CN102443628A - Preparation method for nucleic acid quality control by chimeric exogenous independent sequence - Google Patents
Preparation method for nucleic acid quality control by chimeric exogenous independent sequence Download PDFInfo
- Publication number
- CN102443628A CN102443628A CN2011103397762A CN201110339776A CN102443628A CN 102443628 A CN102443628 A CN 102443628A CN 2011103397762 A CN2011103397762 A CN 2011103397762A CN 201110339776 A CN201110339776 A CN 201110339776A CN 102443628 A CN102443628 A CN 102443628A
- Authority
- CN
- China
- Prior art keywords
- sequence
- mikrobe
- detected
- quality control
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method for nucleic acid quality control by a chimeric exogenous independent sequence, which is characterized in that a microbiologic specific primer sequence is added by a gene clone method or a chemical synthesis method at two sides of the independent sequence, PCR amplification is used, the amplification product is connected with a pGEM-T carrier to obtain the DNA quality control, and then the RNA quality control which is taken as a molecule detection kit can be obtained by using an in vitro transcription. The prepared nucleic acid quality control contains a segment of gene sequence which is independent to the detection object, in the subsequent positive investigation, whether the false amplification is caused by the operation pollution or not can be identified, under the condition of normal negative control, the positive amplification of the nucleic acid quality control sample indicates the effectiveness and the correctness of the detection reaction.
Description
Technical field
The invention belongs to molecular biology method and carry out the detection ranges of mikrobe (virus, bacterium, mycoplasma and fungi etc.), specifically is the technological method of a whole set of preparation and irrelevant sequence DNA of synthetic chimeric external source or RNA Quality Control.
Background technology
Molecular Biological Detection method or detection kit based on based on nucleic acid all need be through adding the standard positive quality-control sample; Validity in order to the inspection process; But the interpolation that all derives from the standard positive sample of detected object tends to detection reaction is brought the interference of potential pollution and interpretation.The main quality-control sample that is used for molecule diagnosis kit at present mainly is the serum virus with infection activity; Hepatitis C virus standard Quality Control like preparations such as Wang Lunan: with the negative blood plasma of HCV RNA positive blood plasma is diluted to about 300 000 copy numbers of content/mL, carries out vacuum lyophilization then. detection method adopts the interior scalar quantity method of the PCR of real-time fluorescence quantitative polymerase chain reaction method and Roche Holding Ag.The standard quality-control sample of this method preparation has infection activity, causes the diffusion and the propagation of virus easily.The quality-control sample that is used for the anthrax bacillus molecular diagnosis of preparations such as Satoshi Inoue; In Quality Control DNA, introduce false positive that whether EcoRV and two restriction enzyme sites of BamH I be used to differentiate that the pollution owing to Quality Control causes increase (Satoshi Inoue, 2004).The paper that the preparation method of more consummate Quality Control nucleic acid delivers in 2011 from Laetitia Ninove: Quality Control DNA (RNA) sequence that use artificial synthetic to contain T7 promoter primer, NotI restriction enzyme site, to detect primer (probe) sequence and virus gene sequence is used for the exogenous Quality Control (Laetitia Ninove, 2011) of all kinds of molecular detecting methods.Both something in commons of back are; The quality-control sample of preparation does not all have infectivity; But all main chimeric be that nucleotide sequence and 1 ~ 2 common restriction enzyme site of detected object itself (or similar) differentiated false positive and true positives in the detected result, identification precision is low, identification is complicated.
The present invention is through the both sides in irrelevant sequence (plasmid vector sequence or artificial stochastic sequence); Add mikrobe specific primer sequence to be measured through gene cloning or chemical synthesis; The DNA Quality Control that the way of utilizing PCR to clone then obtains chimeric irrelevant sequence further utilizes the in-vitro transcription technology can obtain can be used as the RNA Quality Control of detection kit.The nucleic acid Quality Control of the present invention's preparation all contains one section gene order that has nothing to do fully with detected object, in follow-up positive investigation, uses a PCR reaction to irrelevant sequence can differentiate false positive and the true positives in the detected result.Under the normal condition of negative control, the positive of nucleic acid quality-control sample amplification, the indication detection reaction effectively with correct.
Summary of the invention
The purpose of this invention is to provide a kind of DNA Quality Control of the PCR of being used for detection and the RNA Quality Control that a kind of RT-PCR of being used for detects.
The present invention adopts following technical scheme to achieve these goals: (1) irrelevant sequence source and selection: comprise method I or method II; When detection reaction is a selecting method I during based on product length; When the method I can not satisfy actual needs, particularly detection reaction is taqman real-time quantitative PCR or similar centre selecting method II when containing the detection reaction of probe.
Said method I: choose the section of DNA sequence from existing plasmid vector; Analyze the GC content and the secondary conformation of this dna sequence dna with biological software; It is irrelevant sequence I that the dna sequence dna that satisfies following condition is selected for use: a) homology of irrelevant sequence I and mikrobe to be detected is lower than 5%; B) GC content is between 45%～55%, and c) secondary structure is comparatively simple, and d) average T M value is between 60 ℃～85 ℃.
Said method II: adopt the synthetic one section irrelevant sequence II of chemical method, satisfy irrelevant sequence II and mikrobe to be detected and do not have homology.
(2) primer design
Utilize the General Principle of design of primers to design a pair of irrelevant sequence I primer and a pair of mikrobe Auele Specific Primer I to be detected respectively to irrelevant sequence I and mikrobe to be detected described in step (1) the method I; 5 ' end in the downstream of the upper reaches of irrelevant sequence I primer and irrelevant sequence I primer adds the mikrobe Auele Specific Primer to be detected I upper reaches and mikrobe Auele Specific Primer I to be detected downstream respectively, obtains a pair of chimeric primers.
Rule with design of primers designs a pair of mikrobe Auele Specific Primer II to be detected and mikrobe probe to be detected to mikrobe to be detected, also need design a pair of irrelevant sequence II primer to irrelevant sequence II; Synthetic one section from 5 ' to hold 3 ' end be the dna fragmentation of mikrobe upstream primer II to be detected, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, mikrobe downstream primer II to be detected successively.
(3) pcr amplification
With chimeric primers described in the step (2); The said existing plasmid vector of pcr amplification step (1) method I obtains double chain DNA sequence product I: the product I from 5 ' to hold 3 ' end be mikrobe upstream primer I to be detected, irrelevant sequence I upstream primer, irrelevant sequence I, irrelevant sequence I downstream primer and mikrobe downstream primer I to be detected successively.
With the said dna fragmentation of mikrobe Auele Specific Primer II pcr amplification step to be detected (2) described in the step (2), obtain double chain DNA sequence product II: from 5 ' to hold 3 ' end be mikrobe upstream primer sequence II to be detected, irrelevant sequence II upstream primer, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, irrelevant sequence II downstream primer, mikrobe downstream primer II to be detected successively.
(4) clone
Agarose electrophoresis PCR product; Use glue to reclaim test kit and reclaim product I or product II, behind the spectrophotometer standard measure, TA connection product I or product II are to the pGEM-T carrier; Pass through resistance screening; PCR identifies transformant, obtains positive transformant pGEM-T-product I or pGEM-T-product II, promptly required DNA Quality Control I or DNA Quality Control II; DNA Quality Control I or DNA Quality Control II are transformed and be stored in the colibacillus engineering.
(5) in-vitro transcription and purifying
PGEM-T-product I or pGEM-T-product II are carried out linearizing through single endonuclease digestion, and restriction enzyme site is positioned at and inserts outside the gene, utilizes the in-vitro transcription test kit to carry out the synthetic of external RNA, obtains RNA Quality Control I or RNA Quality Control II.
Purification step is: a) replenish no RNAse enzyme aqua sterilisa to 100 μ L, add 900 μ L TriPure Isolation Reagent then, the vibration mixing; Room temperature leaves standstill 5 min, adds 200 μ L chloroforms, shakes 60 s; Then in 4 ℃, 12000 r/min high speed centrifugations, 15 min; 2) get 500 μ L supernatants, and add equal-volume Virahol room temperature and leave standstill 30 min, 12000 r/min high speed centrifugations, 15 min, supernatant discarded is with 75% washing with alcohol 1 time; 3) add 1 mL, 75% ethanol then, be stored in-80 ℃ of refrigerators or liquid nitrogen.
Aforesaid method is applicable to the production of molecular diagnosis or detection kit nucleic acid quality control product.
Advantage of the present invention is that the prepared DNA Quality Control of the present invention is compared with the Quality Control of routine techniques preparation with the RNA Quality Control; Have reactive behavior good, and can and the ability differentiated of laboratory pollution, can be applied to the preparation of molecular Biological Detection (diagnosis) test kit Quality Control (contrast) article.
Description of drawings
The compound method synoptic diagram of Fig. 1 nucleic acid Quality Control;
Among the figure: 1-mikrobe upstream primer to be detected sequence; 2-mikrobe downstream primer to be detected sequence; 3-mikrobe probe sequence to be detected; The 4-dna sequence dna upstream primer that has nothing to do; The 5-dna sequence dna downstream primer that has nothing to do; 6-derives from the irrelevant dna sequence dna of pUC18 carrier; The irrelevant random dna sequence of 7-synthetic; 8-derives from the irrelevant dna sequence dna of pGEM-T carrier.
Embodiment
Embodiment 1, referring to the preparation synoptic diagram of the nucleic acid Quality Control of the irrelevant sequence of the chimeric external source of Fig. 1, when detection reaction is the employing method I based on product length; When the method I can not satisfy actual needs, particularly detection reaction is taqman real-time quantitative PCR or similar centre when containing the detection reaction of probe, employing method II.
(1) selection in irrelevant sequence source
Said method I: irrelevant sequence comes from existing plasmid vector, like pUC18, pET30 etc.Choose the section of DNA sequence from existing plasmid vector; Analyze the GC content and the secondary conformation of this dna sequence dna with biological software; It is irrelevant sequence I that the dna sequence dna that satisfies following condition is selected for use: a) homology of irrelevant sequence I and mikrobe to be detected is lower than 5%; B) GC content is between 45%～55%, c) secondary structure comparatively simple (there is not secondary structure in 70% zone), and d) average T M value is between 60 ℃～85 ℃;
Said method II: adopt the synthetic one section irrelevant sequence II of chemical method, satisfy irrelevant sequence II and mikrobe to be detected and do not have homology;
(2) primer design
Utilize the General Principle of design of primers to design a pair of irrelevant sequence I primer and a pair of mikrobe Auele Specific Primer I to be detected respectively to irrelevant sequence I and mikrobe to be detected described in step (1) the method I; 5 ' end in the downstream of the upper reaches of irrelevant sequence I primer and irrelevant sequence I primer adds the mikrobe Auele Specific Primer to be detected I upper reaches and mikrobe Auele Specific Primer I to be detected downstream respectively, obtains a pair of chimeric primers.Amplified production length is at 80bp ~ 1000bp, and concrete length is set according to the different detection needs.If use identical mikrobe Auele Specific Primer to be detected respectively nucleic acid Quality Control and pathogenic micro-organism to be detected, as if both product certain difference (30 ~ 100bp all can) is arranged on length, whether can directly differentiate is false positive; If both product length is in full accord, then need use upstream and downstream primer that amplified production is carried out a detection to irrelevant gene design, whether be the false positive amplification to differentiate.
Rule with design of primers designs a pair of mikrobe Auele Specific Primer II to be detected and mikrobe probe to be detected to mikrobe to be detected; Also need design a pair of irrelevant sequence II primer to irrelevant sequence II, product length (can differentiated in suitable electrophoresis system and get final product) more than 80 bp.Adopt chemical method synthetic one section from 5 ' to hold 3 ' end be the dna fragmentation of mikrobe upstream primer II to be detected, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, mikrobe downstream primer II to be detected successively.Mikrobe probe 5 ' to be detected holds the distance of mikrobe upstream primer II 3 ' end to be detected between 5 ~ 50bp.Upstream primer 5 ' the end of irrelevant sequence II can have the coincidence of 5 ~ 8 bases with 3 ' end of mikrobe upstream primer II to be detected.Irrelevant stochastic sequence and microbial gene sequence to be detected do not have obvious similarity.
(3) pcr amplification
With chimeric primers described in the step (2); The said existing plasmid vector of pcr amplification step (1) method I obtains double chain DNA sequence product I: the product I from 5 ' to hold 3 ' end be mikrobe upstream primer I to be detected, irrelevant sequence I upstream primer, irrelevant sequence I, irrelevant sequence I downstream primer and mikrobe downstream primer I to be detected successively;
With the said dna fragmentation of mikrobe Auele Specific Primer II pcr amplification step to be detected (2) described in the step (2), obtain double chain DNA sequence product II: from 5 ' to hold 3 ' end be mikrobe upstream primer sequence II to be detected, irrelevant sequence II upstream primer, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, irrelevant sequence II downstream primer, mikrobe downstream primer II to be detected successively;
(4) clone
Agarose electrophoresis PCR product; Use glue to reclaim test kit and reclaim product I or product II, behind the spectrophotometer standard measure, TA connection product I or product II are to the pGEM-T carrier; Pass through resistance screening; PCR identifies transformant, obtains positive transformant pGEM-T-product I or pGEM-T-product II, promptly required DNA Quality Control I or DNA Quality Control II; DNA Quality Control I or DNA Quality Control II are transformed and be stored in the colibacillus engineering;
(5) in-vitro transcription and purifying
For being applicable to the RT-PCR detection reaction; (4) said DNA Quality Control need be carried out the synthetic corresponding RNA of in-vitro transcription: pGEM-T-product I or pGEM-T-product II are carried out linearizing through single endonuclease digestion; Restriction enzyme site is positioned at and inserts outside the gene; Utilize the in-vitro transcription test kit to carry out the synthetic of external RNA, obtain RNA Quality Control I or RNA Quality Control II;
Purification step is: a) replenish no RNAse enzyme aqua sterilisa to 100 μ L, add 900 μ L TriPure Isolation Reagent then, the vibration mixing; Room temperature leaves standstill 5 min, adds 200 μ L chloroforms, shakes 60 s; Then in 4 ℃, 12000 r/min high speed centrifugations, 15 min; 2) get 500 μ L supernatants, and add equal-volume Virahol room temperature and leave standstill 30 min, 12000 r/min high speed centrifugations, 15 min, supernatant discarded is with 75% washing with alcohol 1 time; 3) add 1 mL, 75% ethanol then, be stored in-80 ℃ of refrigerators or liquid nitrogen.
The nucleic acid Quality Control of the irrelevant sequence of above-mentioned chimeric external source is applicable to the purposes of molecular diagnosis or detection kit nucleic acid quality control product in preparation.
Embodiment 2, the evaluation of quality: DNA Quality Control and RNA Quality Control all can be passed through the size that spectrophotometric determination OD260, OD260/OD280 ratio and agarose electrophoresis are measured its concentration respectively.Also need use PCR and RT-PCR to identify the validity of Quality Control nucleic acid respectively.The second best in quality Quality Control DNA and RNA answer that electrophoretic band is clear, OD260/OD280 between 1.8～2.0, the amplification curve of detection reaction is normal.
Embodiment 3, the application of Quality Control
(1) Quality Control PCR/ reverse transcription PCR detection reaction
DNA Quality Control and RNA Quality Control be Quality Control PCR/ reverse transcription PCR (RT-PCR) detection reaction respectively.Be specially,, all can be used as the testing sample of test kit detection reaction respectively, carry out detection reaction according to the specification sheets of this test kit with DNA Quality Control and RNA Quality Control for any molecule diagnosis kit.Positive test symbol appears in quality-control sample, shows that then the test kit preservation is good, and detection reaction is set up; If negative result appears in quality-control sample, show that then test kit reagent lost efficacy or testing staff's malfunction, the detection reaction failure.
(2) differentiate true positives amplification and false positive amplification
If when the testing staff holds the suspection attitude for the male detected result, then need detect product and further differentiate to male.
For nucleic acid Quality Control according to the preparation of method I; Can use upstream and downstream primer that amplified production (diluting 100 ~ 1000 times with sterilized water) is carried out the PCR detection to irrelevant gene design; Whether to differentiate is the false positive amplification; 25 μ L amplification systems comprise: 1 * PCR reaction buffer, 1.5 ~ 2.0 mol/L MgCl
2, 200 μ mol/L dNTP (containing A, G, C, T), 1U heat-resistant dna polysaccharase, irrelevant each 0.2 ~ 0.4 μ mol/L of sequence upstream/downstream primer final concentration, 1 ~ 5 μ L template DNA (amplified production of dilution); Reaction conditions is: preparatory 95 ℃ of 5 min of sex change; 35 circulations: 94 ℃, 30 s, 55 ~ 60 ℃, 30 s, 72 ℃, 1 min; Replenish and extend: 72 ℃, 10 min.If the PCR test positive shows that then previous detection reaction is a false positive; If it is negative that PCR detects, show that then previous detection reaction is a true positives.
For nucleic acid Quality Control according to the preparation of method II; Can use upstream and downstream primer that amplified production (diluting 100 ~ 1000 times with sterilized water) is carried out the PCR detection to irrelevant stochastic sequence design; Whether to differentiate is the false positive amplification; 25 μ L amplification systems comprise: 1 * PCR reaction buffer, 1.5 ~ 2.0 mol/l MgCl
2, 200 μ mol/l dNTP (containing A, G, C, T), 1U heat-resistant dna polysaccharase, irrelevant each 0.2 ~ 0.4 μ mol/l of sequence upstream/downstream primer final concentration, 1 ~ 5 μ L template DNA (amplified production of dilution); Reaction conditions is: preparatory 95 ℃ of 5 min of sex change; 35 circulations: 94 ℃, 30 s, 55 ~ 60 ℃, 30 s, 72 ℃, 1 min; Replenish and extend: 72 ℃, 10 min.If the PCR test positive shows that then previous detection reaction is a false positive; If it is negative that PCR detects, show that then previous detection reaction is a true positives.
If use identical mikrobe Auele Specific Primer to be detected respectively nucleic acid Quality Control and pathogenic micro-organism to be detected, certain difference (30 ~ 100bp all can) is arranged on length as if both product.Then the product with detection reaction carries out electrophoresis, if the two product length differs, and all positive, show that then detection reaction is a true positives; If the two product length is consistent, and all positive, show that then detection reaction is a false positive, need carry out sequencing and differentiate.
Embodiment 4, assembling molecular diagnosis/detection kit
Use is added suitable nucleic acid protective material according to the nucleic acid Quality Control of originally transcribing preparation, and even adds some negative serums, can prepare special-purpose Quality Control (contrast) article of test kit.
A) molecule diagnosis kit qualitatively
Negative serum with suitable is diluted to different extent of dilution with protective material with the nucleic acid Quality Control, gets each extent of dilution and detects.According to detection case, the extent of dilution of getting strong positive, the weak positive and feminine gender is respectively as the strong positive contrast of test kit, weak positive control and negative control.Under different storage conditions, the stability and the validity period of checking quality control product.Get effectively quality control product steady in a long-term as the Quality Control of test kit.
B) quantitative molecule diagnosis kit
Negative serum with suitable is diluted to different extent of dilution with protective material with the nucleic acid Quality Control, makes the variation in gradient of its copy number, gets each extent of dilution and detects.According to detection case, get 3 ~ 6 amplification cycles and count the Ct value and be the successive extent of dilution as the quantitative Quality Control of the copy number of test kit.Under different storage conditions, the stability and the validity period of checking quality control product.Get effectively quality control product steady in a long-term as the Quality Control of test kit.
Embodiment 5, and the example that is prepared as with the RNA Quality Control of H1N1 influenza virus fluorescent quantificationally PCR detecting kit further specifies below:
1, the selection of irrelevant sequence
Utilize FastPCR to produce one section random dna sequence:
Seq?1:
GCTGGATCTGGTATTATCCTGTGCATTGTATTTAACCAAGATACACCAGTCCACGATTGCGATAAGTCTACAGGGTACGGATAGCAGCACTGATCACAACTGTCAGGGACGAACACTTAGAACGCAGGTAGTTCAGAATATACATCCGATC
2, primer design
Utilize the General Principle of design of primers to design irrelevant dna sequence dna primer and mikrobe Auele Specific Primer to be detected according to irrelevant sequence and mikrobe to be detected; 5 ' end in the downstream of the upper reaches of irrelevant aligning primer and irrelevant aligning primer adds the mikrobe Auele Specific Primer upper reaches to be detected and mikrobe Auele Specific Primer to be detected downstream respectively, obtains a pair of chimeric primers.
According to H1N1 influenza sequence (CY039527):
Seq?2：
GGGAAAACAAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAAT
GCTGGATCTGGTATTATCATTTC
AGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCAT
TTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGAATATGTATTAA.
General Principle according to the primer probe design obtains primer and probe to the H1N1 influenza virus:
H1N1 influenza virus upstream primer: 5 '-GCTGGATCTGGTATTATC-3 '
H1N1 influenza virus downstream primer: 5 '-GATCGGATGTATATTCTGAA-3 '
H1N1 influenza virus taqman probe:
FAM-5’-AGATACACCAGTCCACGATTGC-3’-TAMARA。
Obtain the primer of irrelevant random dna sequence according to the General Principle of primer probe design:
Irrelevant random dna sequence upstream primer: 5 '-CTGTGCATTGTATTTAACCA-3 '
Irrelevant random dna sequence downstream primer: 5 '-CACTTAGAACGCAGGTAG-3 '.
One section sequence of synthetic:
GCTGGATCTGGTATTATCCTGTGCATTGTATTTAACCAAGATACACCAGTCCACGATTGCGATAAGTCTACAGGGTACGGATAGCAGCACTGATCACAACTGTCAGGGACGAACACTTAGAACGCAGGTAGTTCAGAATATACATCCGATC。
According to the synthetic above-mentioned dna fragmentation of mass spectrum level.
3, pcr amplification
With H1N1 virus specificity upstream and downstream primer the above-mentioned dna fragmentation of synthetic is increased.The preparation of PCR system and parameter are followed general principle.
50 μ L pcr amplification systems comprise: 1 * PCR reaction buffer, 1.5 mmol/l MgCl
2, 200 μ mol/l dNTP (containing A, G, C, T), 1U heat-resistant dna polysaccharase, each 0.2 μ mol/l of upstream primer/downstream concentration, 3 μ L template DNAs (artificial-synthetic DNA); Reaction conditions is: preparatory 95 ℃ of 5 min of sex change; 35 circulations: 94 ℃, 30 s, 55 ℃, 30 s, 72 ℃, 1 min; Replenish and extend: 72 ℃, 10 min.The product electrophoresis is reclaimed and reclaims test kit with commercialization glue and carry out purifying.
4, clone
Behind the spectrophotometer standard measure; With reference to the requirement of pGEM-T carrier specification sheets; TA connects the PCR product of purifying to the pGEM-T carrier, identifies transformant (method is the same) through resistance screening (after connecting conversion, the penbritin that in cultivation, adds 50 μ g/ml suppresses negative transformant), PCR; Obtain positive transformant pGEM-T-product, i.e. DNA Quality Control.
5, in-vitro transcription and purifying
Because influenza virus is a RNA viruses, need the synthetic RNA of in-vitro transcription is carried out in said DNA Quality Control, step is: the DNA Quality Control is carried out linearizing through the Kpn I, carry out the synthetic of external RNA according to the requirement of in-vitro transcription test kit specification sheets, obtain the RNA Quality Control.The in-vitro transcription reaction solution contains: 1x Transcription Optimized Buffer, 10 mmol/L DTT, 25U Rnasin Ribonuclease Inhibitor; 0.5 mmol/L rNTP (contains rATP, rGTP, rCTP; RUTP), 1 ug linearizing DNA; In 38 ℃ of water-bath 2 h;
RNA also contains a large amount of DNA according to the above-mentioned steps synthetic, needs to use the DNA enzyme to carry out external digestion, and all products are added 1U DNA enzyme, 37 ℃ of reaction 15 min.Then, use TriPure RNA extraction agent box to carry out extracting and purifying.Purification step is: a) replenish no RNAse enzyme aqua sterilisa to 100 μ L, add 900 μ l TriPure Isolation Reagent then, the vibration mixing; Room temperature leaves standstill 5 min, adds 200 μ L chloroforms, shakes 60 s; Then in 4 ℃, 12000 r/min high speed centrifugations, 15 min; 2) get 500 μ L supernatants, and add equal-volume Virahol room temperature and leave standstill 30 min, 12000 r/min high speed centrifugations, 15 min, supernatant discarded is with 75% washing with alcohol 1 time; 3) add 1 mL, 75% ethanol then, be stored in-80 ℃ of refrigerators or liquid nitrogen.
Take out during use, 12000 r/min high speed centrifugations, 5 min after constant temperature to the room temperature remove ethanol, and the RNA resolution of precipitate does not have RNAse water in 20 μ L, promptly can be used as Quality Control and use.
6, the evaluation of quality
OD260, OD260/OD280 ratio through spectrophotometric determination RNA Quality Control.Also need use PCR and RT-PCR to identify the validity of Quality Control nucleic acid respectively.Quality Control RNA electrophoretic band is clear, OD260/OD280 is between 1.8～2.0.
7, the application of Quality Control
(1) Quality Control reverse transcription PCR detection reaction
With the RNA Quality Control is the template of detection reaction, carries out detection reaction.Testing conditions reference reagent box specification sheets.The RNA quality-control sample has good amplification curve, and the Ct value shows that test kit is in good condition in predetermined scope.
(2) differentiate true positives amplification and false positive amplification
If when holding the suspection attitude, then need detect product and further differentiate to male for the male detected result.
With the upstream and downstream primer to irrelevant stochastic sequence design amplified production (diluting 100 ~ 1000 times with sterilized water) being carried out PCR detects; Whether to differentiate is the false positive amplification, 25 μ L amplification systems comprise: 1 * PCR reaction buffer, 1.5 mol/L MgCl2; 200 μ mol/L dNTP (containing A, G, C, T); 1U heat-resistant dna polysaccharase, irrelevant each 0.2 μ mol/L of sequence upstream/downstream primer final concentration, 1 μ L template DNA (amplified production of dilution); Reaction conditions is: preparatory 95 ℃ of 5 min of sex change; 35 circulations: 94 ℃, 30 s, 55 ℃, 30 s, 72 ℃, 1 min; Replenish and extend: 72 ℃, 10 min.If the PCR test positive shows that then previous detection reaction is a false positive; If it is negative that PCR detects, show that then previous detection reaction is a true positives.
(3) assembling molecular diagnosis/detection kit
Negative serum with suitable is diluted to different extent of dilution with protective material with the nucleic acid Quality Control, makes the variation in gradient of its copy number, gets each extent of dilution and detects.According to detection case, get 3 amplification cycles and count the Ct value and be the successive extent of dilution as the quantitative Quality Control of the copy number of test kit.Under different storage conditions, the stability and the validity period of checking quality control product.Get effectively quality control product steady in a long-term as the Quality Control of test kit.
Claims (3)
1. the preparation method of the nucleic acid Quality Control of the irrelevant sequence of chimeric external source comprises the steps:
(1) irrelevant sequence source and selecting: comprise method I or method II, when detection reaction is a selecting method I during based on product length, when detection reaction is a taqman real-time quantitative PCR or similar centre selecting method II when containing the detection reaction of probe;
Said method I: choose the section of DNA sequence from existing plasmid vector; Analyze the GC content and the secondary conformation of this dna sequence dna with biological software; It is irrelevant sequence I that the dna sequence dna that satisfies following condition is selected for use: a) homology of irrelevant sequence I and mikrobe to be detected is lower than 5%; B) GC content is between 45%～55%, and c) secondary structure is comparatively simple, and d) average T M value is between 60 ℃～85 ℃;
Said method II: adopt the synthetic one section irrelevant sequence II of chemical method, satisfy irrelevant sequence II and mikrobe to be detected and do not have homology;
(2) primer design
Utilize the General Principle of design of primers to design a pair of irrelevant sequence I primer and a pair of mikrobe Auele Specific Primer I to be detected respectively to irrelevant sequence I and mikrobe to be detected described in step (1) the method I; 5 ' end in the downstream of the upper reaches of irrelevant sequence I primer and irrelevant sequence I primer adds the mikrobe Auele Specific Primer to be detected I upper reaches and mikrobe Auele Specific Primer I to be detected downstream respectively, obtains a pair of chimeric primers;
Rule with design of primers designs a pair of mikrobe Auele Specific Primer II to be detected and mikrobe probe to be detected to mikrobe to be detected, also need design a pair of irrelevant sequence II primer to irrelevant sequence II; One section of chemosynthesis from 5 ' to hold 3 ' end be the dna fragmentation of mikrobe upstream primer II to be detected, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, mikrobe downstream primer II to be detected successively;
(3) pcr amplification
With chimeric primers described in the step (2); The said existing plasmid vector of pcr amplification step (1) method I obtains double chain DNA sequence product I: the product I from 5 ' to hold 3 ' end be mikrobe upstream primer I to be detected, irrelevant sequence I upstream primer, irrelevant sequence I, irrelevant sequence I downstream primer and mikrobe downstream primer I to be detected successively;
With the said dna fragmentation of mikrobe Auele Specific Primer II pcr amplification step to be detected (2) described in the step (2), obtain double chain DNA sequence product II: from 5 ' to hold 3 ' end be mikrobe upstream primer sequence II to be detected, irrelevant sequence II upstream primer, irrelevant sequence II, mikrobe probe to be detected, irrelevant sequence II, irrelevant sequence II downstream primer, mikrobe downstream primer II to be detected successively;
(4) clone
Agarose electrophoresis PCR product; Use glue to reclaim test kit and reclaim product I or product II, behind the spectrophotometer standard measure, TA connection product I or product II are to the pGEM-T carrier; Pass through resistance screening; PCR identifies transformant, obtains positive transformant pGEM-T-product I or pGEM-T-product II, promptly required DNA Quality Control I or DNA Quality Control II; DNA Quality Control I or DNA Quality Control II are transformed and be stored in the colibacillus engineering;
(5) in-vitro transcription and purifying
PGEM-T-product I or pGEM-T-product II are carried out linearizing through single endonuclease digestion, and restriction enzyme site is positioned at and inserts outside the gene, utilizes the in-vitro transcription test kit to carry out the synthetic of external RNA, obtains RNA Quality Control I or RNA Quality Control II;
Purification step is: a) replenish no RNAse enzyme aqua sterilisa to 100 μ L, add 900 μ L TriPure Isolation Reagent then, the vibration mixing; Room temperature leaves standstill 5 min, adds 200 μ L chloroforms, shakes 60 s; Then in 4 ℃, 12000 r/min high speed centrifugations, 15 min; 2) get 500 μ L supernatants, and add equal-volume Virahol room temperature and leave standstill 30 min, 12000 r/min high speed centrifugations, 15 min, supernatant discarded is with 75% washing with alcohol 1 time; 3) add 1 mL, 75% ethanol then, be stored in-80 ℃ of refrigerators or liquid nitrogen.
2. according to the preparation method of the nucleic acid Quality Control of the irrelevant sequence of the said chimeric external source of claim 1; It is characterized in that: dna fragmentation length described in the step (2) is between 80bp～1000bp, and irrelevant mikrobe probe 5 ' to be detected at random holds the distance of mikrobe upstream primer II 3 ' end to be detected between 5 ~ 50bp.
3. the nucleic acid Quality Control of the irrelevant sequence of the described chimeric external source of claim 1 is applicable to the purposes of molecular diagnosis or detection kit nucleic acid quality control product in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110339776.2A CN102443628B (en) | 2011-11-01 | 2011-11-01 | Preparation method for nucleic acid quality control by chimeric exogenous independent sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110339776.2A CN102443628B (en) | 2011-11-01 | 2011-11-01 | Preparation method for nucleic acid quality control by chimeric exogenous independent sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102443628A true CN102443628A (en) | 2012-05-09 |
| CN102443628B CN102443628B (en) | 2014-12-17 |
Family
ID=46006567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110339776.2A Active CN102443628B (en) | 2011-11-01 | 2011-11-01 | Preparation method for nucleic acid quality control by chimeric exogenous independent sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102443628B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978283A (en) * | 2012-11-20 | 2013-03-20 | 天昊生物医药科技（苏州）有限公司 | Molecular internal standard quality control method and kit for biological sample nucleic acid detection |
| CN106148481A (en) * | 2015-03-12 | 2016-11-23 | 成都大学 | A kind of positive control composition for polymerase chain-reaction test method and test kit and preparation method thereof |
| CN108138228A (en) * | 2015-09-29 | 2018-06-08 | 卡帕生物系统公司 | High-molecular-weight DNA sample for next generation's sequencing tracks label |
| CN117912558A (en) * | 2024-03-19 | 2024-04-19 | 北京医院 | Method for producing nucleic acid sequence which does not exist in nature and nucleic acid sequence produced thereby |
-
2011
- 2011-11-01 CN CN201110339776.2A patent/CN102443628B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| HUANG JIE ET AL.: "The establishment of quality control materials for human papilloma virus genotyping", 《CHIN J LAB MED》 * |
| 徐任等: "采用基因分型质控品评价荧光PCR法人乳头瘤病毒核酸检测试剂盒", 《药物分析杂志》 * |
| 雷秀霞等: "液体人血浆HCV-RNA 质控品临床应用探讨", 《热带医学杂志》 * |
| 龙春平等: "荧光实时定量PCR法检测流感病毒核酸的质控结果分析", 《中国卫生检验杂志》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978283A (en) * | 2012-11-20 | 2013-03-20 | 天昊生物医药科技（苏州）有限公司 | Molecular internal standard quality control method and kit for biological sample nucleic acid detection |
| CN102978283B (en) * | 2012-11-20 | 2015-09-23 | 天昊生物医药科技（苏州）有限公司 | For Molecular internal standard quality control and the test kit thereof of biological specimen detection of nucleic acids |
| CN106148481A (en) * | 2015-03-12 | 2016-11-23 | 成都大学 | A kind of positive control composition for polymerase chain-reaction test method and test kit and preparation method thereof |
| CN108138228A (en) * | 2015-09-29 | 2018-06-08 | 卡帕生物系统公司 | High-molecular-weight DNA sample for next generation's sequencing tracks label |
| CN108138228B (en) * | 2015-09-29 | 2022-05-27 | 卡帕生物系统公司 | High molecular weight DNA sample tracking tag for next generation sequencing |
| CN117912558A (en) * | 2024-03-19 | 2024-04-19 | 北京医院 | Method for producing nucleic acid sequence which does not exist in nature and nucleic acid sequence produced thereby |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102443628B (en) | 2014-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107760762B (en) | Fluorescent chemical sensor for detecting DNA adenine methyltransferase and detection method thereof | |
| Zhou et al. | Influenza A virus molecular virology techniques | |
| Whale et al. | Detection of rare drug resistance mutations by digital PCR in a human influenza a virus model system and clinical samples | |
| Gall et al. | Universal primer set for amplification and sequencing of HA0 cleavage sites of all influenza A viruses | |
| CN111334868A (en) | Construction method of novel coronavirus whole genome high-throughput sequencing library and kit for library construction | |
| CN112322705A (en) | Isothermal amplification fluorescence RMA method for multiple nucleic acid detection | |
| Newsome et al. | Presence of bacterial phage-like DNA sequences in commercial Taq DNA polymerase reagents | |
| DK3105324T3 (en) | NGS SYSTEM CONTROL AND PROCEDURES COMPREHENSIVE THESE | |
| CN102443628B (en) | Preparation method for nucleic acid quality control by chimeric exogenous independent sequence | |
| US9617606B2 (en) | Oligonucleotide for HIV detection, HIV detection kit, and HIV detection method | |
| CN105349697A (en) | GeXP quick detection kit capable of identifying eight different human-infected hypotype avian influenza virus HA genes at same time and application of GeXP quick detection kit | |
| Yang et al. | SARS‐CoV‐2, SARS‐CoV, and MERS‐CoV encode circular RNAs of spliceosome‐independent origin | |
| Lee et al. | High-resolution melting approach to efficient identification and quantification of H275Y mutant influenza H1N1/2009 virus in mixed-virus-population samples | |
| CN110923314A (en) | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof | |
| CN103740863A (en) | RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) kit for detecting avian influenza virus subtype H7N9 | |
| Majoros et al. | Restriction enzyme analysis of ribosomal DNA shows that Candida inconspicua clinical isolates can be misidentified as Candida norvegensis with traditional diagnostic procedures | |
| CN104404162A (en) | Real-time fluorescence PCR method for detecting multiple genes or different targets with primer associated universal probe | |
| CN110945146B (en) | Assay for detection of Human Immunodeficiency Virus (HIV) | |
| CN101560572B (en) | Fluorescence quantitative PCR kit for detecting calf diarrhea virus and application | |
| CN103451320A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for three genotypes of human parvovirus B19, as well as universal detection primer, TaqMan probe and kit thereof | |
| CN102071260A (en) | Target sequence for detecting RNA of influenza A H1N1 viruses and kit | |
| CN101560573B (en) | Fluorescence quantitative PCR kit for detecting type-3 cow adenovirus | |
| CN113774165A (en) | HBV genotyping detection method and kit | |
| Subba-Reddy et al. | RNA synthesis by the brome mosaic virus RNA-dependent RNA polymerase in human cells reveals requirements for de novo initiation and protein-protein interaction | |
| CN110714083B (en) | HELA (HELA) cell pollution detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 400020 room 76, Yanghe village, Jiangbei District, Chongqing, 506-512 Patentee after: Chongqing customs Technology Center Address before: 400020 No. 8, red yellow road, Jiangbei District, Chongqing Patentee before: INSPECTION AND QUARANTINE TECHNOLOGY CENTER OF CHONGQING ENTRY EXIT INSPECTION AND QUARANTINE BUREAU |
|
| CP03 | Change of name, title or address |