CN102433377A - Universal plasmid standard molecule for detecting transgenic cotton and building method thereof - Google Patents
Universal plasmid standard molecule for detecting transgenic cotton and building method thereof Download PDFInfo
- Publication number
- CN102433377A CN102433377A CN2011103243711A CN201110324371A CN102433377A CN 102433377 A CN102433377 A CN 102433377A CN 2011103243711 A CN2011103243711 A CN 2011103243711A CN 201110324371 A CN201110324371 A CN 201110324371A CN 102433377 A CN102433377 A CN 102433377A
- Authority
- CN
- China
- Prior art keywords
- gene
- cotton
- seq
- amplification
- control molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a universal plasmid standard molecule for detecting transgenic cotton and a building method thereof, belonging to the technical field of transgenic plant detection. The plasmid standard molecule contains a cotton endogenous reference gene sadI, a fusion gene of insect resistant genes CryIAb/CryIAc, an insect resistant gene CPTI, a herbicide resistant gene CP4, a marker gene Kan, and partial sequences of regularory sequence 35S starter and Nos terminator. The plasmid standard molecule is good in stability and easy to preserve, and can be used as standard positive reference for various transgenic cotton detection.
Description
Technical field
The invention belongs to the transgenic plant detection technical field, be specifically related to a kind of transgene cotton and detect general plasmid control molecule and construction process thereof.
Background technology
Along with the develop rapidly of transgenic technology, increasing transgenic product is come out and the large-scale commercial applications application.Countries in the world are all at the security control that improves transgenic product.Detection of nucleic acids is one of effective ways that transgenic product carried out security control, in the detection of nucleic acids process, for preventing false-positive appearance, the standard positive material must be arranged as a reference.The standard positive material that derives from the transgenic plant of isozygotying commonly used is at present influenced by a lot of factors all at aspects such as preparation, storage and mensuration; And be not that all crop transgenic strains all exist this class standard positive material, thereby have influence on Molecular Detection to transgenic product.Therefore, the shortage of standard positive material has become one of main factor of restriction transgenic product detection, is badly in need of the substitute of development standard positive material.Taverniers equals calendar year 2001 proposition " single target plasmid molecule " notion; Being about to the different target dna fragmentation is cloned into respectively on the carrier as standard molecule (Taverniers I; Windels P; Bocktaele E V; Et al.Use of cloned DNA fragments for event specific quantification of genetically modified organisms in pure and mixed food products.Eur Food Res Tethnol, 2001,213 (6): 417-424).2002, Japanese scientist Kuribara proposed notion (Kuribara H, the Shindo Y of plasmid control molecule; Matsuoka T; Et al.Novel reference molecules for quantitation of genetically modified maize and soybean.J AOAC Int, 2002,85 (5): 1077-1089); Plasmid control molecule can obtain to cloning vector through the gene fragment clone that will detect, and operates very simple.In addition, plasmid control molecule also has purity height, good stability, is easy to advantages such as preservation.The empirical tests plasmid control molecule is good standard positive material surrogate in the GMO identification and detection; The plasmid control molecule of the detection MON810 that makes up like Corbisier etc. is through the test of reference material method institute of Joint Research Centre of European Union, final registration and called after certified reference material ERM-AD413 (Corbisier P, Broeders S; Charels D; Et al.Certification of plasmidic DNA containing MON810maize DNA fragments, ERM-AD413.EC certification report, 2007; EUR 22948, ISBN 978-92-79-07139-3).Therefore, make up the positive criteria molecule and become the research focus of transgenic detection range in the world.At present; Having obtained multiple transgenic product abroad detects with plasmid control molecule (Debode F; Marien A, Janssen E.Design of multiplex calibrant plasmids, their use in GMO detection and the limit of their applicability for quantitative purposes owing to competition effects.Anal Bioana Chem; 2010,396:2151-2164).China has also carried out the research of many positive criteria molecule plasmid constructions aspect, has successfully made up multiple positive criteria molecule.Multiple positive criteria molecule (Yang L T, Guo J C, Pan A H like the foundation of Shanghai university of communications; Et al.Event specific quantitative detection of nine genetically modified maizes using one novel standard reference molecule.J Agri Food Chem; 2007,55 (1): 15-24), the general plasmid control molecule (Ao Jinxia of transgenic paddy rice, corn and soybean that Northeast Agricultural University makes up; Height is learnt military affairs; Qu Bo, etc. genetically engineered soybean, corn and paddy rice foreign gene detect the structure [J] of universal standard molecule. China Agricultural University's journal, 2008; 13 (6): 19-24), the plasmid control molecule (Li Feiwu of the detection MON89788 that makes up of academy of agricultural sciences, Jilin; Shao Gaige, Xing Zhenjuan, etc. genetically engineered soybean MON89788 detects the structure and the application of plasmid control molecule.The Anhui agricultural sciences, 2010,38 (23): 12330-12333), the genetically modified crops examination that Inst. of Oil Crops, Chinese Academy of Agriculture makes up with positive criteria molecule etc. (Hu Shangjie, Wu Gang, Wu Yuhua, etc.The genetically modified crops examination is with the structure and the applied research of positive plasmid molecule.China's oil crops journal, 2010,32 (2): 173-179).Transgenic cotton against pests large-scale commercial applications application, the Insect Resistant Cotton of plantation mainly contains the Insect Resistant Cotton of the trans Bt gene of Monsanto Company in the market, and the commentaries on classics Bt of Biological Technology institute, Chinese Academy of Agricultural Sciences's research and development or the Insect Resistant Cotton of CPTI.The transgene cotton plasmid molecule that Shanghai Communications University makes up mainly is to design to Bt, and Shang Weiyou detects the general plasmid control molecule of transgene cotton.
Summary of the invention
The object of the present invention is to provide a kind of transgene cotton to detect general plasmid control molecule, satisfy transgene cotton and detect demand.
The present invention also aims to provide a kind of transgene cotton to detect the construction process of general plasmid control molecule.
A kind of transgene cotton detects general plasmid control molecule, and said plasmid control molecule contains cotton internal standard gene sadI, anti insect gene CryIAb/CryIAc fusion gene; Anti insect gene CPTI; Anti-herbicide gene CP4, marker gene Kan, regulating and controlling sequence 35S promoter and Nos terminator sequence.
A kind of transgene cotton detects the construction process of general plasmid control molecule, carries out according to following steps:
(1), obtains cotton internal standard gene SadI, anti insect gene CryIAb/CryIAc fusion gene through GenBank DB and document inquiry; Anti insect gene CPTI; Anti-herbicide gene CP4, marker gene Kan, the nucleotide sequence of regulating and controlling sequence 35S promoter and Nos terminator;
(2) according to the nucleotide sequence of the goal gene that obtains, design primer, PCR obtains target gene fragment; Wherein, The primer that SEQ ID NO1 and SEQ ID NO2 form obtains cotton internal standard gene sadI to the amplification Insect Resistant Cotton; The primer that SEQ ID NO3 and SEQ ID NO4 form obtains anti insect gene CryIAb/CryIAc fusion gene to the amplification Insect Resistant Cotton; The primer that SEQ ID NO5 and SEQ ID NO6 form obtains anti insect gene CPTI to the amplification Insect Resistant Cotton; The primer that SEQ ID NO7 and SEQ ID NO8 form obtains anti-herbicide gene CP4 to the amplification phytocide cotton, and the primer that SEQ ID NO9 and SEQ ID NO10 form obtains Nos terminator sequence to the amplification Insect Resistant Cotton;
(3) the cotton internal standard gene SadI PCR product and the T-carrier that step (2) are obtained are connected to form intermediate carrier pGhsadI;
(4) adopt the Overlapping round pcr; With the anti insect gene CryIAb/CryIAc fusion gene of step (2) acquisition and the PCR product of anti insect gene CPTI is that template is carried out pcr amplification; Obtain CryIAb/CryIAc-CPTI fusion gene fragment, and be connected to form intermediate carrier pCPTI-Bt with the T-carrier;
(5) adopt the Overlapping round pcr; With the anti-herbicide gene CP4 of step (2) acquisition and the PCR product of Nos terminator partial sequence is that template is carried out pcr amplification; Obtain CP4-Nos fusion gene fragment, and be connected to form intermediate carrier pCP4-Nos with the T-carrier;
(6) adopt EcoR1 and Kpn1 double digestion carrier pCAMbia2300 and intermediate carrier pCPTI-Bt, reclaim the DNA band of 8742bp and 1222bp respectively, linked enzyme connects the back and forms intermediate carrier p2CB;
(7) adopt HindIII and salI double digestion intermediate carrier pGhsadI and p2CB to reclaim the DNA band of 824bp and 9964bp respectively, linked enzyme connects the back and forms intermediate carrier p2CBS;
(8) adopt BamHI and SalI double digestion intermediate carrier pCP4-Nos and p2CBS, reclaim the DNA band of 1584bp and 10808bp respectively, linked enzyme connects the back and forms plasmid control molecule pMCS.
Said carrier pCAMbia2300 comprises marker gene Kan and regulating and controlling sequence 35S promoter.
Said Insect Resistant Cotton is transgene cotton GK312.
Transgene cotton detects the application of general plasmid control molecule in detecting transgene cotton, and adopting said plasmid control molecule is template, does qualitative PCR and detects; Amplify and cotton internal standard gene sadI; Anti insect gene CryIAb/CryIAc fusion gene, anti insect gene CPTI, anti-herbicide gene CP4; Marker gene Kan, regulating and controlling sequence 35S promoter and Nos terminator sequence.
Beneficial effect of the present invention: plasmid control molecule purity height, the good stability that the present invention makes up, be easy to preservation; Can effectively amplify cotton internal standard gene sadI, anti insect gene CryIAb/CryIAc fusion gene, anti insect gene CPTI; Anti-herbicide gene CP4; Marker gene Kan, the partial sequence of regulating and controlling sequence 35S promoter and Nos terminator can be as the standard positive control of various transgene cottons detections.
Description of drawings
Fig. 1 is that the element of plasmid control molecule is formed synoptic diagram;
Among the figure, kan represents marker gene Kan, and 35S represents the regulating and controlling sequence 35S promoter; CPT1 represents anti insect gene CPTI, and Bt represents anti insect gene CryIAb/CryIAc fusion gene, and CP4 represents anti-herbicide gene CP4; NosT represents the partial sequence of Nos terminator, and sadI represents cotton internal standard gene sadI, and pVS1sta represents the sta zone of pVS1 plasmid; PVS1rep represents the replication region of pVS1; PBR322bom represents the bom site of pBR322 carrier, and pBR322ori represents the replication origin of pBR322 carrier, and addA represents that gene of card of expressing in the bacterium.
Fig. 2 is the segmental clone's electrophorogram of purpose;
Among the figure, M-Marker, 1-sadI gene fragment, 2-cptI gene fragment, 3-Bt gene fragment, 4-cptI and Bt fusion gene fragment, 5-Nos terminator fragment, 6-cp4 gene fragment, 7-cp4 gene and no terminator fusion gene fragment.
Fig. 3 cuts the evaluation electrophorogram for the plasmid control molecule enzyme;
Among the figure, M-Marker, 1-BamHI and SalI double digestion, 2EcoRI and HindIII double digestion, 3-HindIII and SalI double digestion, 4-XhoI enzyme are cut, the 5-HindIII enzyme is cut.
Fig. 4 is the PCR checking electrophorogram of plasmid control molecule;
Among the figure, 1-100bp Marker, 2-are template amplification CP4,3-with pMCS with increase CP4,4-of reference material be template amplification nptII, 5-with pMCS with increase nptII, 6-of reference material be template amplification SadI, 7-with pMCS with increase sadI, 8-of reference material be template amplification 35s, 9-with pMCS with increase 35s, 10-of reference material be template amplification Bt, 11-with pMCS with increase Bt, 12-of reference material be template amplification no, 13-with pMCS with increase no, 14-of reference material is template amplification cptI, 15-with the reference material cptI that increases with standard pMCS.
Embodiment
Below in conjunction with accompanying drawing and specific embodiment the present invention is further specified; Unspecified operation steps is please with reference to " molecular cloning experiment guide " third edition corresponding section (J. Sa nurse Brooker D.W. Russell work, Science Press) or consult the specification sheets of used kit among the embodiment.
The vegetable material that uses in following examples is transgene cotton GK312, antiweed transgene cotton, non-transgenic cotton.
The restriction enzyme that uses in following examples restrains Bioisystech Co., Ltd available from lark, and cloning vector pMD-18T, T4DNA ligase enzyme, Taq enzyme, dna molecular amount standard are available from precious biotechnology ltd; PCAMbia2300 is available from CAMbia company (http://www.cambia.org); The PCR product reclaims test kit, plasmid extraction kit, TOPO 10 competent cells available from the golden biotechnology of full formula ltd; Other routine biochemistry reagent are available from Bayer enlightening biotechnology ltd; Primer is accomplished by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd with order-checking.
Obtain cotton internal standard gene SadI, anti insect gene CryIAb/CryIAc fusion gene through GenBank and document inquiry; Anti insect gene CPT1; The gene order of anti-herbicide gene CP4 and Nos terminator designs 5 pairs of primers (sequence is as shown in table 1), is respectively applied for amplification SadI, anti insect gene CryIAb/CryIAc fusion gene; Anti insect gene CPT1, anti-herbicide gene CP4 and Nos terminator.
The distinguished sequence amplimer of cotton internal standard gene sadI is made up of SEQ ID NO1 and SEQ ID NO2;
The distinguished sequence amplimer of anti insect gene CryIAb/CryIAc is made up of SEQ ID NO3 and SEQ ID NO4;
The distinguished sequence amplimer of anti insect gene CPT1 is made up of SEQ ID NO5 and SEQ ID NO6;
The distinguished sequence amplimer of anti-herbicide gene CP4 is made up of SEQ ID NO7 and SEQ ID NO8;
The distinguished sequence amplimer of Nos terminator is made up of SEQ ID NO9 and SEQ ID NO10.
Table 1
The primer title | Sequence (5 '---3 ') |
SEQ?ID?NO1 | gtcgacaatgccatcgcctcgaaatct |
SEQ?ID?NO2 | aagcttgctagcacctgtctcatcacgagtt |
SEQ?ID?NO3 | acgaagacgacgaataatgaatccaactggagaggccatgat |
SEQ?ID?NO4 | ggtaccaactgcttgagtaacccagaagttgt |
SEQ?ID?NO5 | gaattcatgcgtatggacctgaaacacct |
SEQ?ID?NO6 | ttattcgtcg?tcttcgtcacgagat |
SEQ?ID?NO7 | ggatccatggctcacggtgcaagcagccgtccagcaa |
SEQ?ID?NO8 | agcagccttagtgtcggagagttcgatct |
SEQ?ID?NO9 | cactaaggctgcttgagatcgttcaaacatttggcaata |
SEQ?ID?NO10 | gtcgacttatcctagtttgcgcgct |
The structure of amplification of embodiment 2 specific sequences and intermediate carrier
1, the segmental amplification of CPT1-Bt fusion gene
(1) being primer with SEQ ID NO5 and SEQ ID NO6, is that template is carried out pcr amplification with transgene cotton GK312 genomic dna, and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 270bp.
(2) being primer with SEQ ID NO3 and SEQ ID NO4, is that template is carried out pcr amplification with transgene cotton SK312 genomic dna, and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 45s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 952bp.
(3) being primer with SEQ ID NO5 and SEQ ID NO4, is that template is carried out pcr amplification with the PCR product of step (1) and (2), and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 60s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 1222bp.
The PCR product recovery back of step (3) is connected with the T-carrier, and checks order positive colony called after pCPT1-Bt.
2, the segmental amplification of CP4-Nos fusion gene
(1) being primer with SEQ ID NO7 and SEQ ID NO8, is that template is carried out pcr amplification with antiweed transgene cotton DNA, and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 60s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 1389bp.
(2) being primer with SEQ ID NO9 and SEQ ID NO10, is that template is carried out pcr amplification with pBI121, and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 195bp.
(3) being primer with SEQ ID NO7 and SEQ ID NO10, is that template is carried out pcr amplification with the PCR product of step (1) and (2), and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 60s, 30 circulations; 72 ℃ of 5m.Amplified production is as shown in Figure 2, is 1584bp.
The PCR product recovery back of step (3) is connected with the T-carrier, and checks order positive colony called after pCP4-Nos.
3, the clone of cotton internal standard gene Sad1 gene fragment
With SEQ ID NO1 and SEQ ID NO2 is primer, is that template is carried out pcr amplification with the SK312 genomic dna, and reaction conditions is: 94 ℃ of 5m, 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 10m.Amplified production is as shown in Figure 2, is 824bp.The PCR product is reclaimed the back be connected, and check order positive colony called after pGhsadI with the T-carrier.
The structure of embodiment 3 plasmid control molecules
(1) EcoR1 and Kpn1 double digestion pCAMbia2300 and pCPT1-Bt reclaim the DNA band of 8742bp and 1222bp respectively, and linked enzyme connects the back and forms intermediate carrier p2CB.
(2) HindIII and salI distinguish double digestion pGhsadI and p2CB, reclaim the DNA band of 824bp and 9964bp respectively, and linked enzyme connects the back and forms intermediate carrier p2CBS.
(3) BamHI and SalI distinguish double digestion pCP4-Nos and p2CBS, reclaim the DNA band of 1584bp and 10808bp respectively, and linked enzyme obtains plasmid control molecule pMCS after connecting.
The concise and to the point collection of illustrative plates of the plasmid control molecule pMCS that makes up is as shown in Figure 1.P2300 representes to be used to make up the carrier of plasmid control molecule among the figure; SadI representes the distinguished sequence of cotton internal standard gene SadI, and CPTI representes anti insect gene cowpea trypsase gene, and Bt representes anti insect gene CryIAb/CryIAc fusion gene fragment; CP4 representes anti-herbicide gene; Nos representes the Nos terminator, and 35S representes 35S promoter, that gene of Kan expressive notation gene card.
The plasmid control molecule pMCS that makes up uses BamHI+SalI, EcoRI+HindIII, and HindIII+SalI, double digestion, XhoI, the HindIII single endonuclease digestion identifies that the result is as shown in Figure 3, all the stripe size with prediction is consistent.
The qualitative detection of embodiment 4 transgene cottons
Whether can be applied to the qualitative detection of transgene cotton for the plasmid control molecule of verifying structure; The contriver with primer (as shown in table 2), is that template carry out pcr amplification with the reference material (transgene component is 1%) of plasmid control molecule, transgenic phytocide cotton with transgene cotton qualitative detection commonly used, and reaction conditions is 94 ℃ of 5m; 94 ℃ of 30s; 58 ℃ of 30s, 72 ℃ of 60s, 30 circulations; 72 ℃ of 5m;
Present embodiment used the transgene cotton qualitative detection following with primer sequence:
The primer that sequence SEQ ID NO11 and SEQ ID NO12 form is right, amplification CP4 gene fragment;
The primer that sequence SEQ ID NO13 and SEQ ID NO14 form is right, amplification npt gene fragment;
The primer that sequence SEQ ID NO15 and SEQ ID NO16 form is right, amplification Sad1 gene fragment;
The primer that sequence SEQ ID NO17 and SEQ ID NO18 form is right, amplification 35S promoter fragment;
The primer that sequence SEQ ID NO19 and SEQ ID NO20 form is right, amplification CryIAb/CryIAc fusion gene fragment;
The primer that sequence SEQ ID NO21 and SEQ ID NO22 form is right, amplification Nos terminator fragment;
The primer that sequence SEQ ID NO23 and SEQ ID NO24 form is right, amplification CPT1 gene fragment;
Amplification shows (Fig. 4); The primer that sequence SEQ ID NO11 and SEQ ID NO12 form is right; When amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton; Obtain the amplified band of the unanimity of 498bp, and amplification template when being plasmid control molecule band brightness big; The primer that sequence SEQ ID NO13 and SEQ ID NO14 form is right; When amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton; Obtain the amplified band of the unanimity of 180bp, and amplification template when being plasmid control molecule band brightness big; The primer that sequence SEQ ID NO15 and SEQ ID NO16 form is right, when amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton, obtains the amplified band of the unanimity of 107bp; The primer that sequence SEQ ID NO17 and SEQ ID NO18 form is right, when amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton, obtains the amplified band of the unanimity of 195bp; The primer that sequence SEQ ID NO19 and SEQ ID NO20 form is right; When amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton; Obtain the amplified band of the unanimity of 340bp, and amplification template when being plasmid control molecule band brightness big; The primer that sequence SEQ ID NO21 and SEQ ID NO22 form is right; When amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton; Obtain the amplified band of the unanimity of 180bp, and amplification template when being plasmid control molecule band brightness big; The primer that sequence SEQ ID NO23 and SEQ ID NO24 form is right, when amplification template is the reference material of plasmid control molecule and transgenic phytocide cotton, obtains the amplified band of the unanimity of 270bp.
Table 2: the qualitative and detection by quantitative primer of plasmid control molecule
The purpose band that amplifies in the plasmid control molecule of amplification surface trimmed book research and establishment and the reference material is identical, shows that the plasmid control molecule of structure can the alternate standard material be used for the qualitative detection of transgene cotton.
Claims (5)
1. a transgene cotton detects general plasmid control molecule; It is characterized in that said plasmid control molecule contains cotton internal standard gene sadI, anti insect gene CryIAb/CryIAc fusion gene; Anti insect gene CPTI; Anti-herbicide gene CP4, marker gene Kan, regulating and controlling sequence 35S promoter and Nos terminator sequence.
One kind according to claim 1 transgene cotton detect the construction process of general plasmid control molecule, it is characterized in that, carry out according to following steps:
(1), obtains cotton internal standard gene SadI, anti insect gene CryIAb/CryIAc fusion gene through GenBank DB and document inquiry; Anti insect gene CPTI; Anti-herbicide gene CP4, marker gene Kan, the nucleotide sequence of regulating and controlling sequence 35S promoter and Nos terminator;
(2) according to the nucleotide sequence of the goal gene that obtains, design primer, PCR obtains target gene fragment; Wherein, The primer that SEQ ID NO1 and SEQ ID NO2 form obtains cotton internal standard gene sadI to the amplification Insect Resistant Cotton; The primer that SEQ ID NO3 and SEQ ID NO4 form obtains anti insect gene CryIAb/CryIAc fusion gene to the amplification Insect Resistant Cotton; The primer that SEQ ID NO5 and SEQ ID NO6 form obtains anti insect gene CPTI to the amplification Insect Resistant Cotton; The primer that SEQ ID NO7 and SEQ ID NO8 form obtains anti-herbicide gene CP4 to the amplification phytocide cotton, and the primer that SEQ ID NO9 and SEQ ID NO10 form obtains Nos terminator sequence to the amplification Insect Resistant Cotton;
(3) the cotton internal standard gene SadI PCR product and the T-carrier that step (2) are obtained are connected to form intermediate carrier pGhsadI;
(4) adopt the Overlapping round pcr; With the anti insect gene CryIAb/CryIAc fusion gene of step (2) acquisition and the PCR product of anti insect gene CPTI is that template is carried out pcr amplification; Obtain CryIAb/CryIAc-CPTI fusion gene fragment, and be connected to form intermediate carrier pCPTI-Bt with the T-carrier;
(5) adopt the Overlapping round pcr; With the anti-herbicide gene CP4 of step (2) acquisition and the PCR product of Nos terminator partial sequence is that template is carried out pcr amplification; Obtain CP4-Nos fusion gene fragment, and be connected to form intermediate carrier pCP4-Nos with the T-carrier;
(6) adopt EcoR1 and Kpn1 double digestion carrier pCAMbia2300 and intermediate carrier pCPTI-Bt, reclaim the DNA band of 8742bp and 1222bp respectively, linked enzyme connects the back and forms intermediate carrier p2CB;
(7) adopt HindIII and salI double digestion intermediate carrier pGhsadI and p2CB to reclaim the DNA band of 824bp and 9964bp respectively, linked enzyme connects the back and forms intermediate carrier p2CBS;
(8) adopt BamHI and SalI double digestion intermediate carrier pCP4-Nos and p2CBS, reclaim the DNA band of 1584bp and 10808bp respectively, linked enzyme connects the back and forms plasmid control molecule pMCS.
3. detect the construction process of general plasmid control molecule according to the said transgene cotton of claim 2, it is characterized in that said carrier pCAMbia2300 comprises marker gene Kan and regulating and controlling sequence 35S promoter.
4. detect the construction process of general plasmid control molecule according to the said transgene cotton of claim 2, it is characterized in that said Insect Resistant Cotton is transgene cotton GK312.
5. the said transgene cotton of claim 1 detects the application of general plasmid control molecule in detecting transgene cotton, it is characterized in that adopting said plasmid control molecule is template; Do qualitative PCR and detect, amplify and cotton internal standard gene sadI, anti insect gene CryIAb/CryIAc fusion gene; Anti insect gene CPTI; Anti-herbicide gene CP4, marker gene Kan, regulating and controlling sequence 35S promoter and Nos terminator sequence.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110324371 CN102433377B (en) | 2011-10-22 | 2011-10-22 | Universal plasmid standard molecule for detecting transgenic cotton and building method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110324371 CN102433377B (en) | 2011-10-22 | 2011-10-22 | Universal plasmid standard molecule for detecting transgenic cotton and building method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102433377A true CN102433377A (en) | 2012-05-02 |
CN102433377B CN102433377B (en) | 2013-07-10 |
Family
ID=45981723
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110324371 Expired - Fee Related CN102433377B (en) | 2011-10-22 | 2011-10-22 | Universal plasmid standard molecule for detecting transgenic cotton and building method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102433377B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104762310A (en) * | 2015-04-02 | 2015-07-08 | 贵州省烟草科学研究院 | High-coverage standard reference plasmid for detecting transgenic tobacco and application of high-coverage standard reference plasmid for detecting transgenic tobacco |
CN105779573A (en) * | 2014-12-22 | 2016-07-20 | 中国农业科学院生物技术研究所 | Plasmid standard molecule applicable to detection of transgenic pest-resistant cotton and application thereof |
-
2011
- 2011-10-22 CN CN 201110324371 patent/CN102433377B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
王旭静等: "《转豇豆胰蛋白酶CPTI基因棉花检测用标准分子的制备》", 《中国生物工程杂志》 * |
胡福泉: "《现代基因操作技术》", 31 October 2000 * |
陆姣等: "《标准分子构建及其在转基因玉米59122定量检测中的应用》", 《食品科学》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105779573A (en) * | 2014-12-22 | 2016-07-20 | 中国农业科学院生物技术研究所 | Plasmid standard molecule applicable to detection of transgenic pest-resistant cotton and application thereof |
CN104762310A (en) * | 2015-04-02 | 2015-07-08 | 贵州省烟草科学研究院 | High-coverage standard reference plasmid for detecting transgenic tobacco and application of high-coverage standard reference plasmid for detecting transgenic tobacco |
Also Published As
Publication number | Publication date |
---|---|
CN102433377B (en) | 2013-07-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2463370B1 (en) | Use of genetically modified organisms to generate biomass degrading enzymes | |
US10006038B2 (en) | Consolidated pretreatment and hydrolysis of plant biomass expressing cell wall degrading enzymes | |
US20170081676A1 (en) | Plant promoter and 3' utr for transgene expression | |
CN102433377B (en) | Universal plasmid standard molecule for detecting transgenic cotton and building method thereof | |
WO2017030864A1 (en) | Plant promotor and 3' utr for transgene expression | |
US10294485B2 (en) | Plant promoter and 3′ UTR for transgene expression | |
US20190040404A1 (en) | Plant promoter and 3' utr for transgene expression | |
US10450577B2 (en) | Root-preferred promoter from a Panicum virgatum metallothionein-like gene | |
CN101880665A (en) | Promoter of rice root hair development control gene OsRHL1 and application thereof | |
US10443067B2 (en) | Root-preferred promoter from a brachypodium distachyon metallothionein-like gene | |
US20190161761A1 (en) | Plant promoter and 3'utr for transgene expression | |
WO2019060145A1 (en) | Use of a maize untranslated region for transgene expression in plants | |
US20170114355A1 (en) | Plant promoter for transgene expression | |
AU2017259115B2 (en) | Plant promoter and 3'UTR for transgene expression | |
AU2012241142B2 (en) | Use of genetically modified organisms to generate biomass degrading enzymes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130710 Termination date: 20201022 |