CN102533660A

CN102533660A - Preparation method of permanent cell line for multiplying orf virus

Info

Publication number: CN102533660A
Application number: CN2011104527087A
Authority: CN
Inventors: 陈德坤; 尚川川; 李�杰; 罗军
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2012-03-07
Filing date: 2012-03-07
Publication date: 2012-07-04
Anticipated expiration: 2032-03-07
Also published as: CN102533660B

Abstract

The invention relates to a preparation method of a permanent cell line for multiplying an orf virus. The aim that the virus can be stably multiplied in a large amount is achieved by inoculating a calf testicular cell line to the orf virus and a stable cell environment and a standardized culture system for developing and producing an attenuated vaccine of the orf virus are provided. The preparation method comprises the following steps of: firstly, acquiring, separating and culturing a calf testicular cell; secondly, permanently establishing the calf testicular cell; and thirdly, carrying out multiplication culture on the orf virus in the cell line.

Description

A kind of permanent cell line preparation method who is used for sheep of virus propagation

One, technical field:

The present invention relates to a kind of permanent cell line preparation method who is used to breed sheep of virus, it is prepared into clone for a kind of bovine testicle cell that utilizes, and sheep of virus utilizes the method for this cell line proliferation.

Two, background technology:

In the background technology; The sheep infective warts is commonly called as sheep aphtha (Orf virus); Be that a kind of of sheep and goat suffers from transmissible disease altogether by the people beast due to the blue tongue virus, OIE (OIE) classifies this disease as need type of declaring Animal diseases, and China classifies it as type of animal epidemic.This disease almost is distributed in all sheep raising countries of the world, main infringement sheep and goat under the natural situation, and goat is comparatively multiple.It is popular that this disease often is mass-sending property, the easy infection of 3 ~ 6 monthly age lambs, the sheep morbidity of growing up is less, sick sheep be this sick contagium with malicious sheep.Virus can be discharged with saliva, warts and the blister secretory product of sick sheep and the crust that comes off, and its route of transmission mainly is to infect through the skin of damage or mucous membrane.Healthy Sheep directly contacts with sick sheep, or contact is infected by the feed trough of sick sheep pollution, feed, drinking-water, apparatus, pad grass, pasture and mew etc.

Along with the developing rapidly of China mutton sheep, wool sheep and milk goat aquaculture, China has become the first in the world sheep raising big country in recent years, and sheep raising had become one of pillar and the specialty industries in the many places of China already.On the other hand, sheep eqpidemic disease, especially sheep aphtha have also become to threaten one of main eqpidemic disease of sheep husbandry.High-quality and efficient cheap sheep aphtha vaccine is badly in need of at the sheep raising family.

But there is not sheep aphtha vaccine can supply the user to use in the market; Cause the reason of this problem to be that production of vaccine enterprise is unwilling to produce sheep aphtha less toxic vaccine, because the cell that this production of vaccine needs is the calf testicular cell of former generation, these cell preparation programs are complicated; Production cost is too high; Expend time in and financial resources, and be difficult to realize that quality control effectively, enterprise are difficult to obtain than rich profit.Therefore, research and development are suitable for sheep of virus (vaccine strain) proliferating cells system has important use to be worth.

Three, summary of the invention:

The present invention is in order to solve the weak point in the above-mentioned background technology; A kind of permanent cell line preparation method who is used to breed sheep of virus is provided; It utilizes this clone inoculation sheep of virus (vaccine strain); Virus reaches stable propagation purpose, and developing and produce for the sheep of virus less toxic vaccine provides stable cellular environment and standardized culture condition.

For realizing above-mentioned purpose, the technical scheme that the present invention adopts is:

A kind of permanent cell line preparation method who is used to breed sheep of virus is characterized in that may further comprise the steps: the obtaining, separate and cultivate of (1) bovine testicle cell; (2) foundation of bovine testicle cell permanence; (3) the stable propagation of sheep of virus.

In the step (1), bovine testicle cell be retrieved as after the calf birth testis of gathering calf before the feed, the low temperature transportation separates testicular cell then.

Bovine testicle cell is separated into mechanical process or tryptic digestion method in the step (1).

The nutrient solution of bovine testicle cell is M199, the high sugar of DMEM or RPMI-1640 substratum in the step (1).

The foundation of bovine testicle cell permanence realizes through importing Telomerase rt genetic method in the step (2).

The setting up in the process of bovine testicle cell permanence, utilize liposome 2000 to carry out the carrier for expression of eukaryon cell transfecting in the step (2), and utilize the RT-PCR method to detect the expression of hTERT in the bovine testicle cell of stable transfection.

Compared with prior art, the advantage and the effect that have of the present invention is following:

Separation and Culture bovine testicle cell of the present invention, reach stable culture condition after, transfection hTRT gene (hTERT) makes the bovine testicle cell immortalization, sets up bovine testicle cell system.Utilize this bovine testicle cell system inoculation sheep of virus (vaccine strain); Virus (vaccine strain) can be stable propagation in the cell culture environment at this; For sheep of virus less toxic vaccine development with produce stable cellular environment and standardized culture systems is provided, can be used for the mass production of sheep aphtha vaccine.

Four, accompanying drawing table explanation:

Fig. 1 is cultivation (normally) result of bovine testicle cell system;

Fig. 2 detects the expression of results of hTERT in the transfectional cell series for RT-PCR;

The cytopathy result of Fig. 3 after for bovine testicle cell system inoculation sheep of virus Local Isolates 96h;

The cytopathy result of Fig. 4 after for bovine testicle cell system inoculation sore mouth toxic vaccine strain 96h;

Five, embodiment:

Referring to Fig. 1, cultivation (normally) result that Fig. 1 for bovine testicle cell of the present invention is; Referring to Fig. 2, utilize RT-PCR method amplification. the cell of the negative contrast untransfected of N hTERT, 20 and 60 be respectively transfection hTERT bovine testicle cell pass 20 generations, 60 generation hTERT expressions, the positive contrast of P.Referring to Fig. 3, the cytopathy behind the inoculation sheep of virus Local Isolates 96h, cell formation of vacuoles; Referring to Fig. 4, the cytopathy behind the inoculation sore mouth toxic vaccine strain 96h, cytopathy is slower; Referring to table 1, table 1 is the titer determination result of the sheep aphtha vaccine strain inoculation bovine testicle cell back 96h of system.

Figure 2011104527087100002DEST_PATH_IMAGE001

Embodiment:

Following examples are used to explain the present invention, but do not limit use range of the present invention.

1, the separation of bovine testicle cell and cultivation

Under the aseptic condition, Hank ' s liquid (two anti-) flushing testis 3 times, sterile scissors cuts off epididymis and tunica albuginea, stays parenchyma of testis.Hank ' s liquid flushing parenchyma of testis until no blood, moves to it in aseptic triangular flask then.

With eye scissors testis is shredded, about 1 ~ 3mm size, 2-3min is left standstill in the flushing of Hank ' s liquid.Supernatant discarded, repetitive scrubbing 3 times adds PH7.6, and 0.25% trypsinase, consumption are 2 ~ 4 times of tissue volume, 4 ℃ of hold over night.Every other day, inhale and remove trypsinase, add the M199 nutrient solution, piping and druming dispels cell gently, and the 50mL centrifuge tube is centrifugal, 1000rpm, and centrifugal 10min, supernatant discarded adds the nutrient solution re-suspended cell, adjustment cell density, 37 ℃, 5% CO ₂Cultivate.

2, the foundation of bull testis epithelial cell permanence

60%～70% o'clock of the bovine testicle cell confluent culture bottle of cultivating utilizes liposome 2000 to carry out carrier for expression of eukaryon pCI-neo-hTERT (purchasing in Addgen) cell transfecting, carries out Xin Meisu (neo) screening and culturing, carries out cell and enlarges and go down to posterity.Extract the 20th, 60 generation transfectional cell and total RNA of the cell of untransfected, reverse transcription reaction synthesizes cDNA, utilizes primer amplified hTERT fragment and confidential reference items GAPDH, detects the expression of hTERT.HTERT primer: hup:5 ' GCTGCTCAGGTCTTTCTTTTATG 3 '; Hdown:5 ' CGACGTAGTCCATGTTCACAA 3 ', 55 ℃ of annealing temperatures; GAPDH primer: Gup:5 ' GAAGGTGAAGGTCGGAGT 3 '; Gdown:5 ' GAAGATGGTGATGGGATTTC 3 ', 56 ℃ of annealing temperatures.The result shows, is passaged to after 60 generations through the bovine testicle cell after the screening transfection, and hTERT is positive, and the cell growth is the stone road shape.

3. the stable propagation of sheep of virus

After getting the recovery of clone freeze-stored cell, with the 1640 substratum suspension cells that contain 10% calf serum, 37 ℃, 5%CO ₂Cultivate 48h.Get the sheep aphtha vaccine strain virus of 300 L～500 L, inoculating cell system continues to cultivate 96h, observes pathology.When treating that plaque appears in culturing cell, freezing whole culture.Behind the multigelation three times, centrifugal then, collect supernatant, measure virus titer.

Claims

1. permanent cell line preparation method who is used for sheep of virus propagation is characterized in that may further comprise the steps: the obtaining, separate and cultivate of (1) bovine testicle cell; (2) foundation of bovine testicle cell permanence; (3) sheep of virus is at the multiplication culture of clone.

2. a kind of permanent cell line preparation method who is used for sheep of virus propagation according to claim 1; It is characterized in that: in the step (1); Bovine testicle cell be retrieved as after the calf birth testis of gathering calf before the feed, the low temperature transportation separates testicular cell then.

3. a kind of permanent cell line preparation method who is used for sheep of virus propagation according to claim 1 is characterized in that: bovine testicle cell is separated into mechanical process or tryptic digestion method in the step (1).

4. a kind of permanent cell line preparation method who is used for sheep of virus propagation according to claim 1, it is characterized in that: the nutrient solution of bovine testicle cell is M199, the high sugar of DMEM or RPMI-1640 substratum in the step (1).

5. a kind of permanent cell line preparation method who is used for sheep of virus propagation according to claim 2 is characterized in that: the foundation of bovine testicle cell permanence realizes through importing Telomerase rt genetic method in the step (2).

6. a kind of permanent cell line preparation method who is used for sheep of virus propagation according to claim 2; It is characterized in that: in the step (2); Setting up in the process of bovine testicle cell permanence; Utilize liposome 2000 to carry out the carrier for expression of eukaryon cell transfecting, and utilize the RT-PCR method to detect the expression of hTERT in the bovine testicle cell of stable transfection.