CN102451472A - Application of minimal heterodimer partner in blood lipid regulation - Google Patents
Application of minimal heterodimer partner in blood lipid regulation Download PDFInfo
- Publication number
- CN102451472A CN102451472A CN201010518503XA CN201010518503A CN102451472A CN 102451472 A CN102451472 A CN 102451472A CN 201010518503X A CN201010518503X A CN 201010518503XA CN 201010518503 A CN201010518503 A CN 201010518503A CN 102451472 A CN102451472 A CN 102451472A
- Authority
- CN
- China
- Prior art keywords
- albumen
- polynucleotide molecule
- heterodimer partner
- small heterodimer
- purposes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to an application of a minimal heterodimer partner in blood lipid regulation. Through the modes of reporter genes and adenovirus over expression, the inventor finds that a minimal heterodimer partner (SHP) can down-regulate the expression of acyl-CoA cholesterol acyltransferase 2 (ACAT 2), and thus finds that the minimal heterodimer partner polynucleotide molecule or protein is applicable to the preparation of medicaments for treating hyperlipidemia diseases. Through the reduction of ACAT 2 by SHP adenovirus over expression, a new approach for blood lipid regulation is provided.
Description
Technical field
The present invention relates to the treatment field of hyperlipidaemic conditions.Particularly, thus the present invention relates to through regulating regulatory factor acyl coenzyme A cholesterol acyltransferase treatment hyperlipidaemic conditions important in the lipid metabolism.
Background technology
The ACAT full name is acyl coenzyme A cholesterol acyltransferase (acyl-coA cholesterol acyltransferase), and catalytic is esterification, and promptly the hydroxyl at cholesterol adds fatty acyl group, generates cholesteryl ester.Cholesterol is a polarity fat molecule, and cholesteryl ester is the nonpolar molecule of a height.So the catalytic reaction of ACAT has increased the hydrophobicity of cholesterol greatly, the cholesteryl ester that hydrophobicity is strong can be deposited in together by hydrophobic interaction each other, has greatly increased the bulk density of cholesteryl ester.
The catalytic reaction of ACAT has its important meaning: first; The cholesteryl ester that generates also can be assembled into the central authorities that fat drips; Be stored in the cell, this mode is considered to reduce the toxic action (Kusunoki et al., 2001) of too high free cholesterol pair cell.The second, in liver, cholesteryl ester can also be under the assembling of ApoB, is stacked into triglyceride and is in the same place, and form granular core, is assembled into spheric VLDL granule with the free cholesterol and the phospholipid of particle surface.The 3rd, in intestinal, ACAT helps absorption of cholesterol (Buhman et al., 2000 esterification of cholesterol; Temel, Gebre, Parks, & Rudel, 2003).The cholesterol of taking in the small intestinal is absorbed with non-esterified form at the Epithelium of intestinal villus cell, after the absorption, 80% free cholesterol is arranged by esterification generating cholesterol ester, and the form with Chylomicron is secreted in lymph fluid or the blood again, participates in the circulation of whole body.Though the molecular mechanism of cholesterol absorption it be unclear that, mainly think a passive diffusion process at present, the ACAT in the small intestine cells keeps the cholesterol esterification free cholesterol of low concentration, and the cholesterol that is beneficial in the enteric cavity diffuses into cell.
ACAT1 is almost having expression in various tissues and the cell, and ACAT2 then only expresses in liver and small intestine cells.More and more evidences proves, ACAT2 is treatment target spot (Leon, Hill, & Wasan, 2005 of very potential and an advantage; Rudel, Lee, & Parini, 2005).
At cellular level, there is multinomial research to show that the secretion of ACAT2 and ApoB is closely related.At rat cell is ACAT1 and the ACAT2 that crosses expressing human among the McA-RH7777, can cause the synthetic of cholesteryl ester, the secretion of gathering and cholesteryl ester in the cell, and the degraded of ApoB reduces, and the secretion in VLDL increases.The expression of the expression ratio ACAT1 of ACAT2 is to the assembling of VLDL and secretion facilitation more obviously (Liang et al., 2004).At stable transfection in the COS cell line of MTP and ApoB, the crossing of ACAT2 expressed the increase that causes active 3 times of ACAT and 4 times increase of cholesteryl ester level.After cholesterol-cyclodextrin (cholesterol-cyclodextrin) processing, the secretion of ACAT2 transfection group cholesteryl ester increases by 27 times, and matched group has only 7 times of increases; The percentage ratio of ACAT2 transfection group cholesteryl ester in the VLDL granule is increased to 54% from 16%, and matched group is increased to 33% from 3%.In addition, ACAT2 transfection group cell is than many 3 times of the excretory ApoB of matched group (Temel, Hou, Rudel, & Shelness, 2007).These results show that the expression of ACAT2 has influence on the content of cholesteryl ester, and then have influence on the particulate atherogenic ability that contains ApoB.
In the animal level, the mice that ACAT2 lacks almost lacks the activity of cholesterol esterification in liver and intestinal, and is when feeding to the Peigen diet when (containing cholesterol, satisfied fatty acid, cholic acid), more obvious with the difference of normal control group.Hypercholesterolemia does not take place in the mice that ACAT2 lacks, and the cholesterol calculus degree reduces, and the cholesterol absorption in the intestinal reduces (Buhman et al., 2000).ACAT2-/-mice and ApoE-/-mice hybridization after, cholesteryl ester reduces by 70% in the blood plasma.Behind the normal diet of giving for 27 weeks; ACAT2-/-ApoE-/-atherosclerosis of aorta speckle that female mice contrasts Mus largely reduces; Contain in the blood plasma and mainly contain triglyceride in the hdl particle of ApoB rather than cholesteryl ester is formed (Willner et al.; 2003) it is bigger, to explain that cholesteryl ester is compared atherosclerotic meaning than triglyceride.Thomas A.Bell III disturbs the expression of ACAT2 with the mode of antisense oligonucleotide; After finding that ACAT2 is lowered; Cholesterol level reduces in the blood plasma; Triglyceride levels increases, and the main fatty acid composition of the cholesteryl ester among the LDL changes, and has become polyunsaturated fatty acid from saturated and single satisfied fatty acid.In addition, the reduction of ACAT2 has suppressed the hypercholesterolemia of diet induced and the deposition of cholesteryl ester (Bell et al., 2006) to a certain extent.Find in the research in the non-human primate monkey that the abundant individuality of cholesteryl ester content is prone to start pulse atherosclerosis (Tall, Small, Atkinson, & Rudel, 1978) in blood plasma.The comparison of primates kind shows protein content and activity (Rudel, Davis, the Sawyer that the macaque of atherogenicity diet high response is contained higher ACAT2 than the cercopithecus aethiops of hypoergia; Shah; & Wallace, 2002), the dependency between prompting ACAT2 and atherosclerosis.
Therefore, ACAT2 is as the metabolic key enzyme of cholesteryl ester, for itself and atherosclerotic relation; Existing bibliographical information is consistent; Be the absorption that ACAT2 can promote cholesteryl ester, promote the secretion of ApoB, and then promote atherosclerotic generation.
(hepatocyte nuclear factor HNF), comprises HNF1, HNF4, members such as HNF6 in HNF family in the idiosyncratic transcription factor in the hepatocyte.The inventor observes the binding site whether these two sections exist these factors.The result finds ,-1299～-897, in two fragments of this between-208～transcriptional start site, has the binding site of a HNF4 respectively.HNF 4 (HNF4) is an important transcription factor, and it knocks out the Mus embryonic death.HNF4 is extremely important for the formation of the liver in the growth course, and is essential for the normal function performance of liver, and is to keep the necessary factor of hepatocyte phenotypic differentiation (Hayhurst et al., 2008; Louet, Hayhurst, Gonzalez, Girard, & Decaux, 2002; Watt, Garrison, & Duncan, 2003).The liver conditionality of adult rats knocks out after the HNF4, and the lipid metabolism of liver receives very big influence, can not keep the stable state of lipid metabolism.
Small heterodimer partner (Small heterodimer partner; SHP; One of also be called as NR0B2) member of the protein product intracellular nucleic receptor family of gene code; In organ such as liver, heart, pancreas and fat and tissue, express, people SHP gene is positioned in the position of chromosome lp36.1.Though similar with other nuclear receptor sequence height, SHP is a more special nuclear receptor family member, do not find its part up to now as yet, so SHP is because of being known as orphan receptor.In addition, SHP lacks classical DNA binding structural domain, can not directly combine with DNA.SHP performance function mainly plays a role through the transcriptional activity that forms heterodimers with other nuclear receptors and suppress these nuclear receptors.SHP performance transcripting suppressioning action has three kinds of modes: the one, and SHP is with after nuclear receptor combines, and what activator and nuclear receptor were assisted in prevention combines and then stops transcriptional activation; The 2nd, SHP is with after nuclear receptor combines, and self raises co-repressor, directly stops and transcribes; The 3rd, SHP is with after nuclear receptor combines, and what stop nuclear receptor and DNA original paper combines the generation of prevention transcriptional activation incident.Through these three kinds of modes, the transcripting suppressioning action that the SHP performance is powerful.
The verified nuclear receptor that receives the SHP transcripting suppressioning action comprises: biostearin receptor, Thyroid Hormone Receptors, estrogen receptor, androgen receptor, adrenal cortical hormone receptor, HNF receptor etc.In liver; SHP can cholesterol regulating and the gene of bile acid biosynthesis; These target genes all receive the transcriptional activation of nuclear receptor usually; SHP then suppresses transcriptional activation through the activity that stops nuclear receptor, and these target genes comprise: people's cetp, and this albumen is transported to cholesteryl ester on the hdl particle that is rich in triglyceride from the high density lipoprotein granule; Steroid 12-ALPHA hydroxylase, the ratio of cholic acid and deoxycholic acid is regulated in synthesizing of this enzyme catalysis cholic acid.
Hyperlipidemia serious threat human health, because ACAT2 plays an important role in blood fat is adjusted, this area is badly in need of the mechanism of ACAT2 blood lipid regulation is furtherd investigate to find the new method of effective control blood fat.
List of references
Bell，T.A.，3rd，Brown，J.M.，Graham，M.J.，Lemonidis，K.M.，Crooke，R.M.and?Rudel，L.L.(2006)，″Liver-specific?inhibition?of?acyl-coenzyme?a：cholesterol?acyltransferase?2?with?antisense?oligonucleotides?limits?atherosclerosis?development?in?apolipoprotein?B100-only?low-density?lipoprotein?receptor-/-mice″，Arterioscler?Thromb?Vasc?Biol，Vol.26?No.8，pp.1814-1820.
Buhman，K.K.，Accad，M.，Novak，S.，Choi，R.S.，Wong，J.S.，Hamilton，R.L.，Turley，S.and?Farese，R.V.，Jr.(2000)，″Resistance?to?diet-induced?hypercholesterolemia?and?gallstone?formation?in?ACAT2-deficient?mice″，Nat?Med，Vol.6?No.12，pp.1341-1347.
Hayhurst，G.P.，Strick-Marchand，H.，Mulet，C.，Richard，A.F.，Morosan，S.，Kremsdorf，D.and?Weiss，M.C.(2008)，″Morphogenetic?competence?of?HNF4?alpha-deficient?mouse?hepatic?cells″，J?Hepatol，Vol.49?No.3，pp.384-395.
Kusunoki，J.，Hansoty，D.K.，Aragane，K.，Fallon，J.T.，Badimon，J.J.and?Fisher，E.A.(2001)，″Acyl-CoA：cholesterol?acyltransferase?inhibition?reduces?atherosclerosis?in?apolipoprotein?E-deficient?mice″，Circulation，Vol.103?No.21，pp.2604-2609.
Leon，C.，Hill，J.S.and?Wasan，K.M.(2005)，″Potential?role?of?acyl-coenzyme?A：cholesterol?transferase(ACAT)Inhibitors?as?hypolipidemic?and?antiatherosclerosis?drugs″，Pharm?Res，Vol.22?No.10，pp.1578-1588.
Liang，J.J.，Oelkers，P.，Guo，C.，Chu，P.C.，Dixon，J.L.，Ginsberg，H.N.and?Sturley，S.L.(2004)，″Overexpression?of?human?diacylglycerol?acyltransferase?1，acyl-coa：cholesterol?acyltransferase?1，or?acyl-CoA：cholesterol?acyltransferase?2?stimulates?secretion?of?apolipoprotein?B-containing?lipoproteins?in?McA-RH7777?cells″，J?Biol?Chem，Vol.279?No.43，pp.44938-44944.
Louet，J.F.，Hayhurst，G.，Gonzalez，F.J.，Girard，J.and?Decaux，J.F.(2002)，″The?coactivator?PGC-1?is?involved?in?the?regulation?of?the?liver?carnitine?palmitoyltransferase?I?gene?expression?by?cAMP?in?combination?with?HNF4?alpha?and?cAMP-response?element-binding?protein(CREB)″，J?Biol?Chem，Vol.277?No.41，pp.37991-38000.
Rudel，L.L.，Davis，M.，Sawyer，J.，Shah，R.and?Wallace，J.(2002)，″Primates?highly?responsive?to?dietary?cholesterol?up-regulate?hepatic?ACAT2，and?less?responsive?primates?do?not″，J?Biol?Chem，Vol.277?No.35，pp.31401-31406.
Rudel，L.L.，Lee，R.G.and?Parini，P.(2005)，″ACAT2?is?a?target?for?treatment?of?coronary?heart?disease?associated?with?hypercholesterolemia″，Arterioscler?Thromb?Vasc?Biol，Vol.25?No.6，pp.1112-1118.
Tall，A.R.，Small，D.M.，Atkinson，D.and?Rudel，L.L.(1978)，″Studies?on?the?structure?of?low?density?lipoproteins?isolated?from?Macaca?fascicularis?fed?an?atherogenic?diet″，J?Clin?Invest，Vol.62?No.6，pp.1354-1363.
Temel，R.E.，Gebre，A.K.，Parks，J.S.and?Rudel，L.L.(2003)，″Compared?with?Acyl-CoA：cholesterol?O-acyltransferase(ACAT)1?and?lecithin：cholesterol?acyltransferase，ACAT2?displays?the?greatest?capacity?to?differentiate?cholesterol?from?sitosterol″，J?Biol?Chem，Vol.278?No.48，pp.47594-47601.
Temel，R.E.，Hou，L.，Rudel，L.L.and?Shelness，G.S.(2007)，″ACAT2?stimulates?cholesteryl?ester?secretion?in?apoB-containing?lipoproteins″，J?Lipid?Res，Vol.48?No.7，pp.1618-1627.
Watt，A.J.，Garrison，W.D.and?Duncan，S.A.(2003)，″HNF4：a?central?regulator?of?hepatocyte?differentiation?and?function″，Hepatology，Vol.37?No.6，pp.1249-1253.
Willner，E.L.，Tow，B.，Buhman，K.K.，Wilson，M.，Sanan，D.A.，Rudel，L.L.and?Farese，R.V.，Jr.(2003)，″Deficiency?of?acyl?CoA：cholesterol?acyltransferase?2?prevents?atherosclerosis?in?apolipoprotein?E-deficient?mice″，Proc?Natl?Acad?Sci?USA，Vol.100?No.3，pp.1262-1267.
Summary of the invention
The inventor crosses the mode of expression through reporter gene and adenovirus, has found the rise effect of HNF4 for the ACAT2 gene.There are some researches show that SHP can be through HNF4 performance important regulation, inventor's experiment shows that SHP can be through suppressing the effect of HNF4, the expression of downward modulation ACAT2.Therefore cross to express through the SHP adenovirus and reduce the approach that ACAT2 provides a new regulation and control blood fat.
Therefore, one aspect of the present invention provides small heterodimer partner (SHP) polynucleotide molecule or the purposes of albumen in the medicine of preparation treatment hyperlipidaemic conditions.Small heterodimer partner (SHP) polynucleotide molecule can design primer amplification according to method well known in the art and obtain from public database.
According to research of the present invention, small heterodimer partner polynucleotide molecule or albumen can be through the effects of downward modulation acyl coenzyme A cholesterol acyltransferase 2 performance blood fat reducing.
In one embodiment, thus small heterodimer partner polynucleotide molecule or albumen can be through expression vector overexpression downward modulation acyl coenzyme A cholesterol acyltransferases 2.Those skilled in the art can select common carrier through the conventional method in this area.
Preferably, in the present invention use adenovirus vector that particularly advantageous benefit is provided.
Hyperlipidaemic conditions is the disease of knowing in this area.Many researchs show that hyperlipidemia is the risk factor of apoplexy, coronary heart disease, myocardial infarction, sudden death.In addition, hyperlipidemia also is an important risk factor that promotes hypertension, impaired glucose tolerance, diabetes.Hyperlipidemia also can cause fatty liver, liver cirrhosis, cholelithiasis, pancreatitis, retinal hemorrhage, blind, peripheral vascular disease, limping, hyperuricemia.
In the present invention, the hyperlipidaemic conditions that can be used for treating comprises constitutional hyperlipidemia and Secondary cases hyperlipidemia.
In one embodiment of the invention, treatable hyperlipidaemic conditions comprises apoplexy, coronary heart disease, myocardial infarction, angina pectoris, hypertension, coronary atherosclerosis, fatty liver, liver cirrhosis, diabetes, hyperlipemia etc.
In another embodiment of the invention, treatable hyperlipidaemic conditions comprises hypercholesterolemia, hypertriglyceridemia and the plyability hyperlipidemia that the two all raises.
On the other hand, the invention still further relates to small heterodimer partner polynucleotide molecule or the albumen purposes in preparation downward modulation acyl coenzyme A cholesterol acyltransferase 2 active preparations.Consider the important function of acyl coenzyme A cholesterol acyltransferase 2 in blood lipid regulation, small heterodimer partner polynucleotide molecule of the present invention or albumen can be used for further studying the adjusting of other factor pair acyl coenzyme A cholesterol acyltransferases 2.Therefore, the present invention provides small heterodimer partner polynucleotide molecule or albumen to can be used for the preparation of preparation research acyl coenzyme A cholesterol acyltransferase 2.For example, can small heterodimer partner polynucleotide molecule be built in the expression vector,, be used for further studying other regulatory factors through overexpression in experiment in vitro cell line.Research of the present invention shows that reporter gene plasmid and HNF4 expression plasmid, SHP expression plasmid cotransfection can be used for studying the activity of ACAT2.
Therefore, one embodiment of the invention relates to small heterodimer partner polynucleotide molecule or albumen through the expression vector overexpression.In a preferred embodiment of the present invention, be effective especially through the adenovirus vector overexpression.
Description of drawings
Fig. 1: HNF4 crosses and expresses the promoter activity that increases ACAT2.
The adenovirus of Fig. 2: HNF4 is crossed and is expressed the transcriptional level that increases ACAT2.A, Western blotting result show that the HNF4 protein content crosses expression group (Ad-HNF4) at adenovirus and significantly rise than the expression of matched group (Ad-GFP) HNF4.B, the PCR in real time result.
Fig. 3: SHP reduces the promoter activity of ACAT2.A, the activity of two luciferases behind reporter gene plasmid and SHP expression plasmid or the control plasmid cotransfection.B, reporter gene plasmid and HNF4 expression plasmid, SHP expression plasmid or control plasmid cotransfection, the activity of the two luciferases in back.
The adenovirus of Fig. 4: SHP is crossed and is expressed the expression that reduces ACAT2.A passes through fluorescence microscope adenovirus infection situation behind the SHP infection cell.B, the Western blotting result.C, the PCR in real time result.
The specific embodiment
One, material and method
Cell culture and plasmid transfection
The cell growth conditions
HuH7 cell line derives from ATCC (U.S. tissue culture center), and cell culture adds 10ml hyclone, 1% non essential amino acid (NEAA), 100U penicillin, 100ug streptomycin in every 100mlDMEM complete culture solution in the DMEM culture fluid.Condition of culture is 37 ℃, 5%CO
2Add the 10ml culture fluid in each 100mm diameter plate.Condition of culture is 37 ℃, 5%CO
2, and saturated humidity.
Passage
The cell of adherent growth grows to the monolayer hypsokinesis and removes culture fluid, washes once with warm (37 ℃) PBS.(should slowly add along the culture dish sidewall when adding PBS).Add Digestive system (containing 0.25 gram pancreatin and 50mM EDTA among the 100mlPBS) 0.5ml (60mm diameter plate) or 1ml (100mm diameter plate or 100ml culture bottle) subsequently; Room temperature was placed about 2 minutes; All cells all shrinks rounded, is separated from each other, and promptly adds an amount of complete culture solution; Piping and druming repeatedly is until becoming single cell suspension.By proper proportion (1: 6 to 1: the 10) cultivation of going down to posterity.
Plasmid construction and cell transfecting
The plasmid source
Reporter gene plasmid pGL3-hACAT2-1299 is by bibliographical information (Biochem Biophys Res Commun.2001; 282 (2): 580-8).PcDNA3-rat-HNF4 is by bibliographical information (Genes Dev.1990; 4 (12B): 2353-65.); The expression plasmid pcDNA3-HA-hSHP of people SHP is by bibliographical information (Molecular Endocrinology, 2004,18 (4): 776-790).
Experimental procedure
The HuH7 cell inoculation is to 24 orifice plates, and with VigoFect cation transfection reagent transfection plasmid, by specification is operated.Promoter region report carrier 0.5 μ g, confidential reference items plasmid phRL-tk 50ng, transcription factor 0.5 μ g are changeed in every hole.In the experiment of HNF4 and SHP corotation, HNF4 adds 0.25ug, and SHP adds 0,0.25 respectively, 0.50ug.36h discards culture medium after the transfection, and PBS washes twice, with the two luciferase reporting system examining report gene activity of Promega company.Concrete steps are following: rock cell lysis 20min with 150 μ l, 1 * lysate (passive lysis buffer) room temperature.Place luciferase substrate reactions liquid luciferase detectable (Luciferase Assay Reagent) II (LAR II) and Stop & Glo
Reagent (SG) difference mixing room temperature subsequent use.Ensuingly carry out before operating in fluorescence detector.At first detecting the blank pipe fluorescent value rectifies an instrument for 3 times.In the EP pipe, add 15 μ l cell pyrolysis liquids and 20 μ l LAR II, testing goal gene by fluorescence value then; Add 20 μ l SG in the reaction system again, detect the crt gene fluorescent value.With the index of relative fluorescence value as the measurement promoter activity, relative fluorescence value=genes of interest fluorescent value/phRL confidential reference items fluorescent value.
The structure of adenovirus, packing and cell adenovirus infection
Plasmid construction:
The clone of pAdTrack-CMV-HNF4 makes up: use primer agtccgGGATCCATGGACATGGCTGACTACAGTGC and agtcCCCAA-GCTTCTAGATGGCTTCCTGCTTGGTG to go up the cDNA that PCR goes out HNF4 from pcDNA3-rat-HNF4; Be connected into the pAdTrack-CMV that crosses through BglII and HindIII enzyme action behind BamHI and the HindIII enzyme action, be built into pAdTrack-CMV-HNF4.Plasmid pcDNA3-HA-hSHP obtains the cDNA of people SHP behind BamHI and XhoI enzyme action, the latter is connected in the pAdTrack-CMV carrier of BamHI and XhoI enzyme action, is built into pAdTrack-CMV-SHP.Order-checking is correct.
Adenovirus construction
The competent preparation of Adeasier-1: the Adeasy-1 plasmid is transformed BJ5183; Coated plate (containing Amp and streptomycin in the culture plate); Choose monoclonal amplification culture (containing Amp and streptomycin in the culture medium), utilize 10% glycerol conventional method to prepare BJ5183 electricity and change competence, put-80 ℃ subsequent use.To show through PmeI enzyme action 4h or spend the night, fully linearisation is reclaimed the DNA behind the test kit purification enzyme action with gel.The linearisation of reclaiming is transformed into Adeasier-1 BJ5183 electricity to be changeed in the competent cell, and shop kalamycin resistance LB is dull and stereotyped, places and cultivates 14-16h in 37 ℃ of incubators.The less clone 15-20 of picking, be inoculated among that resistance liquid of card LB culture medium 5ml, 37 ℃ jolt and spend the night.Receive bacterium inferior morning, extract plasmid (avoid under any temperature storing bacterium liquid, but it being ℃ frozen to be made into glycerol stock-80) immediately, gel electrophoresis is selected big plasmid, uses the method evaluation and screening recon of PCR then.The person identifies with the PacI enzyme action respectively will to have the genes of interest.Obtain adenovirus vector Ad-HNF4 and Ad-SHP respectively after identifying correctly.Take a morsel through identifying that correct plasmid changes E.coli DH5 α over to, shop kalamycin resistance LB is dull and stereotyped, places overnight incubation in 37 ℃ of incubators.Choose one or two positive bacterium colony and be inoculated among the liquid LB culture medium 100-200ml that contains 30 μ g/ml kanamycin, 37 ℃ jolt spend the night (20h), extract plasmid.Get 5 μ g gained plasmids with PacI enzyme action 4-6h or spend the night and (need enzyme action abundant; Otherwise influence the packaging process behind the rotaring redyeing 293 cell); Phenol, each extracting of chloroform/chloroform+isoamyl alcohol (24: 1) are once; Behind the ethanol precipitation, under aseptic condition, be dissolved in 50 μ l 0.1 * TE solution or the MilliQ rank pure water-20 ℃ frozen subsequent use.
The adenovirus packing
Above linearizing adenoviral plasmid transfection is seeded among the T25 flask to reach the HEK293 cell of 70-80% density, and LipofectAmine 2000 transfection standardization programs are pressed in concrete operations.The HEK293 cell cleans (noticing that necessary preparatory earlier temperature is to 37 ℃) one time with 4mlOPTIMEMI.Observe whether existing muddiness forms in the transfection liquid, if form, in T25 flask, dropwise add transfection liquid, the limit edged is jiggled mixing, and 37 ℃, 5%CO
2Cultivate 4-8h in the incubator.Remove transfection liquid, add and contain 10% complete culture solution 6ml.Just can see behind two d that the part cell produces green fluorescence, 7-12d just can gather in the crops supernatant, utilizes three cracking cells of liquid nitrogen/37 ℃ water-bath multigelation, with the centrifugal 10min of maximum rate, collects supernatant on the desk centrifuge.Merge twice supernatant and obtain recombinant adenovirus.Utilize PCR and/or Western blotting checking recombinant adenovirus.
The adenovirus infection hepatocyte
In case recombinant virus by purification and evaluation, can increase in 293 cells in a large number.8 100mm culture dishs add 10ml and contain 5%FBSDMEM and cultivate 293 cells to 1 * 10 in each ware
7Individual.
Get the virus preservation liquid that 0.5ml increases first, add DMEM to 1ml, mixing is viral mixed liquor.Remove cell culture fluid, add the 4ml culture medium, carefully add 1ml virus mixed liquor again, be sure not to destroy cell monolayer, cross slowly rocks three times, in 37 ℃ of CO
2Cultivate 2-4d in the incubator.To 80% cell levitating, the fluorescence microscope whole cells of observation down all has green fluorescence.Collecting cell in aseptic 50ml taper centrifuge tube, the 2000rpm centrifugal collecting cell.Clean cell 3 times with aseptic PBS, with the PBS of 500 μ L that cell is resuspended, be transferred in the frozen pipe.Three cracking cells of liquid nitrogen/37 ℃ water-bath multigelation.With the centrifugal 10min of maximum rate, collect supernatant on the desk centrifuge.Get the above-mentioned viral supernatant of 5-50 μ l, join in 12 orifice plates, 37 ℃ of incubators are hatched 36-48h, collect RNA or albumen.
RT-PCR
The RNA extraction is synthetic with cDNA's
RNA method for distilling and cDNA synthetic method by standard in " molecular cloning " second edition are carried out.
PCR in real time detects
Carry out PCR with the suitable primer of software Express2.0 design.Utilize test kit SYBR
Premix Ex Taq
TM(available from Takara company) (method is carried out according to the test kit operation instruction) carries out PCR in real time.Be template with 1 μ l cDNA respectively,, increase in the 20 μ l reaction systems of 10 μ l, 2 * SYBR buffer containing 1 μ l upstream and downstream primer mixture (5 μ M each).Reaction condition is 95 ℃ of preparatory degeneration 3min; 95 ℃ of 10s, 40 circulations of 60 ℃ of 34s amplifications.If need do solubility curve, 95 ℃ of 1min more then; 60 ℃ of 1min; Rise to 95 ℃, 0.5 ℃ of every 10s rising, 71 circulations of need altogether by 60 ℃.Every pipe repeats 3 times, and internal reference is GAPDH.Carry out quantitative analysis through Bio-Rad IQ5 software.
The PCR in real time of using in the experiment (realtime) primer: hACAT2:TCTATCCTGCATGCCACGTTG and AGTTCCACCAGTCCCGGTAGAA; HGAPDH:GCCTCAAGATCATCAGCAATGC; TCTTCTGGGTGGCAGTGATGG.
Western blotting
Detailed step sees also the relevant portion of " molecular cloning " second edition.Used associated antibodies is that anti--HA antibody structure is from Sigma company in this experiment.
Two, experimental result
Embodiment 1
Experiment showed, that HNF4 crosses the promoter activity of expressing increase ACAT2.In the HuH7 cell, pGL3-hACAT2-1299, the reporter gene plasmid of phRL-TK and HNF4 expression plasmid or control plasmid cotransfection, after 36 hours, collecting cell, the activity of the two luciferases of detection.HNF4 crosses and expresses the promoter activity (see figure 1) that significantly raises ACAT2.
Embodiment 2
The adenovirus that further experiment showed, HNF4 is crossed the transcriptional level of expressing increase ACAT2.Adenovirus infection HuH7 cell.Shown in A part among Fig. 2, the Western blotting result shows that the HNF4 protein content crosses expression group (Ad-HNF4) at adenovirus and significantly rise than the expression of matched group (Ad-GFP) HNF4.B partly shows the PCR in real time result among Fig. 2, and adenovirus is crossed the expression of ACAT2 when expressing HNF4 and crossed expression group (Ad-HNF4) than the nearly 5 times rising of matched group (Ad-GFP) at adenovirus.
Embodiment 3
The research proof, SHP reduces the promoter activity of ACAT2.A partly is presented in the HuH7 cell among Fig. 3, pGL3-hACAT2-1299, and the reporter gene plasmid of phRL-TK and SHP expression plasmid or control plasmid cotransfection, after 36 hours, collecting cell, the activity of the two luciferases of detection.B partly is presented in the HuH7 cell among Fig. 3, pGL3-hACAT2-1299, and the reporter gene plasmid of phRL-TK and HNF4 expression plasmid, SHP expression plasmid or control plasmid cotransfection, after 36 hours, collecting cell, the activity of the two luciferases of detection.The activity of crossing induced expression ACAT2 promoter of HNF4, the activity that significantly reduces ACAT2 is expressed in crossing of SHP.
Embodiment 4
Research shows that the adenovirus of SHP is crossed and expressed the expression that reduces ACAT2.Adenovirus infection HuH7 cell.A passes through fluorescence microscope adenovirus infection situation after partly showing the SHP infection cell among Fig. 4, and wherein bright spot shows expressing green fluorescent protein, and promptly cell is by the SHP adenovirus infection.Shown in B part among Fig. 4, the Western blotting result shows that the SHP protein content crosses expression group (Ad-SHP) than the remarkable rising of matched group (Ad-GFP) at adenovirus, and HA resists as one in the experiment.C partly shows the PCR in real time result among Fig. 4, and the expression of ACAT2 was crossed expression group (Ad-SHP) at adenovirus when adenovirus was crossed expression SHP has remarkable decline than matched group (Ad-GFP).
ACAT2 be considered to blood in cholesteryl ester level among the LDL be closely related: at cellular level, ACAT2 expresses the secretion that can promote VLDL and ApoB hepatocellular the mistake; Cholesteryl ester in the horizontal ACAT2 of animal source is considered to atherogenic main esters in the blood; The secretion that knocks out dirty middle VLDL of Hepar Mus and ApoB of ACAT2 reduces; The cholesteryl ester level obviously reduces in the blood, and for atherosclerosis resistant function is arranged; After the method interference mouse liver ACAT2 through oligonucleotide, the secretion of ApoB reduces, and cholesteryl ester significantly reduces in the blood, and mice strengthens the atheromatous plaque resistivity.Therefore, ACAT2 is considered to very potential treatment target spot.Based on the clearly effect of ACAT2 for cholesterol metabolism, the regulation and control of research ACAT2 are significant.
Inventor's research has confirmed the expression activation of HNF4 for ACAT2, and has found the downward modulation effect of SHP for ACAT2 first.This research is significant for the expression regulation mechanism of illustrating ACAT2.Simultaneously, SHP act as the approach that we provide a potential regulation and control blood fat: promptly cross expression through SHP, suppress significantly that ACAT2 expresses and and then reduce the secretion of VLDL cholesteryl ester, reduce level of cholesterol in the blood.
Claims (10)
1. small heterodimer partner polynucleotide molecule or the albumen purposes in the medicine of preparation treatment hyperlipidaemic conditions.
2. small heterodimer partner polynucleotide molecule according to claim 1 or the albumen purposes in the medicine of preparation treatment hyperlipidaemic conditions, wherein small heterodimer partner polynucleotide molecule or albumen play a role through downward modulation acyl coenzyme A cholesterol acyltransferase 2.
3. small heterodimer partner polynucleotide molecule according to claim 1 or the albumen purposes in the medicine of preparation treatment hyperlipidaemic conditions, wherein small heterodimer partner polynucleotide molecule or albumen are through expression vector overexpression downward modulation acyl coenzyme A cholesterol acyltransferase 2.
4. small heterodimer partner polynucleotide molecule according to claim 3 or the albumen purposes in the medicine of preparation treatment hyperlipidaemic conditions, wherein said expression vector is an adenovirus vector.
5. according to the purposes in the medicine of preparation treatment hyperlipidaemic conditions of each described small heterodimer partner polynucleotide molecule or albumen among the claim 1-4, wherein hyperlipidaemic conditions comprises constitutional hyperlipidemia and Secondary cases hyperlipidemia.
6. according to the purposes in the medicine of preparation treatment hyperlipidaemic conditions of each described small heterodimer partner polynucleotide molecule or albumen among the claim 1-4, wherein hyperlipidaemic conditions comprises apoplexy, coronary heart disease, myocardial infarction, angina pectoris, hypertension, coronary atherosclerosis, fatty liver, liver cirrhosis, diabetes, hyperlipemia.
7. according to the purposes in the medicine of preparation treatment hyperlipidaemic conditions of each described small heterodimer partner polynucleotide molecule or albumen among the claim 1-4, wherein hyperlipidaemic conditions comprises hypercholesterolemia, hypertriglyceridemia and plyability hyperlipidemia.
8. small heterodimer partner polynucleotide molecule or the albumen purposes in preparation downward modulation acyl coenzyme A cholesterol acyltransferase 2 active preparations.
9. small heterodimer partner polynucleotide molecule according to claim 8 or the albumen purposes in preparation downward modulation acyl coenzyme A cholesterol acyltransferase 2 active preparations, wherein small heterodimer partner polynucleotide molecule or albumen are through the expression vector overexpression.
10. small heterodimer partner polynucleotide molecule according to claim 9 or the albumen purposes in preparation downward modulation acyl coenzyme A cholesterol acyltransferase 2 active reagent, wherein small heterodimer partner polynucleotide molecule or albumen are crossed expression through adenovirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010518503XA CN102451472A (en) | 2010-10-26 | 2010-10-26 | Application of minimal heterodimer partner in blood lipid regulation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010518503XA CN102451472A (en) | 2010-10-26 | 2010-10-26 | Application of minimal heterodimer partner in blood lipid regulation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102451472A true CN102451472A (en) | 2012-05-16 |
Family
ID=46035414
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010518503XA Pending CN102451472A (en) | 2010-10-26 | 2010-10-26 | Application of minimal heterodimer partner in blood lipid regulation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102451472A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110177573A (en) * | 2016-11-16 | 2019-08-27 | 普渡研究基金会 | For adjusting the composition and method of weight and metabolic syndrome |
| CN114164249A (en) * | 2021-12-01 | 2022-03-11 | 南京医科大学 | Drug target for screening and inhibiting intestinal fatty acid uptake and preventing and treating fatty liver and application thereof |
-
2010
- 2010-10-26 CN CN201010518503XA patent/CN102451472A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| KYEONG-OK CHANG 等: "Role of Cholesterol Pathways in Norovirus Replication", 《JOURNAL OF VIROLOGY》 * |
| 刘黎 等: "微粒体甘油三酯转移蛋白的功能及临床意义", 《国际病理科学与临床杂志》 * |
| 韩红敬 等: "SHP基因与新生儿出生体重关系的探讨", 《中华围产医学杂》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110177573A (en) * | 2016-11-16 | 2019-08-27 | 普渡研究基金会 | For adjusting the composition and method of weight and metabolic syndrome |
| CN114164249A (en) * | 2021-12-01 | 2022-03-11 | 南京医科大学 | Drug target for screening and inhibiting intestinal fatty acid uptake and preventing and treating fatty liver and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wickenheisser et al. | Differential activity of the cytochrome P450 17α-hydroxylase and steroidogenic acute regulatory protein gene promoters in normal and polycystic ovary syndrome theca cells | |
| Mason et al. | PLIN5 deletion remodels intracellular lipid composition and causes insulin resistance in muscle | |
| Gouédard et al. | Dietary polyphenols increase paraoxonase 1 gene expression by an aryl hydrocarbon receptor-dependent mechanism | |
| Goodwin et al. | The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module | |
| Sirvent et al. | The farnesoid X receptor induces very low density lipoprotein receptor gene expression | |
| Pentchev et al. | Type C Niemann-Pick disease. A parallel loss of regulatory responses in both the uptake and esterification of low density lipoprotein-derived cholesterol in cultured fibroblasts. | |
| You et al. | Suppression of zinc finger protein 467 alleviates osteoporosis through promoting differentiation of adipose derived stem cells to osteoblasts | |
| Southgate et al. | Transcriptional targeting to anterior pituitary lactotrophic cells using recombinant adenovirus vectors in vitro and in vivo in normal and estrogen/sulpiride-induced hyperplasic anterior pituitaries | |
| Kamino et al. | Role of a novel CAR-induced gene, TUBA8, in hepatocellular carcinoma cell lines | |
| Dong et al. | Loss of LCAT activity in the golden Syrian hamster elicits pro-atherogenic dyslipidemia and enhanced atherosclerosis | |
| Guo et al. | Regulation of lipid metabolism and gene expression by fenofibrate in hamsters | |
| Bugge et al. | The PPARγ2 A/B-domain plays a gene-specific role in transactivation and cofactor recruitment | |
| Halder et al. | A cAMP-responsive element binding site is essential for sterol regulation of the human lanosterol 14α-demethylase gene (CYP51) | |
| Liu et al. | Ribonucleic acid expression of the CLA-1 gene, a human homolog to mouse high density lipoprotein receptor SR-BI, in human adrenal tumors and cultured adrenal cells | |
| Yeo et al. | Conditional disruption of calcineurin B1 in osteoblasts increases bone formation and reduces bone resorption | |
| Wu et al. | Targeted inhibition of hepatitis C virus–directed gene expression in human hepatoma cell lines | |
| Thymiakou et al. | Defects in High Density Lipoprotein metabolism and hepatic steatosis in mice with liver-specific ablation of Hepatocyte Nuclear Factor 4A | |
| Nan et al. | p62 is involved in the mechanism of Mallory body formation | |
| Du et al. | The zinc-finger transcription factor, Ofi1, regulates white–opaque switching and filamentation in the yeast Candida albicans | |
| Romac et al. | Overexpression of the arginine-rich carboxy-terminal region of U1 snRNP 70K inhibits both splicing and nucleocytoplasmic transport of mRNA. | |
| Johari et al. | Design of synthetic promoters for controlled expression of therapeutic genes in retinal pigment epithelial cells | |
| CN102451472A (en) | Application of minimal heterodimer partner in blood lipid regulation | |
| Tang et al. | Significance of MR/OPN/HMGB1 axis in NAFLD-associated hepatic fibrogenesis | |
| CN110384801B (en) | Application of miRNA552 cluster microRNA in treatment of LDLC related metabolic diseases | |
| Cheng et al. | Three zinc finger nuclear proteins, Sp1, Sp3, and a ZBP-89 homologue, bind to the cyclic adenosine monophosphate-responsive sequence of the bovine adrenodoxin gene and regulate transcription |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120516 |