spectrophotometer, estimate DNA content and purity.Press aforesaid operations obtain pCAGGS-M and pCAGGS-E plasmid 0.85% normal saline dilution to 1mg/ml, be DNA vaccination M and E.

9.4 duck immunoprotection experiments

9.4.1 40 ducks of immunization method are divided into 4 groups at random, 10 every group: 1) recombinant plasmid pCAGGS-M group; 2) recombinant plasmid pCAGGS-E group; 3) vector plasmid pCAGGS group; 4) blank group.Every duck is injected the pre-treatment of appropriate hydrochloric acid bupivacaine in tibialis anterior in immunity the last week.Duck tibialis anterior intramuscular injection 0.1ml (1mg/ml) plasmid, 1 time/week, continuous 3 weeks.Respectively at getting duck serum behind two, three weeks, surrounding after last booster immunization and splenocyte is measured multinomial amynologic index.

9.4.2 the mensuration duck of antiviral protection ratio immunity DNA vaccination is after 28 days, each experimental group intramuscular inoculation 10 ⁴eLD ₅₀virus liquid.Observe and record death, the incidence of duck every day.The results are shown in Table 6; recombinant plasmid pCAGGS-M; recombinant plasmid pCAGGS-E immune group is attacked malicious sequela rate and is respectively 80% and 20%, shows that DNA vaccination recombinant plasmid pCAGGS-M or recombinant plasmid pCAGGS-E have certain immunoprotection to duck, can be used as DNA vaccination and uses.

The antiviral protection ratio of table 6:DNA vaccine is measured

Embodiment 10 viral diagnosis methods

10.1 quantitative fluorescent PCRs (Real-time PCR) detection method

10.1.1 primer and probe: utilize the full genome of 5 strain duck flavivirus that bioinformatic analysis software MegAlign software records this research department to carry out conservative Analysis, adopt Primer Express 2.0 softwares, assist and carry out primer probe design, then carry out broad spectrum and specificity in its kind of Blast analysis verification.Primer, probe be synthetic and mark by Shanghai Sheng Gong biotechnology company limited, probe 5 ', 3 ' end flag F AM fluorescence report group and TAMRA fluorescent quenching group respectively.In addition, for this gene order, designed the conventional PCR primer of two covers.Primer and probe are synthetic by Shanghai Invitrogen company.

Primer sequence is as follows:

PCR1016-1038CTGGCTTGTTAACAGAGACTGGT

PCR1126-1105GCGTGGGCCTCCTCAAATTCTA

PCR1366-1086TGTCTTATGCAGGTACCGATG

PCR1470-1450CGTATGGGTTGACTGTTATCA

Taqman probe sequence is as follows:

FXV?probe?1041-1056CATGACCTCAATTTAC

FXV?probe?1397-1414AGTTCCCATATCCATGTC

10.1.2 the extraction of viral RNA and cDNA are synthetic: with RNA, extract test kit and by its process specifications, extract respectively total RNA of viral cultures and the homogenate of duck viscera tissue, be dissolved in 30ul DEPC and process water, for the synthesis of cDNA.Getting total RNA 10.5ul adds in 20ul reverse transcription system, wherein comprise 4ul 5 × reverse transcription Buffer, 2uldNTPmix (10mmol/L), 1ul 9-mer random primer (50mmol/L), 2ul AMV (5u/ul) and 0.5ul RNA enzyme inhibitors (40u/ul), after mixing gently in 42 ℃ of water-bath 1h, last ice bath 2min, then for quantitative fluorescent PCR or put 20 ℃ and save backup.

10.1.3 the preparation of positive criteria product: the E gene fragment of conventional pcr amplification duck flavivirus, PCR product reclaims and after test kit purifying, connects into pMD18-T carrier, be converted into DH5 α competent escherichia coli cell, the positive colony plasmid that extraction is identified and verified by Sequence analysis through PCR, measure after DNA concentration, press the copy number that formula calculates standard substance, copy number (copies)=(quality/molecular weight) × 6.0 × 10 ²³.With 10 times of serial dilution plasmid standard to lower limits, reach 10 ⁰copies/ul.

10.1.4 the optimization of reaction system and condition: in same concentrations template and reaction system, adopt matrix method to optimize the optimum concn of primer and probe.In fluorescence quantitative RT-RCR reaction conditions, in conjunction with adjust different Tm values (50 ℃～65 ℃) with grads PCR instrument, select best Tm value to detect the positive nucleus acid template of same concentrations simultaneously.This research is optimized primer and concentration and probe concentration, to improve amplification efficiency and the susceptibility of reaction.Result shows that working as primer concentration is 10pmol/ul, concentration and probe concentration is 50pmol/ul, and Tm temperature is while being 54 ℃, can obtain minimum Ct value and high fluorescent increased value, after optimizing, reaction system is that every 25ul reaction solution comprises: 10 × Ex Taq Buffer (Mg2+Plus) 2.5ul; DNTPmix (each 2.5mmol/L) 2.5ul; The each 1ul of upstream and downstream primer (10pmol/ul); Probe (l0pmol/ul) 0.5ul; Ex Taq SH (5u/ul) 0.2ul, template (plasmid or cDNA) 1ul, mends DEPC water to 25ul.Then with Mx3005p quantitative real time PCR Instrument, by following reaction parameter, detect: 95 ℃ of sex change 5min, with 95 ℃ of 20s, 40 circulations of 54 ℃ of 1min amplifications, carry out single-point fluoroscopic examination at 54 ℃.

10.1.5 the foundation of typical curve: with 10 times of serial dilution plasmid standards 10 ¹copies/ul～10 ⁷copies/ul is template, after quantitative real time PCR Instrument detects, calculates Ct value drawing standard curve.Getting concentration is 2.96 × 10 ¹copies/ul～2.96 × 10 ⁷the standard substance template of copies/ul is carried out fluorescent quantitative PCR Criterion curve.Obtaining typical curve equation is y=-3.447 × LOG (X)+40.74, coefficient R ²=0.999; Amplification efficiency E=0.95 (seeing Fig. 7 A and B).

10.1.6 specificity, susceptibility, replica test: the experimental analysis of detection system, all utilize the analysis of virus infected cell supernatant, first carry out RNA extraction, reverse transcription, be then Real-time PCR and detect.Detect respectively the duck flavivirus strain of 3 strain different areas, examine the conservative property of this detection system in virus kind; Choose respectively the flavivirus epidemic encephalitis type B that this virus is relevant and detect analysis, to examine the specificity of this system; Sensitivity analysis experiment, first carries out virus plaque titration experiments to viral sample, then uses serum-free cell culture medium with 10 times of dilutions, obtains 1～10 ⁵pFU/ml serial dilution virus sample suspension detects respectively analysis, studies it and detects lower limit; Different sample a, b, c, the d of 4 template content of this experimental selection carries out respectively 5 times and detects.Divide and carry out for 2 times, be respectively 2 holes, 3 hole Parallel testings; The experimental result Ct value obtaining is carried out to statistical analysis, calculate the mean value of each detection sample Ct value and the variation coefficient to evaluate its stability or repeatability.

The Ct value that 3 strain duck flavivirus obtain is after testing all between 18～31 circulations, and result is all judged to be the positive.Further verify by experiment the conservative property of primer probe, in duck flavivirus kind, there is the wider spectrum that contains.For the specificity of confirmatory experiment method, by the method that we set up, detect japanese encephalitis virus (JEV) virus of same Tobamovirus, detected result is all negative, and shows that the primer probe that we design has specificity.Viral sample with serial dilution is carried out respectively RNA extraction, reverse transcription and Real-time pcr analysis, and experiment obtains amplification curve as shown in Figure 8.If Ct value is with the positive and negative of 35 cycle criterion results, the detection lower limit of the method can be judged to be 10PFU/ml, if Ct value is limited to 1PFU/ml under with 38 cycle criterion results, detecting.Sample concentration is when 10PFU/ml is above, and Ct value is all less than 35, can be judged to be the positive, the results are shown in Figure 8.

Stability analysis experimental result: the Ct value that 4 different concns sample duplicate detection are obtained for 5 times gathers, and by calculating mean value and the standard deviation of Ct value, further can obtain the variation coefficient of each test item.4 are detected sample and all can be judged to be the positive, and the Ct value variation coefficient (is 3.32% to the maximum in the reasonable scope, all be less than 5%), can reach a conclusion: the Real-time PGR detection method of structure has satisfactory stability, for quantitative analysis is laid a good foundation.

10.1.7 clinical sample detect and virus Fen Lis: the method that Preliminary Applications is set up detects this virus artificial challenge duck clinical sample part: picked up from April, 2010 to October the areas such as Zhejiang Jiaxing, Fengxian, Shanghai City 500 parts of duck pathological tissues grind separately, utilize Real-time PCR detection analysis to carry this viral situation.

21 portions of pathological material of disease lapping liquids are inoculated respectively to SPF embryo and carry out virus and separate, result is presented at the amounting in 11 parts of pathological material of diseases of epidemic season in 2010 of Shanghai periphery, through separating and identifying, obtains virus totally 3 strains; TaqManPCR detects with Ct value < 35 and the S-shaped positive decision principle of amplification curve: the Real-time PCR detected result of 11 parts of pathological material of diseases of Shanghai periphery shows 6 parts can be judged to be virus-positive, is respectively SH103, SH109, SH110, GS3, GS4 and GS6; And viral separating resulting only shows that isolation identification obtains duck flavivirus in SH103, SH109 and GS3.

From the above results, can find out, TaqManPCR detection method and the viral Comparison of separating methods of virus have higher susceptibility, and the positive findings that virus separates detects all positive at Real-time PCR.By this experiment tentative confirmation the method in viral context of detection, there is feasibility, highly sensitive in viral separation method.

10.2 two-way agarose diffusion tests: dissolve agarose, on level table, the agarose dissolving is poured in plate, make the approximately thick sepharose of 3～4mm of thickness, punch according to desired shape after cooling.Antigen and antibody are added respectively in aperture, make the phase mutual diffusion on agar plate of antigen and antibody.When two diffusion circles meet, as antigen and antibody are specific combination and ratio when suitable, will form the precipitation of immune complex, this precipitation can present an opaque white precipitate line in agar.If antigen and irrelevant antibody, just there will not be precipitation line, therefore can pass through this test, identify duck flavivirus antigen with specific antibody, otherwise or with known duck flavivirus antigen evaluation antibody.

10.3ELISA method is identified

10.3.1 for detection of the double antibody sandwich method of duck flavivirus antigen

10.3.1.1ELISA the preparation of double antibody sandwich method detection reagent

With the coated enzyme-linked reaction plate of anti-duck flavivirus monoclonal antibody 2M1 strain, and coated concentration, temperature, time and sealing condition etc. are carried out to system optimization, select best preparation technology.With the anti-duck flavivirus monoclonal anti 4F3 strain of mark horseradish peroxidase (HRP), adopt square formation volumetry to select the best effort concentration of enzymic-labelled antibody.After the matched proportion density of other auxiliary reagent is optimized, be assembled into test kit.

The coated concentration of optimum antibody is 10 μ g/ml, and the working concentration of enzyme labelling thing is 1: 4,000.Optimum test condition: application of sample 100 μ l, put 37 ℃ of water-bath 30min, enzyme-added marker 100 μ l after washing, put 37 ℃ of water-bath 20min, add developer after washing, put 37 ℃ of water-bath 10min, after termination, measure the OD of each reacting hole in 450nm wavelength ₄₅₀value.

10.3.1.2 antigen quantify Specification Curve of Increasing

Virus-positive reference material (tiring as 10EU/ml) is made to 1.5 times of serial dilutions, measure the OD of each concentration ₄₅₀value, calculates through linear regression equation, determines best quantitative concentration range, and calculates the mensuration limitation of reagent.The absorption OD of sample in establishing criteria curve ₄₅₀value, carries out Linear correlative analysis to measured value.Drawing standard curve, is shown in Fig. 9.The quantitative scope of final defined antigen is 0.131～0.666EU/ml.Sample concentration and mensuration OD in this is interval ₄₅₀value is good linear relation (r=0.996), can guarantee quantitative accurately, minimum quantitative limit value is 0.131EU/ml.

10.3.1.3 reagent specificity checking

Bovine serum albumin, duck plague vaccine, Duck parvovirus vaccine and hepatitis B vaccine in cell culture fluid that this virus culture is used, SPF chick embryo allantoic liquid, sample diluting liquid are measured, the specificity of examination reagent.

Test-results demonstration, the detected result of this virus reference material and SPF chick embryo allantoic liquid to be checked and virus-culturing fluid is positive reaction, measures OD ₄₅₀value and antigen concentration are good dependency.And other vaccines (duck plague vaccine, Duck parvovirus vaccine, Vaccinum Encephalitidis Epidemicae) and for the production of cell tissue liquid, BSA solution be negative reaction (A < 0101).Prove that ELISA reagent is special to the measurement result of this antigen, non-this antigenic component can not produce cross reaction in detection, in Table 7.

The specific test of table 7ELISA reagent

10.3.1.4 reagent accurate degree and accuracy validation

Be formulated in high, medium and low 3 parts of these antigen quantify samples in measurement range with these viral positive criteria product, carry out replication 10 times, calculate the preci-sion and accuracy of reagent.

High, medium and low 3 parts of quantitative samples within the scope of ELISA reagent quantitative are carried out to 10 times and measure, learn and process by statistics, the variation coefficient (CV) is respectively 8.3%, 11.0% and 10.0%.The measured value of sample and the rate of recovery of theoretical value are respectively 99%, 98% and 102%, meet the requirement of < < Products in China rules > > (2000 editions) to enzyme connection diagnostic reagent preci-sion and accuracy.

10.3.1.5 reagent stability test

By < < Products in China rules > > (2000 editions) requirement, carry out the stability test of reagent, test kit (the whole series) is deposited to different time at 37 ℃, observe the stability of each component in reagent.

In 37 ℃ of reagent of preserving 3d and 6d, detect identical quantitative reference material and sample to be checked with the reagent of 2～8 ℃ of preservations, 3 groups of results are learned F check (variance analysis) degree of freedom (4 by statistics, 12), F=0.035 < F (0.05)=3.26, P > 0.05.According to P value, analyze, the reagent detected result difference nonsignificance of the reagent after accelerating the failure and 2～8 ℃ of preservations, in Table 8.

The test of table 8ELISA reagent stability

10.3.1.6ELISA the comparison of detected result and RT-PCR test detected result

Take virus-positive reference material as standard, with ELISA, measure the virus antigen content of 10 batches of SPF chick embryo allantoic liquid amplifications, compare with the RT-PCR test detected result of these 10 batches of chick embryo allantoic liquids simultaneously, observe the dependency of two kinds of method measurement results.The RT-PCR test of 10 batches of chick embryo allantoic liquids and ELISA detectable antigens content the results are shown in Table 9.RT-PCR contrast ELISA detected result in table.RT-PCR identifies that positive sample is also positive in ELISA reaction.

The comparison of table 9ELISA detected result and RT-PCR test detected result

10.3.1.7 repeatability

Take positive reference material as quantitative criterion, according to the operation rules and regulations of test kit, the viral A that Fengxian is separated to and B replication 9 times, in each test, every batch of sample to be checked is done to 3 dilution mensuration, calculate respectively each dilution ELISA unit (EU/ml), get its mean value, accuracy and the test bay error of checking reagent quantitative.Learn and process by statistics, the actual measurement antigenic content mean value of A strain virus is (5.92 ± 0.16) EU/ml, and the variation coefficient is 2.7%; The actual measurement antigenic content mean value of B strain is (1.72 ± 0.08) EU/ml, and the variation coefficient is 4.4%, illustrates that the test bay error of reagent is less, and the accuracy of mensuration is high.

Concrete ELISA reactions steps is as follows: (following test no longer repeats)

Coated: with 0.05M PH9.6 carbonate, being coated with damping fluid is 1～10 μ g/ml by antibody dilution to protein content.In the reacting hole of each polystyrene board, add 0.1ml, 4 ℃ are spent the night.Next day, discards solution in hole, washes 3 times each 3 minutes with lavation buffer solution.(being called for short washing, lower same).

Application of sample: add the sample 0.1ml to be checked of certain dilution in above-mentioned coated reacting hole, put 37 ℃ and hatch 1 hour.Then washing.(setting up blank well, negative control hole and positive control hole) simultaneously.

Add enzyme labelled antibody: in each reacting hole, add enzyme labelled antibody (extent of dilution after the titration) 0.1ml of fresh dilution.Hatch 0.5～1 hour washing for 37 ℃.

Add substrate solution colour developing: in each reacting hole, add the tmb substrate solution 0.1ml of interim preparation, 37 ℃ 10～30 minutes.

Termination reaction: add 2M sulfuric acid 0.05ml in each reacting hole.

Result is judged: can be in white background, and result directly detects by an unaided eye: in reacting hole, color is darker, and positive degree is stronger, and negative reaction is colourless or extremely shallow, according to the depth of be color, with "+", "-" number, represents.Also can survey OD value: on ELISA detector, in 450nm (if with ABTS colour developing, 410nm), locate, to survey each hole OD value after the zeroing of blank hole, if be greater than 2.1 times of negative control OD value of regulation, positive.

10.3.2 with duck flavivirus virus antigen, detect the indirect method of corresponding antibodies:

10.3.2.1 the preparation of antigen and purifying:

Normal antigen: duck flavivirus is inoculated 9 age in days SPF chicken embryos through allantoic cavity, collects respectively dead chicken embryo idiosome, chorioallantoic membrane and allantoic fluid thereof after 24 hours.After freeze thawing 3 times, grind, the centrifugal 30min of 10,000r/min, gets supernatant liquor, and surveys protein content 1.9789mg/mL.

Specific antigen: by above-mentioned duck flavivirus supernatant liquor in 4 ℃, the centrifugal 3h of 40,000r/min, collecting precipitation is in appropriate PBS.Again after 20% sucrose is centrifugal, with determined by ultraviolet spectrophotometry antigen protein content be 6.3125mg/mL.

10.3.2.2 judging criterion determines

According to GB, select OD ₄₅₀value reads absorbancy.In the situation that yin, yang contrast is set up, 0D value >=0.2, blood serum special antigen to be checked hole, OD value >=2.1, blood serum special antigen hole OD value/negative control specific antigen hole to be checked, be judged to the positive.

10.3.2.3 determining of normal antigen and specific antigen, enzyme conjugates best effort concentration:

By yin, yang control serum and the dilution in 1: 40 of standby inspection serum.Normal antigen is coated with 0.05,0.1,0.2,0.4 μ g/mL respectively, specific antigen is coated with 5,10,20 μ g/mL respectively, goat-anti pig IgG-HRP is with 1: 5000～1: 64000 doubling dilution, by square formation determine normally, specific antigen and enzyme conjugates best effort concentration are respectively 0.2,10 μ g/mL and 1: 20000.

10.3.2.4 specific test:

Under the condition of all setting up in the contrast of this virus yin, yang, with duck plague, duck hepatitis, duck influenza, duck newcastle disease and Duck parvovirus yin, yang serum all without specific reaction.

10.3.2.5 stability test:

By 3 different batches antigen coated microplates of 4 ℃ of placements 0,30 and 90d, detect known 4 parts of feminine genders and 4 parts of positive serums simultaneously, calculate OD ₄₅₀be worth velocity of variation (relative deviation), determine the time stability of ELISA method.The OD value velocity of variation (relative deviation) of 8 parts of serum is all less than 25%.

10.3.2.6 accuracy test:

With the same extent of dilution of a positive serum, use with a collection of plate and do 20 holes simultaneously, calculate OD ₄₅₀the variation coefficient of value.By 4 different batches antigen coated microplates of 4 ℃ of placements 0,30,60 and 90d, detect same 8 parts of positive serums and same 8 parts of negative serums of different antibodies level simultaneously, replica test between criticizing, calculates interassay coefficient of variation.

Normally, specific antigen is criticized the interior variation coefficient (CV) and is respectively 8.3% and 6.4%; Normally, specific antigen is criticized an average coefficient of variation (CV) and is respectively 9.7% and 11.5%.

10.3.2.7 susceptibility test:

This virus antibody positive serum was made serial doubling dilution since 1: 40, detect the positive hole (OD of maximum dilution ratio by the ELISA method of setting up ₄₅₀value>=0.2) be its detection sensitivity, the results are shown in Table 10.Table 10 indirect ELISA assay sensitivity measurement result (OD ₄₅₀value)

10.3.2.8 confidence level:

By the ELISA method of setting up, 60 parts of known yin, yang serum that application commercialization ELISA antibody assay kit was detected detect, and verify the confidence level of this method.

ELISA method detects known yin, yang serum and the results are shown in Table 11.46 parts of negative serums detect 3 parts of positives, 43 parts of feminine genders, and it is 93.5% that negative serum detects coincidence rate; 6 parts of positive serum detected results are all positive, and positive coincidence rate is 100%; In 8 parts of suspicious serum, detect 7 parts of positives, 1 part of feminine gender.

Table 11ELISA method detects oneself and knows positive and negative serum result

10.3.3 with the albumen of prokaryotic expression, as antigen, detect the indirect method of duck flavivirus antibody:

10.3.3.1 antigen is prepared antigen and is utilized pET-32a prokaryotic expression purification of Recombinant duck flavivirus E albumen.

10.3.3.2 definite square formation volumetry of using of the suitableeest coated concentration of antigen and serum optimum dilution degree, with 0.05mol/L pH 9.6 carbonate buffer solutions by the restructuring duck flavivirus E albumen (1.722mg/mL) after purifying successively by 1.0,0.8,0.4,0.2,0.1,0.05g/ hole dilutes, every hole 100uL is coated with elisa plate, and 4 ℃ are spent the night.Positive serum and negative serum are done respectively dilution in 1: 20,1: 40,1: 80,1: 160,1: 320,1: 640, and ELIAS secondary antibody is done dilution in 1: 5000, according to indirect ELISA program determination.Measure OD ₄₅₀value value and P/N value, select positive OD ₄₅₀value is greater than 1, negative OD ₄₅₀antigen coated concentration and serum diluting multiple when value value is less than 0.2, P/N value maximum are best effort concentration.

Square formation titration results, with OD ₄₅₀it is best coated concentration that value value approaches the coated extent of dilution of 1.0 o'clock, and now, error minimum, reacts the sensitiveest.When detectable antigens is 2ug/mL, serum dilution is 1: 160 o'clock, OD ₄₅₀value value is close to 1.0, and therefore, the suitableeest coated concentration of defined antigen is 2ug/mL, and serum dilution is 1: 160 (table 12).

Determining of the suitableeest coated concentration of table 12 antigen and serum optimum dilution degree

Note: in table, numerical value is OD ₄₅₀value.

10.3.3.3 determining of the best coated condition of antigen

With the suitableeest antigen concentration coated elisa plate, be divided into 6 groups, the 1st group of 37 ℃ of coated 1h; The 2nd group of 37 ℃ of coated 2h; The 3rd group of 37 ℃ of coated 4h; The 4th group 4 ℃ are spent the night coated; The 5th group of 37 ℃ of coated 1h add 4 ℃ and spend the night coated; The 6th group of 37 ℃ of coated 2h add 4 ℃ and spend the night, and other conditions are constant, respectively organize negative hole, positive hole, control wells OD ₄₅₀value and P/N value, determine best coated condition.

With detectable antigens 2ug/mL coated elisa plate, the results are shown in Table 13, the highest with the P/N value of the 5th group, reach 7.51, result shows, 37 ℃ of coated 1h add 4 ℃ and spend the night and be coated with as the coated condition of the best.

The suitableeest coated condition of table 13 antigen is determined

10.3.3.4 confining liquid determines

With the suitableeest antigen concentration and best coated condition coated elisa plate, after washing, use respectively the PBST that contains 5% skimming milk, 1% gelatin, 1%BSA, 10% calf serum as confining liquid, 200uL/ hole, other conditions are constant, select suitable confining liquid.After 37 ℃ of sealing 2h, carry out ELISA detection, measure OD ₄₅₀value and P/N value, select P/N value the maximum as confining liquid.

When with containing the PBST of 1%BSA the P/N value during as confining liquid maximum, be 7.676, accordingly, the PBST of selection 1%BSA is as confining liquid.

10.3.3.5 determining of best off-period

With best antigen concentration and coated condition coated elisa plate, after washing, add confining liquid, 200uL/ hole, is divided into 5 groups.The 1st group 37 ℃ sealing 1h; The 2nd group 37 ℃ sealing 2h; The 3rd group 37 ℃ sealing 3h; The 4th group 37 ℃ sealing 4h; The 5th group 37 ℃ sealing 30min, other conditions are constant, take P/N value the highest as the best off-period.With best antigen concentration and coated condition coated elisa plate, after washing, add confining liquid, 200uL/ hole, test result analysis, with 37 ℃ of sealing 2h, P/N value is 7.738 to the maximum, therefore selects 37 ℃ of sealing 2h for best off-period.

10.3.3.6 the selection of two anti-working concentrations

ELIAS secondary antibody is done to dilution in 1: 2000,1: 4000,1: 8000,1: 16000, and other condition is constant, and antigen and serum are pressed optimum dilution degree dilution, measure OD ₄₅₀value and P/N value.

With best antigen concentration and coated condition coated elisa plate, after washing, add confining liquid, 200uL/ hole, test result analysis, with 37 ℃ of sealing 2h, P/N value is 7.738 to the maximum, therefore selects 37 ℃ of sealing 2h for best off-period.

10.3.3.7 the selection of substrate-function time

With best antigen diluent degree coated elisa plate, the anti-duck IgG of rabbit HRP labeling antibody and negative, positive serum all adopt optimum dilution degree, and the substrate reactions time is respectively room temperature 5,10,15,30min, and other condition is constant, tests according to a conventional method, measures OD ₄₅₀value and P/N value.

10.3.3.8ELISA determining of yin and yang attribute threshold value

By the ELISA method of above-mentioned foundation, 30 parts of duck flavivirus negative serums to be checked are detected, measure its OD ₄₅₀value is also carried out statistical analysis, determines the threshold value OD of positive serum ₄₅₀value>=0.2.

10.3.3.9 criticize interior replica test

With the coated different elisa plate of the recombinant antigen with a collection of preparation, get the serum of 6 parts of different antibodies levels, in identical conditions, press indirect ELISA program determination, every part of blood sample does 5 hole parallel tests, and result is carried out to statistical analysis.

With with batch recombinant antigen, 5 parts of positive serums and 1 part of negative serum being carried out to repeatability detection, by its result of statistical analysis, its variation coefficient, between 1.57%-7.43%, is less than 10%, illustrate that same sample degree of variation in a collection of test is very little, there is good repeatability.

10.3.3.10 criticize a replica test

With the coated different elisa plate of recombinant protein of 3 different batches preparations purifying, get the serum of 6 parts of different antibodies levels, in identical conditions, press indirect ELISA program determination, result is carried out to statistical analysis.

Result is Epidemiological Analysis by statistics, and its variation coefficient, between 1.80%-8.82%, is less than 10%, illustrates that same sample degree of variation in different batches antigen test is very little, has good repeatability.

Claims (21)

1. a duck flavivirus, is characterized in that: the aminoacid sequence of its membranin M gene is as shown in SEQ ID NO:2.

2. a kind of duck flavivirus as claimed in claim 1, is characterized in that: the aminoacid sequence of its envelope protein E protein gene is as shown in SEQ ID NO:4.

3. a duck flavivirus, is characterized in that: the aminoacid sequence of its envelope protein E protein gene is as shown in SEQ ID NO:4.

4. a duck flavivirus, its preserving number is: CCTCC NO.V201032.

5. a kind of duck flavivirus as claimed in claim 1, is characterized in that: the nucleotide sequence of its membranin M albumen is as shown in SEQ ID NO:1.

6. a kind of duck flavivirus as claimed in claim 3, is characterized in that: the nucleotide sequence of its envelope protein E albumen is as shown in SEQ ID NO:3.

7. an antibody, is characterized in that: by claim 1 or claim 3 or a kind of duck flavivirus immunity generation claimed in claim 4.

8. an antibody, is characterized in that: anti-claim 1 or claim 3 or a kind of duck flavivirus antigen claimed in claim 4.

9. a diagnostic reagent, is characterized in that: contain claim 7 or antibody claimed in claim 8.

10. a DNA molecular, is characterized in that: its nucleotide sequence is as shown in SEQ ID NO:1.

11. 1 kinds of DNA moleculars, is characterized in that: coded protein, its aminoacid sequence is as shown in SEQ ID NO:2.

12. 1 kinds of DNA moleculars, is characterized in that: its nucleotide sequence is as shown in SEQ ID NO:3.

13. 1 kinds of DNA moleculars, is characterized in that: coded protein, its aminoacid sequence is as shown in SEQ ID NO:4.

14. 1 kinds of carriers, is characterized in that, contain just like the nucleotide sequence shown in SEQ ID NO:1.

15. 1 kinds of carriers, is characterized in that, contain just like the nucleotide sequence shown in SEQ ID NO:3.

16. 1 kinds of carriers, is characterized in that, the albumen of its expression contains just like the aminoacid sequence shown in SEQ ID NO:2 or SEQ ID NO:4.

17. 1 kinds of vaccines, is characterized in that: contain the carrier described in claim 14 or claim 15.

18. 1 kinds of vaccines, is characterized in that: the claim 1 that contains deactivation or claim 3 or duck flavivirus claimed in claim 4.

19. 1 kinds of vaccines, is characterized in that: contain the claim 1 or claim 3 or the duck flavivirus claimed in claim 4 that cause weak or attenuation.

20. 1 kinds of test rights require 1 or the test kit of claim 3 or a kind of duck flavivirus claimed in claim 4, it is characterized in that: contain pair of primers and probe, the sequence of one of them primer is as shown in SEQ ID NO:9, the sequence of another one primer is as shown in SEQ ID NO:10, and the sequence of described probe is as shown in SEQ ID NO:12.

21. a kind of test kits that detect duck flavivirus as claimed in claim 20, is characterized in that: 5 ' end flag F AM fluorescence report group of described probe, 3 ' end mark TAMRA fluorescent quenching group.

Images