CN102517333A - Spontaneous HHcy-related atherosclerosis transgenic mice animal model and preparation method thereof - Google Patents

Abstract

The invention discloses a hyperhomocysteinaemia (HHcy)-related atherosclerosis transgenic mice animal model with apoE and Mthfr dual gene deficient, and a preparation method thereof. Characteristics of two gene-deleted models are better combined in the animal model. With the model, HHcy can be formed spontaneously, and can be developed into atherosclerosis. Also, effects of atherosclerosis-causing factors other than HHcy can be avoided to a maximal extent. The animal model is advantaged in high repeatability, good controllability, and easy breeding. With the animal model, defects of current animal models are covered. The model is more stable, and accords clinical features. With the animal model, a batter platform is provided for the researches of occurrence mechanisms and intervention measures of HHcy-related atherosclerosis.

Description

Atherosis transgenic mice animal model of spontaneous HHcy related arteries and preparation method thereof

Technical field

The present invention relates to transgenic mice animal model field, more particularly, relate to atherosis transgenic mice animal model of a kind of spontaneous HHcy related arteries and preparation method thereof.

Background technology

Many epidemiology and clinical observation result of study show; Hyperhomocysteinemiainjury (hyperhomocysteinemia; HHcy) increase the risk that cardiovascular and cerebrovascular diseases and atherosclerosis take place; The every rising 3umol/L of Plasma Hcy, the ischemic heart disease incidence increases by 11%, and stroke incidence increases by 19%.Hhcy is one of initiating agent of atherosclerosis generation, and its atherosclerotic inflammatory reaction process of bringing out is in case startup finally can cause the formation of irreversible atherosclerotic plaque.

Though some ebm evidences (the HOPE2 test of NORVIT test of announcing in 2005 and report in 2006) show that folic acid associating vitamin B group reduces blood Hcy level the improvement that formed atherosclerotic's one-level terminal point is not already had obvious effect; But reduce blood Hcy level; The function of vascular endothelium damage that the homocysteine Hazard Factor is only arranged due to (not forming atherosclerotic plaque as yet) be might improve, thereby atherosclerotic generation and/or development checked.Hhcy still should not be underestimated to the infringement that cardio-cerebrovascular causes.Up to the present, Hhcy causes atherosclerotic mechanism not illustrated fully yet.

Research recently both at home and abroad shows, Hcy maybe through promotes oxidn stress, transmitting inflammation and immunoreation, short smooth muscle cell proliferation influence function of vascular endothelium, activates the thrombocyte blood coagulation system, influences the incidence and development of machine-processed participation AS such as lipid metabolism.The further investigation homocysteine activates the mechanism of action of arteries and veins gruel type damage and takes effective intervening measure, presses for a kind of animal model that can reflect human atheromatosis progression and good reproducibility the most truly.The method of setting up the HHcy animal model that generally adopts in the world at present mainly contains: 1, add homomethionin/homocysteine or folic acid in the diet, the cobalamin disappearance induces HHcy to form; 2, adopt the genetic flaw mouse: the gene that is usually used in knocking out has nuclear family's Guang sulphur to narrow β-synthase (CBS), methylene tetrahydrofolate reductase (MTHFR), apo E (ApoE).Adopt the method cost of diet induced lower, but difference between individuals is bigger, poor repeatability, controllability is low; And the HHcy model that the disappearance of the key enzyme effect in homocysteine metabolic process back forms is stablized because of its proterties, good reproducibility is widely used.The Plasma Hcy level of cbs gene deficient mice of isozygotying can reach more than 40 times of normal level, with the serious sluggishness of growing, and fatty degeneration of liver, lens dislocation.Assorted and cbs gene deficient mice Plasma Hcy raises more than 2 times, and without various growth defects, therefore becomes the ideal model of the slight HHcy of research.But multinomial research shows, though endothelial injury occurred, on cbs gene deficient mice model, does not observe the infringement of Atheromatosis reason and takes place.The phenotype of mthfr deficiency mouse is similar with the cbs gene deficient mice, but it is bigger that atherosclerotic tendency takes place.Isozygoty and mix and mthfr deficiency HHcy mouse after diet induced, can observe the aorta lipid deposit of similar atherosclerosis early lesion; And the lipid level of mouse is all in normal range; Therefore, as if the mthfr deficiency mouse can become simple slight Hcy and increase atherogenic animal model.

Discover, give homomethionin or homocysteine diet after, apoE genetic flaw mouse can form big and baroque multiple atherosclerotic plaque.And diet induced can occur at first three months the influence of patch size and quantity, so apoE genetic flaw mouse can be used for studying the influence of HHcy at atherosclerosis sclerosis commitment.Also existing at present research has successfully made up apoE genetic flaw mouse HHcy Atherosclerosis Model, and existing Atheromatosis reason changes after point out that homomethionin is induced the bimester, and finds that its atherosclerotic plaque is unsettled.

In sum, three kinds of genetic flaw mouse models all cut both ways.Though mthfr deficiency or apoE genetic flaw HHcy mouse can observe the aorta lipid deposit of similar atherosclerosis early lesion, also must be through diet induced.Diet induced is nothing but in drinking-water or food, to add methionine(Met)/homocysteine, perhaps makes folic acid or vitamin B12 deficiency.This method poor controllability, difference between individuals is bigger.Certain density methionine(Met) is irritated stomach can control the methionine(Met) dosage that mouse is taken in, but bigger to the stimulation of mouse, and non-medicine factor lethality rate increases.Therefore it is imperative to set up a kind of repeatability HHcy Atherosclerosis Model high, that controllability is good.

Summary of the invention

The objective of the invention is, the preparation method of the atherosis transgenic mice animal model of a kind of spontaneous HHcy related arteries is provided.

Second purpose of the present invention is that a kind of transgenic mice animal model that utilizes above-mentioned preparation method to prepare is provided.

To achieve these goals, the invention provides the preparation method of the atherosis transgenic mice animal model of a kind of spontaneous HHcy related arteries, may further comprise the steps:

(1) the ES cell SCR012 that chooses 129/S6/SvEv strain male mice is as the used cell of gene targeting, and structure Mthfr targeting vector;

(2) utilize electroporation to carry out gene targeting, screen positive ES clone;

(3) utilize micro-injection method that positive ES clone is implanted the blastaea of C57BL/6J mouse;

(4) utilize blastaea after the mosaic preparation method will inject to be implanted into the first-filial generation false pregnancy mouse acceptor intrauterine of C57BL/6J male mice and CBA female mice;

(5) chimeric rate is carried out mating greater than 50% ripe mouse and C57BL/6J female mice, the offspring mouse carries out PCR and identifies through extracting coda gene group DNA, obtains Mthfr gene knockout heterozygosis mouse.

For realizing second purpose of the present invention; The present invention provides a kind of transgenic mice animal model that utilizes above-mentioned preparation method to obtain, and said transgenic mice animal model is the atherosis transgenic mice animal model of the HHcy related arteries of apoE and the dual genetic flaw of Mthfr.

The invention has the advantages that; The HHcy Atherosclerosis Model of apoE and the dual genetic flaw of MTHFR has combined the characteristic of two kinds of genetically deficient models better; Both can make it can spontaneous formation HHcy mass formed by blood stasis and develop into atherosclerosis, farthest avoid other atherogenicity effect of factors except that Hcy again.This animal model repeatability is high, controllability is good; Be easy to captive breeding; Remedied the deficiency of existing animal model, and more stable, more meet clinical characters, for the atherosis mechanism research of HHcy related arteries and the exploration of intervening measure provide better platform.Utilize this platform, for the research of HHcy atherosclerosis dependency and pharmacological agent will be further science deeply and more.

Description of drawings

Fig. 1 is a target practice plasmid construction synoptic diagram.

Fig. 2 identifies figure for plasmid enzyme restriction, and targeting vector is cut with EcoRI, HindIII enzyme, and the purpose band is respectively: EcoRI:173bp, 5641bp, 7407bp; HindIII:5999bp, 7222bp.

Fig. 3 is ES clone qualification result PCR electrophorogram, Marker:1kb ladder; Positive band: the 4071bp of PCR.

Fig. 4 is ES clone qualification result PCR electrophorogram, Marker:1kb ladder; Positive band: the 2779bp of PCR.

Fig. 5 is that mousetail DNA PCR 5'arm identifies figure.

Fig. 6 is that mousetail DNA PCR 3'arm identifies figure.

Fig. 7 is dual genetic flaw mouse of apoE and MTHFR and control group mice.

Fig. 8 is each group mice plasma Hcy concentration, with ApoE (-), MTHFR (+-) mouse compares, ApoE (-) * MTHFR (+-) mouse Hcy level significantly increases, and presents statistical significance (P < 0.05).

Fig. 9 is each group mice plasma TC, TG level, and its TC, TG level have remarkable rising than wild-type and MTHFR (+-) mouse, but with ApoE (-) mouse compares no significant difference.

Figure 10 is each group mouse aorta root morphological change (* 200), wherein Figure 10 A, 10B be 4 monthly age wild-type mices and ApoE (-) mouse, its aortic tunica intima is smooth, interior elastic force film is wavy; Figure 10 C is MTHFR (+a-) mouse, and its aortic tunica intima thickens, and owes smooth, but does not see that patch generates; Figure 10 D be ApoE (-) * MTHFR (+-) mouse, patch appears in its aortic root, volume is bigger; The fibrous cap that surface coverage one deck is thin; And massive inflammatory cells infiltrated is arranged, the collagen ratio obviously increases in the patch, and has and bury fibrous cap and patch internal hemorrhage in the patch.

Figure 11 is each group mouse aorta root BiP and CHOP mRNA expression; RT-PCR result shows; With ApoE (-), MTHFR (+-) mouse compares; ApoE (-) the mRNA expression level of * MTHFR (+-) mouse aorta root BiP and CHOP significantly increases, semi-quantitative results has statistical significance (P < 0.05).

Figure 12 is the expression of each group mouse aorta root BiP and CHOP protein level; The result of Western-blot shows; With ApoE (-), MTHFR (+-) mouse compares; ApoE (-) protein expression level of * MTHFR (+-) mouse aorta root BiP and CHOP significantly increases, and statistical significance (P < 0.05) is arranged.

Embodiment

Specify the preparing method's of the atherosis transgenic mice animal model of spontaneous HHcy related arteries provided by the invention embodiment below in conjunction with accompanying drawing; Should be understood that these embodiment only are used to the present invention is described but not are used to limit scope of the present invention.

Embodiment 1, the atherosis transgenic mice animal model of the spontaneous HHcy related arteries of preparation

1. choose the used cell of gene targeting: 129/S6/SvEv strain male mice ES cell SCR012.

2. make up Mthfr targeting vector plasmid (see figure 1), plasmid enzyme restriction is identified (see figure 2).

3. with the targeting vector linearizing: (enzyme dosage: 100U) enzyme tangent line shapeization, enzyme are cut volume 200ul, 37 ℃ of digestion are spent the night with NotI with 80ug Mthfr KO Vector DNA; Walk the glue separation and purification, (glue reclaims test kit with QIAquick Gel Extraction Kit (Cat No. 28706)); Ethanol sedimentation subsequently, the aseptic PBS of 100ul is resuspended.

4.ES cell targeting and screening: E S cell: SCR012; DNA amount: 35 μ g; Electroporation model: Bio-Rad Gene Pulser (Cat.No.165-2105); Electroporation conditions: voltage 240 v, electric capacity 500 μ F; Actual conduction time 10.5ms, virtual voltage 256 v; Colony screening condition: 300 μ g/ml G418,2uM GanC screening 8 days; Totally 96 of picking resistance clones provide 96 parts in DNA sample.

5.ES cellular genome is identified

1) identify strategy (Fig. 1):

5 ' PCR identifies: primers designed 5L&neoR, and the purpose fragment is 4071bp, annealing temperature: 65 ℃;

PCR primer sequence: Neo-R:CTGAGCCCAGAAAGCGAAGGA;

5L:?GTGGCCCCACACTCTTCAAAGTTT。

3 ' PCR identifies: primers designed 3R&neoF, and the purpose fragment is 2779bp, annealing temperature: 65 ℃;

PCR primer sequence: Neo-F:CCTCCCCCGTGCCTTCCTTGAC;

3R:?CATGAAGGCCAGGCCAGGGTATTGG。

2) ES clone qualification result:

Identify 96 of drug resistance clones altogether, wherein several 12 of correct homologous clone all takes place in both arms, and positive rate is 12.5%.The PCR electrophorogram is seen Fig. 3, Fig. 4.

6. utilize micro-injection method that positive ES clone is implanted the blastaea of mouse.Microinjection derives from the superovulation of C57BL/6J mouse with blastaea, and natural conception was grown in the body to the blastaea stage.

Utilize blastaea after the mosaic preparation method will inject to be implanted into the first-filial generation false pregnancy mouse acceptor intrauterine of C57BL/6J (♂) and CBA (♀).Chimeric rate is carried out mating greater than 50% ripe mouse and C57BL/6J female mice, and offspring's grey mouse is identified (identifying that strategy is the same) through extracting coda gene group DNA, obtains 7 of mouse according to the invention.

Mousetail DNA PCR identifies and sees Fig. 5, Fig. 6.

Primer and the condition identified:

Reorganization-P1:GGGGAACTTCCTGACTAGGG;

Public-P2:ATAACACGTTCCAGGCGAAG;

Wild-P3:CCCAGGGATGGATAACAGTG;

Stripe size: homo:560bp heter:560+354bp wt:354bp tm:60 degree 30s, 30cycles.

Whether embodiment 2, the dual genetic flaw mouse of checking ApoE/MTHFR can cause spontaneous HHcy related arteries atherosis

(1) mensuration of detection model Hcy and plasma lipid profile

As shown in Figure 8, with ApoE (-), MTHFR (+-) mouse compares, ApoE (-) * MTHFR (+-) mouse Hcy level significantly increases, and presents statistical significance (P < 0.05); As shown in Figure 9, its TC, TG level have remarkable rising than wild-type and MTHFR (+-) mouse, but with ApoE (-) mouse compares no significant difference.

(2) respectively organizing the aortic root pathomorphism changes

Shown in figure 10, aortic root section is through H&E dyeing back discovery, 4 monthly age wild-type mices and ApoE (-) aortic tunica intima of mouse is smooth, that interior elastic force film is is wavy (Figure 10 A, 10B); The aortic tunica intima of MTHFR (+-) mouse thickens, and owes smooth, but does not see that patch generates (Figure 10 C); ApoE (-) patch appears in * MTHFR (+-) mouse aorta root; Volume is bigger, the fibrous cap that surface coverage one deck is thin, and massive inflammatory cells infiltrated is arranged; The collagen ratio obviously increases in the patch, and has and bury fibrous cap and patch internal hemorrhage (Figure 10 D) in the patch.

(3) respectively organizing mouse aorta root BiP and CHOP mRNA expresses

Shown in figure 11; RT-PCR result shows: with ApoE (-), MTHFR (+-) mouse compares; ApoE (-) the mRNA expression level of * MTHFR (+-) mouse aorta root BiP and CHOP significantly increases, semi-quantitative results has statistical significance (P < 0.05).

(4) respectively organize the expression of mouse aorta root BiP and CHOP protein level

Shown in figure 12; The result of Western-blot shows: with ApoE (-), MTHFR (+-) mouse compares; ApoE (-) protein expression level of * MTHFR (+-) mouse aorta root BiP and CHOP significantly increases, and statistical significance (P < 0.05) is arranged.

To sum up; ApoE and the dual genetic flaw mouse model of MTHFR according to preparing method's acquisition provided by the invention; By the stack of two kinds of genetically deficient effects, combined the characteristic of two kinds of genetically deficient models better, both can make it can spontaneous HHcy and develop into atherosclerosis; Other atherogenicity effect of factors except that Hcy have farthest been avoided again; Remedied the deficiency of previous various animal models, and more stable, more meet clinical characters, for HHcy provides better animal model to the research of atherosclerotic influence and intervening measure.

The above only is a preferred implementation of the present invention; Should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention; Can also make some improvement and retouching, these improvement and retouching also should be regarded as protection scope of the present invention.

SEQUENCE?LISTING

 

< 110>Ruijin Hospital, Shanghai Jiao Tong University School of Medicine

 

< 120>atherosis transgenic mice animal model of spontaneous HHcy related arteries and preparation method thereof

 

<130> 。

 

<160> 7

 

<170> PatentIn?version?3.5

 

<210> 1

<211> 21

<212> DNA

<213> Rat

 

<400> 1

ctgagcccag?aaagcgaagg?a 21

 

 

<210> 2

<211> 24

<212> DNA

<213> rat

 

<400> 2

gtggccccac?actcttcaaa?gttt 24

 

 

<210> 3

<211> 22

<212> DNA

<213> rat

 

<400> 3

cctcccccgt?gccttccttg?ac 22

 

 

<210> 4

<211> 25

<212> DNA

<213> rat

 

<400> 4

catgaaggcc?aggccagggt?attgg 25

 

 

<210> 5

<211> 20

<212> DNA

<213> rat

 

<400> 5

ggggaacttc?ctgactaggg 20

 

 

<210> 6

<211> 20

<212> DNA

<213> rat

 

<400> 6

ataacacgtt?ccaggcgaag 20

 

 

<210> 7

<211> 20

<212> DNA

<213> rat

 

<400> 7

cccagggatg?gataacagtg 20

 

Claims (2)

1. the preparation method of the atherosis transgenic mice animal model of spontaneous HHcy related arteries may further comprise the steps:

(1) the ES cell SCR012 that chooses 129/S6/SvEv strain male mice is as the used cell of gene targeting, and structure Mthfr targeting vector;

(2) utilize electroporation to carry out gene targeting, screen positive ES clone;

(3) utilize micro-injection method that positive ES clone is implanted the blastaea of C57BL/6J mouse;

(4) utilize blastaea after the mosaic preparation method will inject to be implanted into the first-filial generation false pregnancy mouse acceptor intrauterine of C57BL/6J male mice and CBA female mice;

(5) chimeric rate is carried out mating greater than 50% ripe mouse and C57BL/6J female mice, the offspring mouse carries out PCR and identifies through extracting coda gene group DNA, obtains Mthfr gene knockout heterozygosis mouse.

2. the transgenic mice animal model that utilizes the described preparation method of claim 1 to obtain is characterized in that said transgenic mice animal model is the atherosis transgenic mice animal model of the HHcy related arteries of apoE and the dual genetic flaw of Mthfr.

Images