CN102517330B - Adenovirus vector and its application in preparing HCV cell and mouse models - Google Patents
Adenovirus vector and its application in preparing HCV cell and mouse models Download PDFInfo
- Publication number
- CN102517330B CN102517330B CN201110411318.5A CN201110411318A CN102517330B CN 102517330 B CN102517330 B CN 102517330B CN 201110411318 A CN201110411318 A CN 201110411318A CN 102517330 B CN102517330 B CN 102517330B
- Authority
- CN
- China
- Prior art keywords
- hcv
- hdad
- cell
- adenovirus
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an adenovirus vector and its application in preparing HCV (hepatitis C virus) cells and mouse models. The invention provides a recombinant adenovirus vector which is obtained by inserting nucleotides shown by the sequence 1 in the sequence table in the adenovirus vector HDAd (helper-dependent adenovirus). The experiments prove that the invention provides a third generation adenovirus vector of a recombinant HCV 2a type full-length genome, the prepared adenovirus can be used for preparing HCV whole-genome cell models or mouse models, and the obtained models can be used for drug screening of anti-HCV drugs, so as to be used for HCV vaccine evaluation and researches of the pathogenic mechanism.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of adenovirus carrier and the application in preparation HCV cell and mouse model thereof.
Background technology
Hepatitis C virus (hepatitis C virus, HCV) is one of important factor causing chronic hepatitis, liver cirrhosis and liver cancer, serious threat human health.Still there is no effective HCV preventative vaccine at present, and HCV model, the shortage of especially infectious model, also counteracts that HCV vaccine research and development and mechanism of causing a disease research, thus adds its prevention and control difficulty.Existing HCV infection mouse model is immunodeficiency type people liver gomphosis mouse mainly, can not be used for HCV vaccine evaluation and mechanism of causing a disease research.(Mercer DF，Schiller DE，Elliott JF，Douglas DN.，Hao C，RinfretA，Addison WR，Fischer KP，Churchill TA，Lakey JR，Tyrrell DL，Kneteman NM.Hepatitis Cvirus replication in mice with chimeric human livers.Nat Med 2001；7：27-933.)。
Third-generation adenovirus vectors, also known as ghost carrier or helper virus dependent form adenovirus (HDAd, helper-dependent adenovirus) carrier, it removes the gene of the whole coding trans-acting proteins of adenovirus, only remain inverted terminal repeat and the packaging signal at two ends, the function of its adenovirus protein encoding sequence removed is provided by helper virus.
Summary of the invention
An object of the present invention is to provide a kind of recombinant adenoviral vector.
Recombinant adenoviral vector provided by the invention, for inserting the carrier obtained in adenovirus carrier HDAd by the Nucleotide shown in sequence in sequence table 1.
Above-mentioned recombinant adenoviral vector is specially and the Nucleotide shown in sequence in sequence table 1 is inserted the carrier obtained between the I-Ceu I of adenovirus carrier HDAd and I-Sce I site.
The adenovirus be packaged to be by above-mentioned recombinant adenoviral vector.
Above-mentioned adenovirus is by 293 cells of above-mentioned recombinant adenoviral vector transfection expression Cre recombinase, the adenovirus be packaged to be.
Above-mentioned adenovirus is specifically prepared as follows: above-mentioned recombinant adenoviral vector is expressed 293 cells of Cre recombinase with helper virus AdNG163 cotransfection after Pme I linearizing, is packaged to be adenovirus.
Another object of the present invention is to provide a kind of transgenic cell, for above-mentioned adenovirus being imported the cell obtained in host cell.
In above-mentioned transgenic cell, described host cell is Huh7 cell.
The application in the cell model of preparation screening anti-HCV medicament of above-mentioned recombinant adenoviral vector or above-mentioned adenovirus.
Above-mentioned recombinant adenoviral vector or above-mentioned adenovirus are for the preparation of the application in screening anti-HCV medicament mouse model.
Above-mentioned recombinant adenoviral vector or above-mentioned adenovirus or the application of above-mentioned transgenic cell in screening anti-HCV medicament.
Experiment of the present invention proves, the invention provides a kind of third-generation adenovirus vectors of recombinant HCV 2a type JFH1 full-length gene group, its adenovirus prepared can be used for preparing HCV full-length genome cell model or mouse model, the model obtained can be used for carrying out anti-HCV drug screening, thus for HCV vaccine evaluation and mechanism of causing a disease research.
Accompanying drawing explanation
Fig. 1 is HDAd-HCV virus infection Huh7 cell GFP and HCV core and NS3 Immunofluorescence test result.
Fig. 2 is HDAd-HCV virus infection Huh7 cell HCV core and NS3 Western blot detected result.
Fig. 3 is HDAd-HCV virus infection Huh7 cell HCV RNA Northern blot detected result.
Fig. 4 is HCV RNA Real_time quantitative detection result in HDAd-HCV virus infection Huh7 cell and supernatant.
Fig. 5 is that HDAd-HCV virus infection Huh7 cells and supernatant infects Huh7 cell HCV core and NS3 Immunofluorescence test result again.
Fig. 6 is that HDAd-HCV virus infection Huh7 cells and supernatant HCV infection is tested by people CD81 monoclonal antibodies block.
Fig. 7 is that HDAd-HCV virus infection Huh7 cells and supernatant HCV infection is tested by HCV E2 monoclonal antibodies block.
Fig. 8 is HDAd-HCV virus infection Huh7 cell transmission electron microscope and the supernatant immuno-electron microscope result for HCV E2.
Fig. 9 is that HDAd-HCV virus infection Huh7 cell model is for the evaluation of IFN-α anti-hcv activity.
Figure 10 is HDAd-HCV virus infection C57BL/6 murine liver tissue HCV core and NS3Western blot detected result.
Figure 11 is HDAd-HCV virus infection C57BL/6 murine liver tissue HCV RNA Northern blot detected result.
Figure 12 is HDAd-HCV virus infection C57BL/6 mice serum HCV RNA Real_time quantitative detection result.
Figure 13 is HDAd-HCV virus infection C57BL/6 mice serum ALT detected result.
Figure 14 is that HDAd-HCV virus infection C57BL/6 murine liver tissue HE dyes and HCV core immunohistochemical methods detected result.
Figure 15 is that HDAd-HCV virus infection C57BL/6 mouse model is for the evaluation of miRNA122 antisense oligonucleotide anti-hcv activity.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Experiment material used in following embodiment is as follows:
The plasmids such as pJFH1, pSC11 and helper virus AdNG163, Huh7 clone, HepG
2293 clones of clone, stable transfection recombinase Cre are this room and preserve, and foetal calf serum (FCS), Hepes, dual anti-, glutamine etc. are all purchased from Gibco company, and alpha-interferon is purchased from Beijing Jie Hua bio-engineering research institute.DNA extraction kit, plasmid extraction kit, PCR purification kit are purchased from Beijing Quan Shijin biotech firm, and T4DNA Ligase is purchased from Promega company; RNeasy Mini Kit is purchased from Qiagen company; Lipofectamine box, Trizol reagent are Invitrogen product.E.coli DH5 α competent cells and DNA standard Marker is purchased from Beijing Quan Shijin biotech firm; QIAprep Spin Miniprep Kit and Gel Extraction Mini Kit is purchased from Qiagen company; M-MLV (code:D2640A), dNTP Mixture (code:D4030RA), Random 6mer (code:D3801A) and RNase Inhibitor (code:D2310A) are all purchased from Takara company.RealMaster Mix (SYBR Green) is purchased from Tian Gen biotech firm (catalog number (Cat.No.): FP202), and proteinase inhibitor Aprotinin, Pepstatin A, Leupeptin, PMSF are all purchased from Amresco company; Restriction enzyme is purchased from NEB company and Takara company; Primer is synthesized by the raw work in Shanghai, Hematorylin, Yihong available from Sigma.ALT adopts Fuji DRI-CHEM 7000 Biochemical Analyzer to detect (FUJIFILM Corporation, Tokyo, Japan).
Anti-HCV core monoclonal antibody is purchased from Thermo Scientific (Cat.No.MA1-080), Anti-HCV NS3monoclonal antibody is purchased from Virogen (Cat.No.MA1-7369), Anti-HCV E2monoclonal antibody (sc-65457) and Anti-human CD81monoclonal antibody (sc-70803) all purchased from Santa Cruz company, purchased from Anti-GAPDH polyclonal antibody (Cat.No.G9545) available from Sigma; RIPA lysate (#C1053) and the super quick luminescent solution (#P1020) of SuperECL Plus are all purchased from Puli's lema gene technology company, Bradford determination of protein concentration test kit (green skies company, P0006), lowlenthal serum confining liquid, DAB nitrite ion, HRP mark goat anti-rabbit igg, HRP mark goat anti-mouse IgG and DyLight
tM594 mark goat anti-mouse IgG are all purchased from company of Zhong Shan Golden Bridge; MEGAscript T7RNA in-vitro transcription test kit purchased from Ambion company (Cat.No.AM1334), Amersham Hybond
tM-N+ nylon membrane is purchased from GEhealthcare (Cat.No.RPN303B), High Pure PCR Product Purification Kit (REF 11732668001) and DIG High Prime DNA Labeling and Detection Starter Kit II (Cat.No.11585614910) is all purchased from Roche company, and wild-type C57BL/6J mouse is purchased from Military Medical Science Institute's Experimental Animal Center.
PBS solution in following embodiment is Gibco company, REF10010-023.
The acquisition of embodiment 1, HDAd-HCV recombinant adenoviral vector
The genomic third-generation adenovirus vectors HDAd-HCV of recombinant HCV 2a type JFH1 is for insert adenovirus carrier HDAd (Prolonged Peritoneal Gene Expression Using AHelper-Dependent Adenovirus.Peritoneal Dialysis International, 2009 by sequence in sequence table 1; 29:508-516, the public can obtain from Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL) I-Ceu I and I-Sce I site between the carrier that obtains.
Be prepared as follows:
1, pMD18T-HCV500-Ribo builds:
With pJFH1 plasmid (Production of Infectious Hepatitis C Virus in Tissue Culture from ACloned Viral Genome.Nat.Med, 2005; 11 (7): 791-796, the public can obtain from Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL) be template, use overlapping PCR method that HDV ribozyme sequence Ribo is connected in JFH1 downstream, the primer sequence of HDV ribozyme sequence and design is as follows:
HDV Ribo：
ggccggcatggtcccagcctcctcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaatggcgaatgggaccca；
F1：gtttgcggccgatatctcttcaattgggcggtg；
R1：gaggaggctgggaccatgccggccacatgatctgcagagagaccagttacggca；
F2：ggccggcatg gtcccagcctcctcgctggcgccggctgggcaacattccgagggga；
R2：gctctagatgggtcccattcgcc attaccgaggggacggtcccctcggaatgttgccca，
Take F1/R1 as primer, pJFH1 is 21bp sequence before template amplification HCV end 455bp sequence and ribozyme, product is designated as P1, P1, F2, R2 mixing is carried out the 2nd and takes turns PCR, product is designated as P2, be template again with P2, F1/R2 is that primer carries out the 3rd and takes turns pcr amplification, product is designated as P3, by P3 subclone in pMD18T, Xba I enzyme cuts qualification direction, and selecting enzyme to cut object size is that the clone of about 500bp extracts plasmid and sends to order-checking, called after pMD18T-HCV500-Ribo, above PCR condition is: 94 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds, 56 DEG C of annealing 30 seconds, 72 DEG C extend 30 seconds, and 2-4 walks 30 circulations; 72 DEG C 10 minutes, 4 DEG C 5 minutes.
2, pJFH1-Ribo builds
PMD18T-HCV500-Ribo reclaims about 500bp fragment through Xba I/EcoR V double digestion, is connected into the pJFH1 through Xba I/EcoRV double digestion, is designated as pJFH1-Ribo; Utilize T7 promotor upstream EcoR I and Age I site, downstream, at T7 promotor downstream design pair of primers F3, R3, F3:ccgaattcgagctcggtacccgg, R3:caccggttccgcagaccac, respectively containing EcoR I and Age I site, be that template carries out PCR with pJFH1-Ribo, above PCR condition is: 94 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds, 56 DEG C of annealing 30 seconds, 72 DEG C extend 30 seconds, and 2-4 walks 30 circulations; 72 DEG C 10 minutes, 4 DEG C 5 minutes.Product is connected into the pJFH1-Ribo cut through EcoR I and Age I enzyme equally after EcoR I/Age I enzyme is cut, and the pJFH1-Ribo (Δ T7) of T7 promoter sequence has been removed in order-checking qualification.
3, HDAd-HCV builds:
PJFH1-Ribo obtained above (Δ T7) is connected into pSC11 after EcoR I and Hind III double digestion, obtain pSC11-JFH1-Ribo, be connected in HDAd after I-Ceu I and I-Sce I double digestion, obtain recombinant plasmid, through order-checking, this plasmid is and the sequence 1 in sequence table is inserted the carrier obtained between the I-Ceu I of adenovirus carrier HDAd and I-Sce I site, is denoted as HDAd-HCV.
Embodiment 2, HDAd-HCV recombinant adenoviral vector are preparing the application in cell model and mouse model
The acquisition of I, HDAd-HCV recombinant adenovirus
By the carrier HDAd-HCV that obtained by embodiment 1 and HDAd empty carrier all after Pme I linearizing with helper virus AdNG163 (Prolonged Peritoneal Gene Expression Using A Helper-DependentAdenovirus.Peritoneal Dialysis International, 2009, 29:508-516, the public can obtain from Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL) 293 cells of cotransfection stably express Cre recombinase, restructuring HDAd-HCV is made to pack and activate, then constantly add AdNG163 helper virus, respectively through 60mm Tissue Culture Dish, 150mm Tissue Culture Dish and 3L Tissue Culture Flask amplification cultivation (37 DEG C 60rpm shake-flask culture 3 days), CsCl density gradient centrifugation (4 DEG C 35000rpm centrifugal 12 hours) is carried out after collecting cell cracking, collect the visible lustrous band of naked eyes, obtain HDAd-HCV virus and the empty virus of HDAd (all representing with HDAdGFP virus below) respectively.
Plaque method measures the titre of above-mentioned HDAd-HCV virus and the empty virus of HDAd: add in cell by virus liquid by after 10 doubling dilutions, room temperature places 60 minutes, remove substratum, adding 5% low melting point agar covers on cell, in case the virus of release flows in liquid medium, 37 DEG C are continued cultivation 4 days, use toluylene red dyeing, because sick cell does not absorb toluylene red, sick cell district just presents colourless plaque.The titre of viral suspension represents with every milliliter of plaque forming unit (PFU/ml), 1PFU=200viral particle, and result is HDAd-HCV virus titer is 2 × 10
11vp/mL, HDAdGFP virus titer is 1 × 10
12vp/mL (vp=viral particle, virion number).
The infectious cell model of II, HDAd-HCV is set up and anti-HCV medicament evaluation
One, the infectious cell model of HDAd-HCV is set up
Above high titre HDAd-HCV virus (by 100vp/cell) is utilized to infect Huh7 cell (Production ofInfectious Hepatitis C Virus in Tissue Culture from A Cloned Viral Genome.Nat.Med, 2005; 11 (7): 791-796, the public can obtain from Inst. of Epidemiology and Microbiology, Academy of Military Medical Sciences, PL), within every 2 ~ 3 days, carry out cells infected and go down to posterity, obtain the infectious cell model of HDAd-HCV.
Adopting uses the same method infects Huh7 cell by HDAdGFP virus (by 100vp/cell), obtains the empty virocyte of HDAd.
Two, the qualification of the infectious cell model of HDAd-HCV
1, in the infectious cell model of HDAd-HCV, HCV copies and detection of expression
Collect different time points respectively by the cell of the infectious cell model of above-mentioned one HDAd-HCV that obtains and cells and supernatant, detect HDAd self under fluorescent microscope with green fluorescent protein GFP gene expression dose, observe HDAd-HCV infection rate with HDAd self with green fluorescent protein GFP gene expression dose.
Result is as the display of Fig. 1 first row, and after infecting, the GFP of the 2nd, 6, the 11 day infectious cell model of HDAd-HCV expresses and weakens gradually (green fluorescence represents), illustrates that HDAd-HCV virus does not copy itself.
2, detect D8L core and NS3 in cell model to express
1) indirect immunofluorescence (two resist for red fluorescence traget antibody)
Experimental implementation is as follows: get part infect after the 4th day and the 20th day by the cell of the above-mentioned one HDAd-HCV infectivity cell model obtained, fix through 4% paraformaldehyde, PBS solution washes 3 times, lowlenthal serum confining liquid room temperature (25 DEG C) closes 1 hour, 0.3%Triton X-100 room temperature (25 DEG C) process 1 hour, Anti-HCV core monoclonalantibody (red fluorescence traget antibody) and Anti-HCV NS3monoclonal antibody (red fluorescence traget antibody) uses PBS respectively by 1: 300 and dilution 1: 30, hatch 1 hour for 37 DEG C, PBS solution washes 3 times, DyLight
tMpBS is by 1: 600 dilution for the anti-use of 594 mark goat anti-mouse IgG two, and hatch 30 minutes for 37 DEG C, PBS solution washes 3 times, observations under fluorescent microscope.Be that contrast (for HDAdGFP virus (by 100vp/cell) is infected Huh7 cell, obtains the empty virocyte of HDAd with HDAdGFP.)。
Indirect immunofluorescence result such as Fig. 1 the 2nd arranges and (wherein the first behavior HDAdGFP shown in the 3rd row, the cell of the infectious cell model of second and third behavior HDAd-HCV), wherein the 2nd result being classified as Anti-HCV core monoclonalantibody (red fluorescence traget antibody), 3rd result being classified as Anti-HCV NS3monoclonal antibody, can find out, infect latter 4th day and the 20th day, HCV core and NS3 albumen are all expressed (red fluorescence represents).
2)Western-blot
Method operation is as follows: the 36th hour and the 72nd hour cell (the infectious cell model of the HDAd-HCV obtained by above-mentioned) after getting part HDAd-HCV virus infection, through RIPA lysate 4 DEG C process 30 minutes, centrifugal 10 minutes of 10000rpm 4 DEG C, collect supernatant liquor, use Bradford determination of protein concentration test kit (green skies company, catalog number (Cat.No.) P0006) protein content in detection by quantitative supernatant liquor, result is as follows: after getting part HDAd-HCV virus infection, the protein content of the 36th hour and the 72nd hour cell is respectively 1.2mg/ml and 1.0mg/ml;
Then to extract after HDAd-HCV virus infection the 36th hour and the protein solution 30 μ g of the 72nd hour cell, add 5 × SDS sample-loading buffer and 1/20 volume beta-mercaptoethanol, boil 10min, the centrifugal 5min of 10000rpm, the Western that supernatant is used for HCV core and NS3 albumen detects: HCV core and NS3 Protein Detection primary antibodie use Anti-HCV core monoclonal antibody (extent of dilution 1: 1000) and Anti-HCV NS3 monoclonalantibody (extent of dilution 1: 50) respectively, GAPDH albumen primary antibodie uses Anti-GAPDH polyclonal antibody (extent of dilution 1: 10000), the two anti-HRP that use respectively mark goat anti-mouse IgG (core and NS3 bis-resists) and HRP mark goat anti-rabbit igg (extent of dilution 1: 5000) (two of GAPDH albumen resists), developing solution uses the super quick luminescent solution of SuperECL Plus.
Western-blot result as shown in Figure 2, wherein, HDAdJFH136 is the 36th hour cell after HDAd-HCV virus infection, HDAdJFH172 is the 72nd hour cell after HDAd-HCV virus infection, the compared with control cells that HDAdGFP obtains for empty for HDAd virus (by 100vp/cell) being infected Huh7 cell, PC Huh7 is that the JFH1 RNA of in-vitro transcription is (by pJFH1 after Xbal I linearizing, use MEGAscript T7 RNA in-vitro transcription test kit to carry out in-vitro transcription (explanation is shown in operation), obtain HCV RNA) transfection Huh7 cell; Huh7 is normal Huh7 cell; Can find out, infect the cell of latter 36th hour and 72 hours in the infectious cell model of the HDAd-HCV obtained by above-mentioned, HCV core and NS3 albumen are all expressed.
3), Northern blot method detects HCV rna expression in HDAd-HCV virus infected cell
7th day, 14 days, 21 days cells (the infectious cell model of the HDAd-HCV obtained by above-mentioned) after getting part HDAd-HCV virus infection, RNeasy Mini Kit is used to extract total serum IgE, through Nanodrop 1000 spectrophotometric determination concentration and purity, result is that concentration is respectively 720ng/ul, 560ng/ul, 630ng/ul; Purity (A260/280) is respectively 2.07,2.00,1.98; By pJFH1 after Xbal I linearizing, use MEGAscript T7RNA in-vitro transcription test kit to carry out in-vitro transcription (explanation is shown in operation), obtain HCV RNA as positive control.
Design primer North-F1:gaggcctcctgggcgccatag, North-R1:taagcctgacggtggtctccgc, take pJFH1 as template, the about 500bp PCR primer of amplification and HCVNS3 complementation, use Roche company High PurePCR Product Purification Kit purifying (explanation is shown in operation), take purified pcr product as template, use DIG-High Prime in DIG HighPrime DNA Labeling and Detection Starter Kit II to carry out digoxin (DIG) label probe preparation (explanation is shown in operation).
Set up following RNA sample sex change system: 2ul 10 × MOPS electrophoretic buffer+4ul formaldehyde+10ul methane amide+1ul ethidium bromide (200ug/ml), supply RNase Free H
2o to 20ul.By RNA sample 85 DEG C of incubations 10 minutes, after cooling 10 minutes rapidly on ice, add 2ul 10 × formaldehyde gel sample loading buffer, by the agarose/formaldehyde gel load level electrophoresis chamber prepared, add 1 × MOPS electrophoretic buffer, prerunning 10 minutes (5V/cm), adds with electrophoresis under 4 ~ 5V/cm voltage after RNA sample, until tetrabromophenol sulfonphthalein shifts out about about 8cm.Then with DEPC process water wash gel, glue to be immersed in 0.01mol/LNaOH-3mol/LNaCl 20 minutes, by RNA by capillary transfer on positively charged nylon membrane.Add DIG label probe 100ng/ml, 68 DEG C are spent the night, film is washed each 2 times successively, each 15 minutes (above operation refers to the molecular cloning third edition) through 2 × SSC (containing 0.1%SDS), 0.5 × SSC (containing 0.1%SDS), 0.1 × SSC (containing 0.1%SDS).Add 1 × Blocking buffer room temperature in DIG High Prime DNA Labeling andDetection Starter Kit II and close 30 minutes, add the Anti-DIG-AP of 1 × Blockingbuffer dilution (1: 10000) again, room temperature is closed and is washed film after 30 minutes, carries out CSPD chemiluminescence detection (referring to test kit specification sheets).
Result as shown in Figure 3, HDAdJFH1 7 is the 7th day cell (the infectious cell model of the HDAd-HCV obtained by above-mentioned) after HDAd-HCV virus infection, HDAdJFH1 14 is the 14th day cell (the infectious cell model of the HDAd-HCV obtained by above-mentioned) after HDAd-HCV virus infection, HDAdJFH1 21 is the 21st day cell (the infectious cell model of the HDAd-HCV obtained by above-mentioned) after HDAd-HCV virus infection, the compared with control cells that HDAdGFP obtains for empty for HDAd virus (by 100vp/cell) being infected Huh7 cell, PC RNA is the positive control of above-mentioned preparation, Huh7 is normal Huh7 cell, can find out, infect latter 7th day, 14 days, 21 days, all HCV RNA can be detected.
3, real-time quantitative PCR detects HCV rna level in lysis composition and cells and supernatant
The cell of different time points and supernatant liquor (cell of the infectious cell model of the HDAd-HCV obtained by above-mentioned one and supernatant liquor) after getting HDAd-HCV virus infection, Qiagen company RNeasy Mini Kit and QIAamp Viral RNA Mini Kit is used to extract RNA respectively, wherein cell total rna gets 500ng, supernatant RNA gets 6ul, reverse transcription reaction is carried out: 2ul 5 × M-MLV Buffer+0.5ul dNTP Mix+0.5ulRandom 6mers+0.25ul M-MLV reversed transcriptive enzyme+0.25ul RNase Inhibitor+RNA by following system, supply RNaseFree H
2o to 10ul, reverse transcription reaction condition be 42 DEG C 60 minutes.PJFH1 is equivalent to 10 by 0.1ng
7copies is diluted to standard substance 10 successively
7copies/mL, 10
6copies/mL, 10
5copies/mL, 10
4copies/mL, HCV real-time quantitative PCR design of primers is as follows: HCV-real-F:cgacactccgccatgaatc, HCV-real-R:ccatggctaggcgctttc, prepare following PCR system: 9ul SYBR Mix+0.5ulHCV-real-F (10uM)+0.5ul HCV-real-R (10uM)+cDNA, supply ddH
2o to 20ul, real-time quantitative PCR condition is: 95 DEG C of denaturations 2 minutes; 94 DEG C of sex change 15 seconds, 55 DEG C of annealing 15 seconds, 68 DEG C extend 30 seconds, and 2-4 walks 40 circulations.According to standard substance Ct value drawing standard curve (Ct=40.58-3.625Log [HCV copy number]), it is quantitative to carry out HCV RNA.
Result as shown in Figure 4, can be found out, the HCV RNA titre levels of the cell in the infectious cell model of the HDAd-HCV obtained by above-mentioned is by infecting latter 2nd day 3.6 × 10
8copies/ μ g cellular RNA is down to the 26th day 8.6 × 10 gradually
6the HCV rna level of the cell conditioned medium in the infectious cell model of copies/ μ g cellular RNA, the HDAd-HCV obtained by above-mentioned is first increased to the 16th day peak value 8.95 × 10 gradually
6copies/ml, then drops to the 26th day 1.9 × 10 gradually
5copies/ml.
4, the infectious cell model of HDAd-HCV infects HCV infection detection in Huh7 cells and supernatant
Different time points is collected and infects normal Huh7 cell and normal HepG2 cell more respectively by the culture supernatant in the infectious cell model of above-mentioned one HDAd-HCV obtained, detect again HCV core and NS3 in cells infected by indirect immunofluorescence and express (method is the same).
Determine whether supernatant has the result of HCV infection as shown in Figure 5, the culture supernatant of the infectious cell model of above-mentioned one HDAd-HCV obtained infects normal Huh7 cellmediated immunity Fluorometric assay HCV core and NS3 again and is the positive (in Fig. 5), and the culture supernatant of the infectious cell model of the HDAd-HCV that above-mentioned obtains infects normal HepG again
2cellmediated immunity Fluorometric assay HCV core and NS3 is feminine gender (Fig. 5 is right), illustrate that infecting is that the HCV produced in supernatant causes, instead of HDAd-HCV virus causes.
Different time points is collected HCV-Ab IgG E2 monoclonal antibody (the Santa Cruz company being added serial dilution by the culture supernatant of the infectious cell model of above-mentioned one HDAd-HCV obtained, sc-65457) 1,5,10ug/ml) and anti-human CD81 monoclonal antibody (Santa Cruz company, sc-70803,0.5,5,25ug/ml), (directly antibody is added with neutralizing antibody suppressing method, hatch after 1 hour for 37 DEG C and carry out Real_time quantitative detection to HCV RNA in Huh7 cell, method is the same) detect whether block HCV infection.
Whether observation blocks the result of HCV infection as shown in Figure 6 and Figure 7, wherein Fig. 6 is for adding anti-human CD81 monoclonal antibody, Fig. 7 is for adding HCV-Ab IgG E2 monoclonal antibody, can find out, add HCV-Ab IgG E2 monoclonal antibody and anti-human CD81 monoclonal antibody all can block (the Fig. 6 and 7 of HCV infection in supernatant, HCV RNA copy number reduces), also illustrate in supernatant and produce infectious HCV virus.
5, the infectious cell model of HDAd-HCV infects HCV virus transmission electron microscope observing in Huh7 cell and culture supernatant
Different time points is collected by the cell in the infectious cell model of above-mentioned one HDAd-HCV obtained and culture supernatant, be fixed and electron microscopic sample preparation, whether electron microscopic observation produces HCV virion, cell carries out transmission electron microscope observing, add Anti-HCV E2 monoclonal antibody in culture supernatant successively and Radioactive colloidal gold (10nm) marks goat anti-mouse IgG, carry out immune electron microscopy.
Result as shown in Figure 8, A is that HDAd-HCV infects the 8th day Huh7 cell transmission electron microscope results (24000 times), B is that A amplifies (65000 times) with the visual field, C is that to infect the 8th day Huh7 cell conditioned medium immuno-electron microscope result (93000 times), D be that C amplifies (135000 times) with the visual field to HDAd-HCV, arrow indication is virion, can find out and observe state of coat virion, and viral size is about 60nm, this describes consistent with document about HCV.
Three, by IFN-α HCV-Ab IgG evaluation in the infectious cell model of above-mentioned one HDAd-HCV obtained
Add in the cell of the 8th day after infection in the infectious cell model of the HDAd-HCV that obtains by above-mentioned one and add different concns 0 successively, 0.04,2.0,10, (the outstanding China in Beijing is biological for the IFN-α of 50 (units/ml), A20070913), continue to cultivate 72h as experimental group.With Huh7 cell for control group.
Adopt HCV NS3 differential expression in Western-blot method (ditto) analysis design mothod group and cellular control unit, result shows as shown in Figure 9, and IFN-α effectively can suppress HCV copying in Huh7 cell.
Above result shows, the novel HCV full-length genome cell model of HDAd mediation, realizes that HCV is long-term, efficient stable copies expressions, it is viral to produce infectious HCV, and can Preliminary Applications in anti-HCV medicament evaluation.
The foundation of III, HDAd-HCV virus infection C57BL/6 mouse model and application thereof
One, the foundation of HDAd-HCV virus infection C57BL/6 mouse model
Experimental group and control group respectively get 8 C57BL/6 mouse, and experimental group every mouse is through tail vein injection about 1 × 10
10the HDAd-HCV virus that vp is obtained by above-mentioned I, the HDAdGFP virus that control group is obtained by above-mentioned I through tail vein injection equivalent, obtains HDAd-HCV virus infection C57BL/6 mouse model and control group model respectively.
Two, HDAd-HCV virus infection C57BL/6 mouse model qualification
1, in HDAd-HCV virus infection C57BL/6 Mice Body, HCV expresses and copy detection
The HDAd-HCV virus infection C57BL/6 mouse model obtained above-mentioned one and control group model carry out hepatic tissue on the 3rd, 7,14 day after infection and draw materials, and part is for extracting total protein and total serum IgE.Use the tissue protein lysate of following formula: 10mM 1M Tris-HCl, 1% (V/V) Triton X-100,1% (V/V) sodium deoxycholate, 0.1% (V/V) 10% (g/ml) SDS, 0.4% (V/V) NP-40,150mM NaCl, 5mM EDTA, 0.2mM sodium orthovanadate, distilled water constant volume.In tissue protein lysate, add proteinase inhibitor Aprotinin, PepstatinA, Leupeptin, PMSF respectively before extraction, make its final concentration be respectively 2 μ g/ml, 0.7 μ g/ml, 0.5 μ g/ml, lmM.
The concrete grammar of total protein extraction is organized to be: to get and be no more than 30mg hepatic tissue, add above-mentioned tissue protein lysate and 4 kinds of proteinase inhibitor, after T10 basic ULTRA-TURRAX dispersion machine 5 grades of homogenate 40S, ice bath 30min, every 5min shakes even 1 time, 13000rpm 4 DEG C of centrifugal 15min, supernatant is total protein solution.The concrete grammar of Total RNAs extraction is: get and be no more than 30mg hepatic tissue, add RLT solution 600ul and 6ul β mercaptoethanol in Qiagen company RNeasy Mini Kit, after T10basic ULTRA-TURRAX dispersion machine 5 grades of homogenate 40S, Qiagen company RNeasy Mini Kit is used to extract total serum IgE (specification sheets is shown in operation).
Western blot method detects HCV core and NS3 expression (method is the same) in different time points hepatic tissue, and as shown in Figure 10, after infecting, in the 3rd day, 7 days, 14 days murine liver tissue, HCV core and NS3 all expresses result;
Northern blot method detects HCV rna expression situation (method is the same) in different time points hepatic tissue, and as shown in figure 11, after HDAd-HCV virus infection, in the 3rd day, 7 days, 14 days murine liver tissue, HCV RNA all expresses result;
Real-time quantitative PCR detects HCV rna level in mice serum, result as shown in figure 12, after HDAd-HCV virus infection in murine liver tissue HCV RNA mean level (ML) by the 1st week 1.2 × 10
5copies/ml rises to 2 × 10
5copies/ml, then drops to the 8th week 2 × 10 gradually
4copies/ml.
2, HDAd-HCV virus infection C57BL/6 murine liver tissue HE and immunohistochemical methods detect
The hepatic tissue of the above-mentioned one HDAd-HCV virus infection C57BL/6 mouse model obtained and control group model is fixed with 4% formaldehyde stationary liquid, makes paraffin section, and HE staining analysis hepatic tissue pathology changes.Immunohistochemical analysis hepatic tissue HCV core expresses, operate as follows: roasting sheet 1 hour in 60 DEG C of constant temperature ovens, dimethylbenzene dewaxes 2 times, each 20 minutes, then successively through 100%, 95%, 80%, 70% ethanol, each 5 minutes, running water 2 times, distilled water flushing 2 times, PBS damping fluid embathes 5 minutes, totally 3 times.3%H
2o
2incubated at room 10 minutes, distilled water flushing.Antigen retrieval damping fluid (0.01M citric acid-sodium citrate damping fluid, PH6.0) 98 DEG C of Microwave methods 5 minutes, naturally cool to room temperature, PBS damping fluid embathes 5 minutes, totally 3 times, Normal Goat Serum closes 10 minutes, add primary antibodie Anti-HCV core monoclonal antibody (1: 500 dilution), 4 DEG C of wet boxes spend the night, PBS damping fluid washes 5 minutes, totally 3 times, add two anti-HRP and mark goat anti-mouse IgG (1: 100 dilution), hatch 30 minutes for 37 DEG C, PBS damping fluid washes 5 minutes, totally 3 times, DAB develops the color, Hematorylin lining dye, running water, the color separation of acid alcohol, running water, successively through 70% ethanol, 80% ethanol, 95% ethanol, each 2 minutes of 100% ethanol, transparent 5 minutes of dimethylbenzene, totally 2 times, neutral gum mounting, basis of microscopic observation is taken pictures.
As shown in figure 14, A and C is respectively the empty virus infected mice hepatic tissue HCV core immunohistochemical methods of HDAdGFP and HE coloration result to result, B and D is respectively HDAd-HCV virus infection C57BL/6 mouse the 1st week hepatic tissue HCV core immunohistochemical methods and HE coloration result; HCV core albumen has expression (Figure 14 B) at HDAd-HCV virus infection C57BL/6 mouse the 1st week hepatic tissue, HE coloration result shows, HDAd-HCV virus infection C57BL/6 mouse has obvious inflammatory lymphocytes to infiltrate in hepatic tissue on the 1st week, with apoptosis (Figure 14 D).
3, ALT level detection in HDAd-HCV virus infection C57BL/6 mice serum
The serum alt level of HDAd-HCV virus infection C57BL/6 mouse model and control group model adopts FujiDRI-CHEM 7000 Biochemical Analyzer to detect (automatically being detected by animal center biochemical room instrument), result as shown in figure 13, in HDAd-HCV virus infection C57BL/6 mice serum, ALT level reaches maximum value 199.4 ± 53.1IU/L on the 2nd week, then decline gradually, and in HDAdGFP virus infection C57BL/6 mice serum there is not considerable change in ALT level.
Three, the application of HDAd-HCV virus infection C57BL/6 mouse model
Evaluate for HCV-Ab IgG small-molecule drug: existing document display (Therapeutic silencing ofmicroRNA-122 in primates with chronic hepatitis C virus infection.Science 2010,327:198-201.), the microRNA-122 antagonistic molecule utilizing lock nucleic acid (LNA) to modify can suppress HCV to copy by partial extent in chimpanzee body, therefore, this experiment utilizes and is evaluated LNA-antimiR-122 molecule anti-hcv activity by the above-mentioned one HDAd-HCV virus infection C57BL/6 mouse model obtained.
Design LNA-antimiR-122 sequence is as follows: (capitalization is that LNA modifies to 5 '-ccAttGtcAcamCtcCa-3 ', lowercase is unmodified dna, microRNA-122 antagonistic molecule after modification is that direct labor synthesizes), design Mismatch controls molecule mismatch control LNA as follows: 5 '-ccAttGtcTcaAtcCa-3 ' (upper and lower case letter implication is the same) simultaneously.
Experimental mice (HDAdHCV+antimiR-122: simultaneously inject 1 × 10 by tail vein
10vpHDAd-HCV virus and 100 μ g LNA-antimiR-122 molecules;
Control group mice (HDAdHCV+control): simultaneously inject 1 × 10
10vp HDAd-HCV virus and 100 μ gmismatch control LNA molecules.
Got part hepatic tissue respectively at the 3rd day, 7 days, 14 days and carry out Northern blot method detection HCV rna expression situation (method is the same), gather mice serum real-time quantitative PCR week about and detect HCV rna level in mice serum.。
Result as shown in figure 15, A is murine liver tissue HCV RNANorthern blot result, PC RNA is that the JFH1RNA of in-vitro transcription is (by pJFH1 after Xbal I linearizing, use MEGAscript T7RNA in-vitro transcription test kit to carry out in-vitro transcription (explanation is shown in operation), obtain PC RNA); NC RNA is the total serum IgE that normal C57BL/6 murine liver tissue is extracted; HDAdGFP injects the empty virus of the HDAd obtained by above-mentioned I (by 1 × 10
10vp) to the control group model that mouse tail vein obtains, can find out, in HDAd-HCV virus infection C57BL/6 mouse model, LNA-antimiR-122 molecule has suppression HCV effect
B is mice serum HCV RNA real-time quantitative result; Can find out further, in HDAd-HCV virus infection C57BL/6 mouse model, LNA-antimiR-122 molecule has suppression HCV effect.
Above result shows, the present invention successfully sets up the novel HCV full-length genome mouse model of HDAd mediation, realizes copying expression in HCV certain hour, can Preliminary Applications study in anti-HCV medicament evaluation and acute infection damage mechanisms.
Claims (1)
1. a recombinant adenoviral vector, for inserting the carrier obtained between the I-Ceu I of adenovirus carrier HDAd and I-Sce I site by the Nucleotide shown in sequence in sequence table 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110411318.5A CN102517330B (en) | 2011-12-12 | 2011-12-12 | Adenovirus vector and its application in preparing HCV cell and mouse models |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110411318.5A CN102517330B (en) | 2011-12-12 | 2011-12-12 | Adenovirus vector and its application in preparing HCV cell and mouse models |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102517330A CN102517330A (en) | 2012-06-27 |
| CN102517330B true CN102517330B (en) | 2015-07-08 |
Family
ID=46288396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110411318.5A Active CN102517330B (en) | 2011-12-12 | 2011-12-12 | Adenovirus vector and its application in preparing HCV cell and mouse models |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102517330B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748149A (en) * | 2009-12-24 | 2010-06-23 | 中国人民解放军军事医学科学院微生物流行病研究所 | Plasmid containing HCV genome, cell, system and method for screening drug |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101012463A (en) * | 2007-01-19 | 2007-08-08 | 安徽医科大学 | HDAd/F carrier and method for preparation and use |
-
2011
- 2011-12-12 CN CN201110411318.5A patent/CN102517330B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748149A (en) * | 2009-12-24 | 2010-06-23 | 中国人民解放军军事医学科学院微生物流行病研究所 | Plasmid containing HCV genome, cell, system and method for screening drug |
Non-Patent Citations (1)
| Title |
|---|
| Prolonged Peritoneal Gene Expression Using A Helper-Dependent Adenovirus;Limin Liu等;《Peritoneal Dialysis International》;20090930;第29卷(第5期);508-516 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102517330A (en) | 2012-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jangra et al. | DDX6 (Rck/p54) is required for efficient hepatitis C virus replication but not for internal ribosome entry site-directed translation | |
| Yang et al. | Hepatitis B virus-encoded microRNA controls viral replication | |
| Wang et al. | MiR-125b reduces porcine reproductive and respiratory syndrome virus replication by negatively regulating the NF-κB pathway | |
| Chen et al. | Adenovirus-mediated RNA interference against foot-and-mouth disease virus infection both in vitro and in vivo | |
| Fukuhara et al. | Expression of microRNA miR-122 facilitates an efficient replication in nonhepatic cells upon infection with hepatitis C virus | |
| Silvestri et al. | Rotavirus replication: plus-sense templates for double-stranded RNA synthesis are made in viroplasms | |
| Pudupakam et al. | Mutational analysis of the hypervariable region of hepatitis e virus reveals its involvement in the efficiency of viral RNA replication | |
| Jangra et al. | Regulation of hepatitis C virus translation and infectious virus production by the microRNA miR-122 | |
| Li et al. | hnRNP L and NF90 interact with hepatitis C virus 5′-terminal untranslated RNA and promote efficient replication | |
| Hayes et al. | Hepatitis B virus-specific miRNAs and Argonaute2 play a role in the viral life cycle | |
| Arzberger et al. | Apoptosis of hepatitis B virus-infected hepatocytes prevents release of infectious virus | |
| Yang et al. | Inhibition of hepatitis C virus replication using adeno‐associated virus vector delivery of an exogenous anti–hepatitis C virus microrna cluster | |
| Lei et al. | Functional interaction between cellular p100 and the dengue virus 3′ UTR | |
| Li et al. | Infection of common marmosets with hepatitis C virus/GB virus‐B chimeras | |
| Zhao et al. | Circular RNA CircEZH2 suppresses transmissible gastroenteritis coronavirus-induced opening of mitochondrial permeability transition pore via targeting MiR-22 in IPEC-J2 | |
| Bokharaei‐Salim et al. | Prevalence of occult hepatitis C virus infection in the Iranian patients with human immunodeficiency virus infection | |
| Zhang et al. | The FUSE binding protein is a cellular factor required for efficient replication of hepatitis C virus | |
| Ding et al. | HCV infection induces the upregulation of miR-221 in NF-κB dependent manner | |
| Klepper et al. | Hepatitis C virus double‐stranded RNA is the predominant form in human liver and in interferon‐treated cells | |
| Tang et al. | Application of siRNA against SARS in the rhesus macaque model | |
| Cai et al. | Swine Interferon-Inducible transmembrane proteins potently inhibit african swine fever virus replication | |
| Lambeth et al. | Suppression of bovine viral diarrhea virus replication by small interfering RNA and short hairpin RNA-mediated RNA interference | |
| Ma et al. | Significant inhibition of two different genotypes of grass carp reovirus in vitro using multiple shRNAs expression vectors | |
| Liu et al. | A DNA-launched reverse genetics system for rabbit hemorrhagic disease virus reveals that the VP2 protein is not essential for virus infectivity | |
| Teimourpour et al. | Viral load analysis of hepatitis C virus in Huh7. 5 cell culture system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |