CN102517291A - Fumonisins B1 aptamer and applications thereof - Google Patents
Fumonisins B1 aptamer and applications thereof Download PDFInfo
- Publication number
- CN102517291A CN102517291A CN201110380354XA CN201110380354A CN102517291A CN 102517291 A CN102517291 A CN 102517291A CN 201110380354X A CN201110380354X A CN 201110380354XA CN 201110380354 A CN201110380354 A CN 201110380354A CN 102517291 A CN102517291 A CN 102517291A
- Authority
- CN
- China
- Prior art keywords
- fumonisin
- aptamer
- nucleotide sequence
- application
- fumonisins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to an aptamer combined with high specificity and high affinity of Fumonisins B1 and applications thereof. The aptamer can be used for detection and analysis and separation and concentration of the Fumonisins B1, and has the characteristics of high specificity, high affinity, uniform quality, high stability, short development cycle, low production cost and convenience in use. The invention also relates to sequences derived from aptamer sequences, which comprise modified sequences.
Description
(1) technical field:
The invention belongs to biological technical field, relate to----SELEX technical project of utilizing Protocols in Molecular Biology and preparation a kind of with fumonisin B1 high specific and high-affinity bonded fumonisin B1 aptamer and application thereof.
(2) background technology:
Fumonisin (Fumoni sins; FB) mainly be the secondary metabolite that produces by fungi F.moniliforme and F.proliferatum; Be the diester compound of the pure and mild tricarballylic acid of many hydrogen, there is wide range in it, all can be contaminated to fruit such as bananas from the grain to cereal; And be present in each links such as processing, storage, transportation, through processes such as grain processing, fodder prodn livestock industry and even human health are produced more serious harm.Fumonisin mainly comprised fumonisins B1, B2 and B3, wherein is fumonisin B1 (FB1) more than 60%, and FB1 is the strongest fumonisin of toxicity, from the corn that goes mouldy, separated obtaining first in the researchist by the South Africa and the U.S. in 1988.Horse is to the most responsive animal of volt horse verticillium toxin, and volt horse verticillium toxin toxinosis has horse alba malacopathia, pig wet lung disease, fowl high mortality or poisonous feed syndromes etc., and in addition, it is active that fumonisins also shows short cancer.Because all existing animal and human's class health, volt horse verticillium toxin seriously influences, normally the mycotoxins that will worry of food and feed owner.
The detection method of fumonisins has vapor-phase chromatography (GC), HPLC (HPLC), thin layer chromatography (TLC), liquid phase one mass spectrometry (LC-MS), capillary electrophoresis, enzyme linked immunological (ELISA) etc.Though aforementioned these methods have higher susceptibility and specificity, need complicated purification purification step and more valuable plant and instrument, be difficult for promoting the use of; The characteristics that have simple rapid sensitive based on the ELISA detection technique of monoclonal antibody or polyclonal antibody; Can detect a large amount of samples simultaneously; Compare with the LC-MS method with the HPLC method, have highly sensitive, disturb less, determination step is easy, quick, operational safety, facility investment are few, measure result's advantage accurately and reliably.Yet; For this toxicity small molecules of FB; The preparation cycle of its antibody is long, production cost is high, technical difficulty is big, differences between batches are big, clone strain (cell) is difficult to difficult problems such as effectively preservations, big limitations the technological fast development of immunology detection such as enzyme-linked immunosorbent assay.Aptamer (aptamer) is better as a specific specificity, avidity is higher, the antibody surrogate article of quality homogeneous, good stability; Widely approved in the check and analysis Application for Field; And have the advantages that the construction cycle is short, production cost is low, easy to use; Therefore, aptamer has a good application prospect in the micromolecular rapid detection of this toxicity of FB.
(3) summary of the invention:
The object of the present invention is to provide a kind of adopt that SELEX technology screening of new generation obtains can be fit with fumonisin B1 high specific and high-affinity bonded Structure Conversion signal; And the application method of fumonisin B1 aptamer in fumonisin B1 check and analysis and sample separation enrichment be provided; Have easy, quick, economic dispatch characteristics; Compare the many advantages of fit tool that from oligonucleotide library, filter out with other combinatorial chemical libraries such as random peptide library, antibody library and phage display library.
Technical scheme of the present invention:
A kind of fumonisin B1 aptamer is characterized in that it is a nucleotide sequence
Dna molecular shown in GCATCACTACAGTCATTACGCATCGCGAGGGGACGGGAACGCGCTGAAGGGAGGCC TAGGATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.
The verivate of said fumonisin B1 aptamer has the identical function purposes.
The verivate of said fumonisin B1 aptamer is that nucleotide sequence carries out amination or sulfhydrylation or isotropic substance modification.
The verivate of said fumonisin B1 aptamer is that nucleotide sequence combines vitamin H or enzyme or digoxin or fluorescent substance or nano luminescent material.
A kind of application of fumonisin B1 aptamer is characterized in that fumonisin B1 aptamer is used for the check and analysis of fumonisin B1, and it may further comprise the steps:
(1) the competition plate is prepared: 50 μ g/ml arm molecule aminopropyltriethoxywerene werene or poly-lysine 100 μ l encapsulate in 4 ℃ and spend the night; Linking agent time phenylene diisothiocyanic acid salt or LUTARALDEHYDE activation 6h; The 100 μ l couplings of 200-2000pmol/ml NH2-primer, 0.2mol/L thanomin or glycocoll sealing 2h, sodium borohydride reduction; The 1%BSA sealing, PBS washing back is subsequent use;
(2) detect step:
1. fumonisin B1 aptamer 5-10pmol, 94 ℃ of 3min, 5min sex change on ice;
2. with 0-100pmol target mixing, TV 100 μ l add in the entering plate incubated at room 30min;
3. draw 50 μ l and add in the fluorescent plate, add 1: 200 OliGreen 100 μ l, effect 5min;
4. measure fluorescent value (Ex:485nm, Em:525nm).
Typical curve: through 6 revision tests, being ordinate zou with fluorescence numerical value, is X-coordinate with the normal concentration, does typical curve.
Sensitivity calculations: through 6 revision tests, the target content of detection is 0ng/ml ± 3*STDV.
Repeatability: standard specimen replication 5 times, calculate it and measure plastisied dispersion CV value.
The recovery: with the dilution of corn methanol extract is sample for 50 times, adds basic, normal, high concentration standard, and replication 3 times calculates its recovery.
FB1 detection kit: detection sensitivity: 0.024ng/ml, repeatability: CV<6%
With corn homogenate methanol extract is sample dilution in 1: 50, and the recovery is seen table:
A kind of application of fumonisin B1 aptamer is characterized in that fumonisin B1 aptamer is used for from sample separation, enrichment fumonisin B1, and it may further comprise the steps:
(1) coupling there is the magnetic particle of fumonisin B1 aptamer and treats the isolating solution thorough mixing that contains fumonisin B1;
(2) with magnetic separator enrichment magnetic particle, and clean, have the magnetic particle of aptamer to dissociate from coupling fumonisin B1 then, obtain fumonisin B1 single-component.
A kind of application of complementary sequence of fumonisin B1 aptamer is characterized in that being applied in fumonisin B1 check and analysis, may further comprise the steps:
1. fumonisin B1 detects chromatograph test strip, and its substruction is formed and comprised: supporting pad, Radioactive colloidal gold pad, nitrocellulose filter, absorbent pad etc.;
2. contain aggregates of nanoparticles (through biotin labeling) the 6 μ l that aptamer and its complementary sequence are assembled on the Radioactive colloidal gold pad, contain the detection line of 1-10mg/ml Streptavidin 2 μ l on the nitrocellulose filter;
When 3. detecting, test strip baffle end is inserted in the solution of testing sample, about 20s, the complete moistening web plate of liquid also gets into film; Take out paper slip, be placed on and let liquid continue to flow on the platform, if do not have target in the liquid to be measured, aggregate is bigger; Can not get into nitrocellulose filter with flow, not develop the color, if there is target fumonisin B1 to exist in the liquid to be measured; The aggregate that can cause assembling dissociates and forms the dispersive nano particle, and the dispersive nano particle gets into cellulose membrane with flow, and Streptavidin combines on the biotin labeling thing on the nano particle and the film; Showing red, is positive result, and colour developing degree and the proportional relation of target concentration.
The characteristic evaluation and test of a kind of fumonisin B1 of the present invention aptamer:
1, fluorescence quantitative PCR method is estimated the activity of fumonisin B1 aptamer:
Thorough washing assembling (realizing through its complementary sequence) has the magnetic particle of fumonisin B1 aptamer, and the fumonisin B1 with final concentration 1 μ M is at war with room temperature reaction 30min then.With the competing reaction product is that template is carried out the quantitative fluorescent PCR reaction; Adopt the test kit Platinum SYBR Green qPCR SuperMix-UDG of Invitrogen company; Contain template 2 μ l, primer P1, each 20pmol of P2 in the 20 μ l systems, 65 ℃ of annealing temperatures.Be provided with simultaneously with the control group of solvent methanol as the competition thing.
The result:
It is thus clear that fumonisin B1 aptamer has the specificity affinity to fumonisin B1.
2, dye method is estimated the activity of fumonisin B1 aptamer
Thorough washing assembling (realizing through its complementary sequence) has the magnetic particle of fumonisin B1 aptamer, and the fumonisin B1 with final concentration 1 μ M is at war with room temperature reaction 30min then.After the Oligreen dyestuff diluted by 1: 200 with binding buffer liquid, equal proportion added in the competing reaction liquid, and room temperature lucifuge reaction 2-5min uses the 480nm optical excitation, measures the emission light at 520nm place.Be provided with simultaneously with control group and the binding buffer liquid background control group of methyl alcohol as the competition thing.
The background control group does not detect emission light as a result, and the experimental group fluorescence intensity is significantly higher than the methyl alcohol control group, and visible fumonisin B1 aptamer has the specificity affinity to fumonisin B1.
3, through the activity rating of the fumonisin B1 of base group modification aptamer:
According to the active method of fluorescence quantitative PCR method evaluation fumonisin B1 aptamer, carry out the fumonisin B1 aptamer of amination fumonisin B1 aptamer, sulfhydrylation fumonisin B1 aptamer, isotropic substance fumonisin B1 aptamer, biotin labeled fumonisin B1 aptamer, HRP mark, the fumonisin B1 aptamer of AP mark, the fumonisin B1 aptamer of digoxigenin labeled, the fumonisin B1 aptamer and the nano luminescent material Y of TAMRA mark respectively with fluorescence quantitative PCR method
2SiO
5: the activity rating of the fumonisin B1 aptamer of Eu mark.
The result:
It is thus clear that amination fumonisin B1 aptamer; Sulfhydrylation fumonisin B1 aptamer; Isotropic substance fumonisin B1 aptamer; Biotin labeled fumonisin B1 aptamer; The fumonisin B1 aptamer of HRP mark; The fumonisin B1 aptamer of AP mark; The fumonisin B1 aptamer of digoxigenin labeled; The fumonisin B1 aptamer of TAMRA mark; And the fumonisin B1 aptamer of nano luminescent material Y2SiO5:Eu mark all has the specificity affinity to fumonisin B1.
Advantage of the present invention is: itself be oligonucleotide 1), molecular weight is less, can chemosynthesis, practice thrift cost; 2) have affinity and the specificity higher than antibody; 3) be convenient to mark and can be at different sites mark selectively; 4) repeatability and good stability, and be easy to preserve, promptly insensitive with violent condition to high temperature; 5) the aptamer technology has a good application prospect, particularly in the check and analysis field.
(4) embodiment:
Embodiment: a kind of fumonisin B1 aptamer is characterized in that being nucleotide sequence
Dna molecular shown in GCATCACTACAGTCATTACGCATCGCGAGGGGACGGGAACGCGCTGAAGGGAGGCC TAGGATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.
The single stranded DNA that is used for SELEX among the present invention is synthetic by Takara company with hangar and primer; Two ends are fixed sequence program; The centre is the stochastic sequence of 35 bases: 5 ' GCATCACTACAGTCATTACGCATCG-(N35)-ATCGTGTGAAGTGCTGTCCC 3 '; Storage capacity is more than 1014, primer 1:5 ' GCATCACTACAGTCATTACGCA-3 ', primer 2: 5 ' GGGACAGCACTTCACACGAT 3 '; Primer 3:5 ' GCGTAATGACAAAAAAAAAAACAT-C6-NH23 ', primer 4:5 ' Biotin-GGGACAGCACTTCACACGAT 3 '.Fumonisin B1 is available from ALEXIS company, and magnetic bead is purchased the company in invitrogen, and the purified reagent of oligonucleotide is purchased the company in Qiagen, and PCR test kit and T carrier are purchased the company in Pu Luomaige (Promega).
A kind of screening preparation of fumonisin B1 aptamer:
Initial library is coupled on the magnetic particle through complementary sequence, is that anti-sieve element, fumonisin B1 serve as that the screening molecule screens with solvent.In the presence of fumonisin B1, there is the oligonucleotide sequence of binding ability to dissociate from the magnetic particle with it, behind pcr amplification, adopt affine separation and purification method to prepare secondary library, repeat to screen 8 and take turns, cloning and sequencing, the mono-clonal aptamer of acquisition fumonisin B1.
A kind of application of fumonisin B1 aptamer is characterized in that fumonisin B1 aptamer is used for the check and analysis of fumonisin B1, and it may further comprise the steps:
(1) the competition plate is prepared: and poly-lysine (50 μ g/ml, CBS) 100 μ l encapsulate in 4 ℃ and spend the night LUTARALDEHYDE (2.5%; PBS) activation 6h, NH2-primer (2000pmol/ml, PBS) 100 μ l couplings; Thanomin (0.2mol/L, pH8.0) sealing 2h, sodium borohydride reduction; BSA (1%, PBS) sealing, PBS washing back is subsequent use;
(2) detect step:
1. fumonisin B1 aptamer 5-10pmol, 94 ℃ of 3min, 5min sex change on ice;
2. with target (0-100pmol) mixing, TV 100 μ l add in the entering plate incubated at room 30min;
3. draw 50 μ l and add in the fluorescent plate, add 100 μ l OliGreen (1: 200, TAE), effect 5min;
4. measure fluorescent value (Ex:485nm, Em:525nm).
Typical curve: through 6 revision tests, being ordinate zou with fluorescence numerical value, is X-coordinate with the normal concentration, does typical curve.
Sensitivity calculations: through 6 revision tests, the target content of detection is 0ng/ml ± 3*STDV.
Repeatability: standard specimen replication 5 times, calculate it and measure plastisied dispersion CV value.
The recovery: with the dilution of corn methanol extract is sample for 50 times, adds basic, normal, high concentration standard, and replication 3 times calculates its recovery.
FB1 detection kit: detection sensitivity: 0.024ng/ml, repeatability: CV<6%.
With corn homogenate methanol extract is sample dilution in 1: 50, and the recovery is seen table:
A kind of application of fumonisin B1 aptamer is characterized in that fumonisin B1 aptamer is used for from sample separation, enrichment fumonisin B1, and it may further comprise the steps:
(1) coupling there is the magnetic particle of fumonisin B1 aptamer and treats the isolating solution thorough mixing that contains fumonisin B1;
(2) with magnetic separator enrichment magnetic particle, and clean, have the magnetic particle of aptamer to dissociate from coupling fumonisin B1 then, obtain fumonisin B1 single-component.
A kind of application of complementary sequence of fumonisin B1 aptamer is characterized in that being applied in fumonisin B1 check and analysis, may further comprise the steps:
1. fumonisin B1 detects chromatograph test strip, and its substruction is formed and comprised: supporting pad, Radioactive colloidal gold pad, nitrocellulose filter, absorbent pad etc.;
2. contain aggregates of nanoparticles (through biotin labeling) the 6 μ l that aptamer and its complementary sequence are assembled on the Radioactive colloidal gold pad, contain the detection line of 10mg/ml Streptavidin 2 μ l on the nitrocellulose filter;
When 3. detecting, test strip baffle end is inserted in the solution of testing sample, about 20s, the complete moistening web plate of liquid also gets into film; Take out paper slip, be placed on and let liquid continue to flow on the platform, if do not have target in the liquid to be measured, aggregate is bigger; Can not get into nitrocellulose filter with flow, not develop the color, if there is target fumonisin B1 to exist in the liquid to be measured; The aggregate that can cause assembling dissociates and forms the dispersive nano particle, and the dispersive nano particle gets into cellulose membrane with flow, and Streptavidin combines on the biotin labeling thing on the nano particle and the film; Showing red, is positive result, and colour developing degree and the proportional relation of target concentration.
Claims (6)
1. a fumonisin B1 aptamer is characterized in that it is the dna molecular shown in nucleotide sequence GCATCACTACAGTCATTACGCATCGCGAGGGGACGGGAACGCGCTGAAGGGAGGCC TAGGATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.
2. according to the said a kind of fumonisin B1 aptamer of claim 1, it is characterized in that the verivate that has the identical function purposes with said fumonisin B1 aptamer is that nucleotide sequence carries out amination or sulfhydrylation or isotropic substance modification.
3. according to the said a kind of fumonisin B1 aptamer of claim 1, it is characterized in that the verivate that has the identical function purposes with said fumonisin B1 aptamer is that nucleotide sequence combines vitamin H or enzyme or digoxin or fluorescent substance or nano luminescent material.
4. the application of the said fumonisin B1 of claim 1 aptamer is characterized in that being used for the check and analysis of fumonisin B1.
5. the application of the said fumonisin B1 of claim 1 aptamer is characterized in that being used for from sample separation, enrichment fumonisin B1.
6. the application of claim 2 or 3 said fumonisin B1 nucleic acid aptamer derivative is characterized in that being applied in fumonisin B1 check and analysis and the separation and concentration.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110380354XA CN102517291A (en) | 2011-11-25 | 2011-11-25 | Fumonisins B1 aptamer and applications thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110380354XA CN102517291A (en) | 2011-11-25 | 2011-11-25 | Fumonisins B1 aptamer and applications thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN102517291A true CN102517291A (en) | 2012-06-27 |
Family
ID=46288358
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201110380354XA Pending CN102517291A (en) | 2011-11-25 | 2011-11-25 | Fumonisins B1 aptamer and applications thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102517291A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103013999A (en) * | 2012-11-22 | 2013-04-03 | 江南大学 | Oligonucleotides aptamer special for distinguishing fumonisin B1 |
CN103901000A (en) * | 2012-12-26 | 2014-07-02 | 江南大学 | Method for detecting fumonisin B1 based on fluorescence resonance energy transfer |
CN105543231A (en) * | 2016-01-11 | 2016-05-04 | 河南省农业科学院农业质量标准与检测技术研究所 | Screening and application of fumonisin B1 aptamer strand displacement probe |
CN106596812A (en) * | 2017-01-16 | 2017-04-26 | 北京美正生物科技有限公司 | Fumonisins aptamer affinity column and preparation method and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008141351A1 (en) * | 2007-05-21 | 2008-11-27 | Erber Aktiengesellschaft | Method for quantitatively determining analytes using a test element and test system and use thereof |
CN101915830A (en) * | 2010-07-19 | 2010-12-15 | 江南大学 | Ochratoxin A fluorescence detection test strip and application thereof |
-
2011
- 2011-11-25 CN CN201110380354XA patent/CN102517291A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008141351A1 (en) * | 2007-05-21 | 2008-11-27 | Erber Aktiengesellschaft | Method for quantitatively determining analytes using a test element and test system and use thereof |
CN101915830A (en) * | 2010-07-19 | 2010-12-15 | 江南大学 | Ochratoxin A fluorescence detection test strip and application thereof |
Non-Patent Citations (1)
Title |
---|
MAUREEN MCKEAGUE ET AL.: "Screening and Initial Binding Assessment of Fumonisin B1 Aptamers", 《INT. J. MOL. SCI.》 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103013999A (en) * | 2012-11-22 | 2013-04-03 | 江南大学 | Oligonucleotides aptamer special for distinguishing fumonisin B1 |
CN103013999B (en) * | 2012-11-22 | 2014-09-10 | 江南大学 | Oligonucleotides aptamer special for distinguishing fumonisin B1 |
CN103901000A (en) * | 2012-12-26 | 2014-07-02 | 江南大学 | Method for detecting fumonisin B1 based on fluorescence resonance energy transfer |
CN103901000B (en) * | 2012-12-26 | 2016-09-28 | 江南大学 | A kind of based on FRET (fluorescence resonance energy transfer) detection volt horse verticillium toxin B1method |
CN105543231A (en) * | 2016-01-11 | 2016-05-04 | 河南省农业科学院农业质量标准与检测技术研究所 | Screening and application of fumonisin B1 aptamer strand displacement probe |
CN105543231B (en) * | 2016-01-11 | 2019-07-05 | 河南省农业科学院农业质量标准与检测技术研究所 | Fumonisin B1The screening and application of aptamer strand displacing probes |
CN106596812A (en) * | 2017-01-16 | 2017-04-26 | 北京美正生物科技有限公司 | Fumonisins aptamer affinity column and preparation method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102517289A (en) | Nucleic acid aptamer of aflatoxin B1 and application thereof | |
CN102517288A (en) | Ochratoxin A aptamer and applications thereof | |
CN102443585A (en) | Zearalenone nucleic acid aptamer and application thereof | |
CN102559686A (en) | Deoxynivalenol nucleic acid aptamer and application thereof | |
Humpage et al. | Comparison of analytical tools and biological assays for detection of paralytic shellfish poisoning toxins | |
Wang et al. | Development and application of a quantitative fluorescence-based immunochromatographic assay for fumonisin B1 in maize | |
Xiao et al. | Simultaneous determination of trace Aflatoxin B1 and Ochratoxin A by aptamer-based microchip capillary electrophoresis in food samples | |
CN103852460B (en) | Based on the method that how residual the magnetic nano fluorescent sensor detection of antibiotics of aptamers is | |
CN107446929B (en) | Aptamer for specifically recognizing ochratoxin A and preparation method thereof | |
CN105784990A (en) | Test strip for detecting aflatoxin B1 or M1 by utilizing aptamer | |
Hun et al. | Signal amplified strategy based on target-induced strand release coupling cleavage of nicking endonuclease for the ultrasensitive detection of ochratoxin A | |
CN103674935B (en) | A kind of method of measuring gibberellin based on hybridization chain reaction signal amplification technique | |
CN105886512B (en) | Oligonucleotide aptamer group for high-specificity recognition of clenbuterol hydrochloride, salbutamol and ractopamine | |
CN101148667B (en) | Preparation and use for affinity human albumin nucleic acid aptamer | |
CN102703453A (en) | DNA aptamer specifically recognizing streptomycin and application of DNA aptamer | |
Wellhausen et al. | Facing current quantification challenges in protein microarrays | |
US20160320377A1 (en) | Method for protein analysis | |
CN102517291A (en) | Fumonisins B1 aptamer and applications thereof | |
Vijitvarasan et al. | A point-of-use lateral flow aptasensor for naked-eye detection of aflatoxin B1 | |
EP2192408A1 (en) | Agents and methods for spectrometric analysis | |
Lippolis et al. | Fluorescence polarisation immunoassays for rapid, accurate and sensitive determination of mycotoxins | |
WO2020206828A1 (en) | Alternariol aptamer affinity column and preparation method and application therefor | |
CN103013999A (en) | Oligonucleotides aptamer special for distinguishing fumonisin B1 | |
CN103443614A (en) | Use of signal enhancing compounds in electrochemiluminescence detection | |
JP2007521011A (en) | Analytical methods for labeling and detecting microRNA sequences and small interfering RNA sequences |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120627 |