CN102433271A - Preparation and use of cellulase producing strain P5 - Google Patents
Preparation and use of cellulase producing strain P5 Download PDFInfo
- Publication number
- CN102433271A CN102433271A CN2011103480740A CN201110348074A CN102433271A CN 102433271 A CN102433271 A CN 102433271A CN 2011103480740 A CN2011103480740 A CN 2011103480740A CN 201110348074 A CN201110348074 A CN 201110348074A CN 102433271 A CN102433271 A CN 102433271A
- Authority
- CN
- China
- Prior art keywords
- strain
- cellulase
- bacterial strain
- substratum
- producing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a new cellulase producing strain P5. The collection number of the strain in China General Microbiological Culture Collection Center is CGMCCNo.5356; the 16SrDNA sequence of the strain is represented by SEQIDNo.1. The cellulase producing strain P5 provided by the invention is screened and identified from soil by using sodium-carboxymethylcellulose-containing cellulase producing strain screening and culture solution and genetic engineering technical means. The cellulase secretion characteristic of the strain indicates the cellulase secreted by the stain has the characteristics of wide temperature adaption range and certain acid and alkali resistance. The strain and the cellulase secreted by the strain has application potential in many industries, including biological energy source, cloth washing, textile, food processing, and fermentation production industries and other industries.
Description
Technical field
The invention belongs to biological technical field, be specifically related to preparation and the application of a strain cellulase producing bacteria strain P5, and the method for strain identification, its secretor type cellulase of the bacterium that is screened has that the adaptive temperature scope is wide, the characteristics of anti-certain acid-basicity.
Background technology
Mierocrystalline cellulose is that occurring in nature distributes extensively and the abundantest a kind of glucide resource of output, but because the degraded difficulty, very low of the utilization ratio that causes cellulose resource.All incinerated such as raw material major parts such as stalk and cots, do like this and both endanger the eubiosis, again the weighting ring environment pollution.Cellulosic molecule can be by cellulose degraded.Cellulase is an enzyme system, the β-1 that can degrade, 4-glucoside bond.Study on Cellulase is the basis of cellulose resource comprehensive utilization.The mikrobe that is used for the biological Study on degradation of Mierocrystalline cellulose at present belongs to fungi mostly, and screening exploitation highly effective cellulose degradation bacteria and Study on Cellulase will be lacked much relatively in bacterium.The research of cellulose degradation bacterium concentrates on the bacillus class mostly,
Pantoea ananatisIn research report is not arranged.Along with molecular biology, engineered fast development, all attempt using gene engineering technique both at home and abroad and screen, transform and make up highly effective cellulose degradation bacteria strains, development of new cellulase efficiently.Therefore, need to strengthen research, to develop novel cellulase to the bacteria cellulose enzyme through biotechnological means.
Summary of the invention
The object of the present invention is to provide the plain enzyme of a strain tencel to produce bacterium, and through the method for 16S rDNA to identification of strains.The cellulase producing bacteria strain P5 that is screened has that the adaptive temperature scope is wide, the characteristics of anti-certain acid-basicity.Can be applied to a plurality of industries such as bioenergy, laundry weaving, food-processing, fermentative prodn.
Technical scheme of the present invention is: a strain cellulase producing bacteria, and said bacterial strain at the preserving number of Chinese common micro-organisms preservation administrative center is: CGMCC NO.5356; Preservation date on October 17th, 2011, the classification called after
Pantoea ananatis, the 16S rDNA sequence such as the SEQ ID NO.1 of bacterial strain are said.The 16S rDNA gene order of this bacterial strain has been logined the Genbank DB, and accession number is FJ796221.
The preparation method of above-mentioned cellulase producing bacteria is:
(1) sample separation near the soil rotted plant material branches and leaves surface reaches, sample adds in the 50 mLLB substratum, in 250 mL Erlenmeyer flasks, cultivates 24 h with 160 rpm rotating speeds in 37 ° of C and coats on the LB solid plate, obtains bacterial strain; Said LB liquid nutrient medium component is: contain peptone 10g in every 1L zero(ppm) water, yeast powder 5g, NaCl 10g; Said LB solid plate component is: contain peptone 10g in every 1L zero(ppm) water, yeast powder 5g, NaCl 10g agar powder 12g;
(2) colony inoculation is arrived cellulase-producing bacterial strain screening substratum, in cultivating incubator, cultivate 2-4 d, the generation bacterium of the plain enzyme of screen fibre, used substratum is: contain Xylo-Mucine 10 g in every 1L substratum, peptone 10g, yeast powder 5 g, KH
2PO
41 g, MgSO
40.2 g, NaCl 10 g, glucose 2 g, agar powder 12 g supply volume to 1L with zero(ppm) water;
(3) with dyeing 5 min in 0. 5% the Congo red cellulase-producing bacterial strain screening substratum of pouring into after the inoculation culture, outwell Congo red after, use 5% NaCl solution soaking decolouring 1h, screening obtains the cellulase-producing bacterial strain.
(4) to bacterial strain 16S rDNA gene clone and sequential analysis; The general upstream primer sequence that is used for cloning bacteria 16S rDNA gene is: AGAGTTTGATCCTGGCTCAG, general downstream primer sequence is: GGTTACCTTGTTA CGACTT.
The invention has the beneficial effects as follows: with the cellulase-producing bacterial strain screening substratum and the genetic engineering technique means that contain Xylo-Mucine; From soil, screen and identify cellulase producing bacteria strain P5 of the present invention; Show that through bacterial strain secretor type cellulase specificity analysis this bacterium excretory cellulase has that the adaptive temperature scope is wide, the characteristics of anti-certain acid-basicity.Screening and authentication method that the present invention adopts are easy to operate, and accuracy is high as a result.This bacterium and excretory cellulase thereof will have application potential in a plurality of industries such as bioenergy, laundry weaving, food-processing, fermentative prodn.
Description of drawings
Fig. 1 is the genomic dna of cellulase producing bacteria strain P5 and the agarose gel electrophoresis figure (1: genomic dna of 16S rDNA; 2:Marker, once size is 2000bp from top to bottom, 1000bp, 750bp, 500bp, 250bp, 100bp; 3:16S rDNA).
Fig. 2 is the influence data plot of incubation time to bacterial strain P5 cellulase-producing.
Fig. 3 is the influence data plot of culture temperature to bacterial strain P5 cellulase-producing.
Fig. 4 is the influence data plot of pH to bacterial strain P5 cellulose enzyme activity.
Fig. 5 is the influence data plot of temperature to bacterial strain P5 cellulose enzyme activity.
Embodiment
One, main raw
(1) substratum
LB liquid nutrient medium component is: contain peptone 10g in every L substratum, yeast powder 5g, NaCl 10g;
LB solid plate component is: contain peptone 10g in every L substratum, yeast powder 5g, NaCl 10g agar powder 12g;
The screening culture medium component is: contain Xylo-Mucine 10 g in every 1L substratum, peptone 10g, yeast powder 5 g, KH
2PO
41 g, MgSO
40.2 g, NaCl 10 g, glucose 2 g, agar powder 12 g;
The fermention medium component is: contain Xylo-Mucine 10g in every L substratum, peptone 10g, yeast powder 10g, KH
2PO
41 g, (NH
4)
2SO
42 g, NaCl 5g.
(2) experimental instrument and equipment
FA2004 electronic balance---Shanghai flat more scientific instrument ltd
Instrument ltd is established in electronics electric furnace---Shanghai
DNP-9162 type electro-heating standing-temperature cultivator---go up the grand experimental installation of Nereid ltd
DYY-12 type electrophoresis apparatus---Beijing Liuyi Instrument Factory
YXJ-2 supercentrifuge---Changzhou Guohua Electric Appliance Co., Ltd.
Low speed centrifuge---Changzhou Guohua Electric Appliance Co., Ltd.
Digital display type electric-heated thermostatic water bath---the Shanghai medical apparatus and instruments factory of making a leapleap forward
D-1 type high-pressure steam sterilizing pan---Beijing Fa En scientific & trading Co., Ltd.
7230G visible spectrophotometer---Shanghai Precision Scientific Apparatus Co., Ltd
THZ-C constant temperature oscillator---Taicang experimental installation factory
XS-213 opticmicroscope---Nanjing Jiangnan Yongxin Optical Co., Ltd.
HYG type shaking table---the glad stamen automatic equipment in Shanghai ltd
Haier refrigerator---Qingdao Haier Group
Pipettor---Dragon Medical(Shanghai) Co., Ltd.
Sanyo's Ultralow Temperature Freezer---SANYO GS Electronics Co., Ltd.
WD-9413A gel imaging analysis appearance---Liuyi Instruments Plant, Beijing
Two, the screening of a strain cellulase producing bacteria strain P5
(1) sample separation near the soil rotted plant material branches and leaves surface reaches, sample adds in the 50 mLLB substratum, in 250 mL Erlenmeyer flasks, cultivates 24 h with 160 rpm rotating speeds in 37 ° of C and coats on the LB solid plate, obtains bacterial strain;
(2) colony inoculation is arrived cellulase-producing bacterial strain screening substratum, in cultivating incubator, cultivate 2-4 d, the generation bacterium of the plain enzyme of screen fibre, used substratum is: contain Xylo-Mucine 10 g in every 1L substratum, peptone 10g, yeast powder 5 g, KH
2PO
41 g, MgSO
40.2 g, NaCl 10 g, glucose 2 g, agar powder 12 g supply volume to 1L with zero(ppm) water;
(3) with dyeing 5 min in 0. 5% the Congo red cellulase-producing bacterial strain screening substratum of pouring into after the inoculation culture, outwell Congo red after, use 5% NaCl solution soaking decolouring 1h, screening obtains the cellulase-producing bacterial strain.
Three, identification of strains analysis
(1) gramstaining
Connect bacterium on slide glass; Just dye: drip Viola crystallina (suitable) dyeing 1-2 min, washing just mycoderm is covered as; Mordant dyeing: wash away residual water with iodine liquid, and cover about 1 min, washing with iodine liquid; Decolouring: remove the residual water on the slide with the filter paper suction, slide is tilted, under white background, add 95% ethanol decolorization with dropper stream, when effusive ethanol does not have purple, washing (bleaching time is generally 20-30 s) immediately; Redye: redye about 2 min with sarranine liquid, washing; Microscopy: after the drying, observe with oily mirror.It is gram-positive microorganism that thalline is dyed hepatic, and what dyed redness is Gram-negative bacteria.
(2) extraction of bacterial strain DNA
Inoculum size inoculated bacteria by 1% is in the test tube that 5 mLLB liquid nutrient mediums are housed, and 30 ℃ of 150 r/min shaking culture spent the night, and makes it grow to logarithmic phase, gets 1 mL bacterium liquid next day in 1.5 mL centrifuge tubes, 1.0 * 10
4The centrifugal 1 min deposition of r/min bacterium liquid; Abandon supernatant, add 450 μ L zero(ppm) water, add 50 μ L 20%SDS again, the centrifuge tube that turns upside down gently makes it mixing, 75 ℃ of water-bath 5 min (until bacterium liquid cracking becoming clarification); 500 μ L3: 1 phenol: chloroform extracting protein, turning upside down gently makes it mixing, centrifugal 5 min of 10000 * g; The gentle aspiration supernatant is in new 1.5 mL centrifuge tubes (noting not being drawn onto intermediary protein) and supply volume to 500 μ L, adds 500 μ L3: 1 phenol: chloroform, 1.0 * 10
4Centrifugal 5 min of r/min draw supernatant, so repeatedly, till can't see the intermediary protein layer, (notice preventing that DNA from the fracture degraded taking place in extracting) as far as possible; Draw supernatant in new 1.5 mL centrifuge tubes and supply volume, add 500 μ L chloroforms, mixing gently, 1.0 * 10 to 500 μ L
4Centrifugal 5 min of r/min; Draw supernatant in new 1.5 mL centrifuge tubes, add 50 μ L 3M NaAc, add the Virahol of 500 μ L then, turn upside down several times, should see that flocks produces 1.0 * 10 this moment
4Centrifugal 5 min of r/min; With the supernatant sucking-off, add 1 mL70% ethanol washing and precipitating, 1.0 * 10
4Centrifugal 5 min of r/min remove supernatant, drying at room temperature; Add 20 μ L sterilized water dissolution precipitations, get an amount of volume electrophoresis detection DNA quality and concentration.The genomic dna that extracts is seen Fig. 1.
(3) bacterial strain 16S rDNA sequential analysis
To bacterial strain 16S rDNA gene clone and sequential analysis; The general upstream primer sequence that is used for cloning bacteria 16S rDNA gene is: AGAGTTTGATCCTGGCTCAG, general downstream primer sequence is: GGTTACCTTGTTA CGACTT.The PCR reaction conditions is: 95 ℃ of preparatory sex change 5 min; 94 ℃ of sex change 30 s; 57 ℃ of annealing 60 s; 72 ℃ are extended 90 s; Repeating step 2 ~ 4 reacts 22 circulations; 72 ℃ are extended 10 min.Bacterial strain 16S rDNA is connected on the T carrier, and screening positive clone send " Shanghai Sangon Biological Engineering Technology And Service Co., Ltd " order-checking.Submit the 16S rDNA sequence that obtains to the NCBI website, obtain accession number.Use blast program in GeneBank, to carry out sequence alignment, analyze the taxonomy status of each bacterium producing multi enzyme preparation, and the evolution of Analysis and Screening bacterial strain and the close bacterial strain of sequence relation.PCR obtains the electrophoresis result of 16S rDNA and sees Fig. 1.
Four, the bacterial strain cellulase activity is measured
(1) glucose standard curve making
Get 6 tool plug scale test tubes of cleaning oven dry, the numbering back adds standard glucose solution by 0,0.2,0.4,0.6,0.8,1.0 mL, and uses zero(ppm) water to be settled to 1mL respectively, is mixed with the glucose solution of a series of different concns.After fully shaking up, in each test tube, add 2 mLDNS solution, shake up back boiling water bath 5 min, take out the cooling back and be settled to 25 mL, fully mixing with zero(ppm) water.Under 540 nm wavelength, as blank, zeroising is measured other and is respectively managed the OD value of solution and write down the result with the solution in No. 0 test tube.With glucose content (mg) is X-coordinate, is that ordinate zou is drawn out the glucose typical curve with the absorbance of correspondence.
(2) preparation of crude enzyme liquid
Seed culture: in test tube, add the LB liquid nutrient medium of about 1/3 volume, insert bacterial classification and be placed on 28 ℃, the shaking table of 120 r/min is cultivated as seed liquor.
Fermentation culture: behind seed culture 12 h, the gained seed liquor is forwarded in the triangular flask that fermention medium is housed by 2% inoculum size, places 37 ℃, cultivate in the shaking table of 120 r/min.
Fermented liquid is centrifugal: fermentation culture is poured out an amount of fermented liquid to required time, centrifugal 10 min of 4000 r/min, and it is subsequent use to get supernatant.
(3) filter paper enzyme activity is measured
Absorbance measurement: get 4 brace plug test tubes by 0 to 3 numbering, No. 0 pipe is as blank.Add 2 mL damping fluids to each test tube, add 1 mL crude enzyme liquid in 1,2, No. 3 test tube, 4 test tube preheatings in 42 ℃ of water-baths simultaneously.Behind 5 min 6 No. 1 filter paper of Xinhua that are cut into 1 cm * 1 cm small pieces are in advance put in vitro 42 ℃ of insulations.Take out behind 10 min, add 2 mLDNS colour developing liquid to each test tube rapidly, and in No. 0 test tube, add 1 mL crude enzyme liquid.Each test tube is fully shaken up back heating 5 min in boiling water bath, cool off with flowing water rapidly after the taking-up.The cooling back is settled to 25 mL with zero(ppm) water, is blank with the solution in No. 0 test tube, under 540 nm wavelength, measures absorbancy.
Enzyme work is calculated:
Will be in 42 ℃ of following unit time of condition (1 min) hydrolysis substrate produce the required crude enzyme liquid amount of 1 μ mol reducing sugar and be defined as the enzyme unit (U/mL) that lives.
The enzyme activity calculation formula is formula as follows:
K in the formula---the slope of expression glucose typical curve;
N---expression extension rate;
1000---expression mg converts μ g to;
180---expression glucose standard molecular weight;
T---the expression reaction times (min);
V---the crude enzyme liquid volume (mL) of reaction is participated in expression.
(4) fermentation condition optimization
Incubation time is to producing the influence of enzyme: fermented liquid is cultivated in the shaking table of 120 r/min at 37 ℃.Every alive at a distance from enzyme of 12h mensuration.Get the highest incubation time of inulinase-producing activity as the righttest incubation time.The result sees Fig. 2.
The initial pH of substratum is to producing the influence of enzyme: setting the initial pH of fermented liquid is 2,4,6,8,10, at 37 ℃, cultivates in the shaking table of 120 r/min.Is 42 ℃ at the righttest incubation time in temperature, and pH measures enzyme to live under 4 the condition.Get the highest initial pH of inulinase-producing activity as the righttest initial pH.
Culture temperature is to producing the influence of enzyme: set the initial pH of fermented liquid and be the righttest initial pH, under 27 ℃, 32 ℃, 37 ℃, 42 ℃, 47 ℃, in the shaking table of 120 r/min, cultivate.Is 42 ℃ at the righttest incubation time in temperature, and pH measures enzyme to live under 4 the condition.Get the highest culture temperature of inulinase-producing activity and be the righttest culture temperature.The result sees Fig. 3.
(5) zymologic property research
The crude enzyme liquid for preparing down with the righttest condition of enzyme production is a raw material.
The influence that reaction pH lives to enzyme: using pH respectively is 2,4,6,8,10 damping fluid, under 42 ℃ of reaction conditionss, measures enzyme work.Getting and recording enzyme the highest pH alive is optimal reaction pH.The result sees Fig. 4.
The influence that temperature of reaction is lived to enzyme: use the damping fluid of pH, under 27 ℃, 32 ℃, 37 ℃, 42 ℃, 47 ℃ reaction conditionss, measure enzyme respectively and live as optimal reaction pH.Get and record enzyme the highest temperature alive for reacting optimum temperuture.The result sees Fig. 5.
Above-mentioned result of experiment shows, cellulase producing bacteria strain P5 excretory cellulase according to the invention has that the adaptive temperature scope is wide, the characteristics of anti-certain acid-basicity.
Sequence table
< 110>Xuzhou Engineering Institute
Preparation and the application of < 120>one strain cellulase producing bacteria strain P5
<160>?1
<210>?1
<211>?1407
<212>?DNA
< 213>pantoea agglomerans (Pantoea ananatis)
<220>
< 223>SEQ ID NO.1:16S rDNA sequence
<400>?1
ctttggcggc?ggtctacaca?tgcaagtcga?acggtagcac?agaagagctt?gctcttcggg?60
tgacgagtgg?cggacgggtg?agtaatgtct?ggggatctgc?ccgatagagg?gggataacca?120
ctggaaacgg?tggctaatac?cgcataacgt?cgcaagacca?aagaggggga?ccttcgggcc?180
tctcactatc?ggatgaaccc?agatgggatt?agctagtagg?tggggtaacg?gctcacctag?240
gcgacgatcc?ctagctggtc?tgagaggatg?accagccaca?ctggaactga?gacacggtcc?300
agactcctac?gggaggcagc?agtggggaat?attgcacaat?gggcgcaagc?ctgatgcagc?360
catgccgcgt?gtatgaagaa?ggccttcggg?ttgtaaagta?ctttcagcgg?ggaggaaggg?420
acggagctta?atacgctctg?tcattgacgt?tacccgcaga?agaagcaccg?gctaactccg?480
tgcagggtgc?aagcgttaat?cggaattact?gggcgtaaag?cgcacgcagg?cggtctgtca?540
agtcggatgt?gaaatccccg?ggctcaaccc?gggaactgca?ttcgaaactg?gcaggctaga?600
gtctcgtaga?ggggggtaga?attccaggtg?tagcggtgaa?atgcgtagag?atctggagga?660
ataccggtgg?cgaaggcggc?cccctggacg?aagactgacg?ctcaggtgcg?aaagcgtggg?720
gagcaaacag?gattagatac?cctggtagtc?cacgccgtaa?acgatgtcga?cttggaggtt?780
gtgcccttga?ggcgtggctt?ccggagctaa?cgcgttaagt?cgaccgcctg?gggagtacgg?840
ccgcaaggtt?aaaactcaaa?tgaattgacg?ggggcccgca?caagcggtgg?agcatgtggt?900
ttaattcgat?gcaacgcgaa?gaaccttacc?tggccttgac?atccacggaa?tttggcagag?960
atgccttagt?gccttcggga?accgtgagac?aggtgctgca?tggctgtcgt?cagctcgtgt?1020
tgtgaaatgt?tgggttaagt?cccgcaacga?gcgcaaccct?tatcctttgt?tgccagcgat?1080
tcggtcggga?actcaaagga?gactgccggt?gataaaccgg?aggaaggtgg?ggatgacgtc?1140
aagtcatcat?ggcccttacg?gccagggcta?cacacgtgct?acaatggcgc?atacaaagag?1200
aagcgacctc?gcgagagcaa?gcggacctca?taaagtgcgt?cgtagtccgg?atcggagtct?1260
gcaactcgac?tccgtgaagt?cggaatcgct?agtaatcgtg?gatcagaatg?ccacggtgaa?1320
tacgttcccg?ggccttgtac?acaccgcccg?tcacaccatg?ggagtgggtt?gcaaaagaag?1380
taggtagctt?aaccttcggg?agggcgc?1407
Claims (4)
1. a strain cellulase producing bacteria strain P5 is characterized in that: said bacterial strain at the preserving number of Chinese common micro-organisms preservation administrative center is: CGMCC NO.5356; The classification called after
Pantoea ananatis, the 16S rDNA sequence such as the SEQ ID NO.1 of bacterial strain are said.
2. the preparation method of a strain cellulase producing bacteria strain P5 as claimed in claim 1 is it is characterized in that:
(1) sample separation near the soil rotted plant material branches and leaves surface reaches, sample adds in the 50 mLLB substratum, in 250 mL Erlenmeyer flasks, cultivates 24 h with 160 rpm rotating speeds in 37 ° of C and coats on the LB solid plate, obtains bacterial strain; Said LB liquid nutrient medium component is: contain peptone 10g in every 1L zero(ppm) water, yeast powder 5g, NaCl 10g; Said LB solid plate component is: contain peptone 10g in every 1L zero(ppm) water, yeast powder 5g, NaCl 10g agar powder 12g;
(2) colony inoculation is arrived cellulase-producing bacterial strain screening substratum, in cultivating incubator, cultivate 2-4 d, the generation bacterium of the plain enzyme of screen fibre, used substratum is: contain Xylo-Mucine 10 g in every 1L substratum, peptone 10g, yeast powder 5 g, KH
2PO
41 g, MgSO
40.2 g, NaCl 10 g, glucose 2 g, agar powder 12 g supply volume to 1L with zero(ppm) water;
(3) with dyeing 5 min in 0. 5% the Congo red cellulase-producing bacterial strain screening substratum of pouring into after the inoculation culture, outwell Congo red after, use 5% NaCl solution soaking decolouring 1h, screening obtains the cellulase-producing bacterial strain.
3. the 16S rDNA sequence preparation method of a strain cellulase producing bacteria strain P5 is according to claim 1: to bacterial strain 16S rDNA gene clone and sequential analysis; The general upstream primer sequence that is used for cloning bacteria 16S rDNA gene is: AGAGTTTGATCCTGGCTCAG, general downstream primer sequence is: GGTTACCTTGTTACGAC TT.
4. the application of cellulase producing bacteria strain P5 according to claim 1 is characterized in that: said cellulase producing bacteria strain P5 is applied to the production of cellulose enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110348074 CN102433271B (en) | 2011-11-07 | 2011-11-07 | Preparation and use of cellulase producing strain P5 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110348074 CN102433271B (en) | 2011-11-07 | 2011-11-07 | Preparation and use of cellulase producing strain P5 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102433271A true CN102433271A (en) | 2012-05-02 |
| CN102433271B CN102433271B (en) | 2013-01-16 |
Family
ID=45981618
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110348074 Expired - Fee Related CN102433271B (en) | 2011-11-07 | 2011-11-07 | Preparation and use of cellulase producing strain P5 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102433271B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102936601A (en) * | 2012-11-22 | 2013-02-20 | 徐州工程学院 | Endoglucanase coding gene, recombinase and application |
| CN104046632A (en) * | 2014-05-28 | 2014-09-17 | 苏州科技学院 | Application of phragmites australis high methionine gene LwHM1 and coding protein thereof |
| CN104164439A (en) * | 2014-05-28 | 2014-11-26 | 苏州科技学院 | Gene coding high methionine protein of barnyard grass, and its application |
| CN108342498A (en) * | 2018-03-13 | 2018-07-31 | 中国农业科学院饲料研究所 | A kind of PCR detection method of the general bacterium of pineapple |
| CN111690539A (en) * | 2020-07-07 | 2020-09-22 | 安徽农业大学 | Screening and application of high-efficiency straw cellulose decomposition bacteria |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555461A (en) * | 2009-04-07 | 2009-10-14 | 福州大学 | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof |
-
2011
- 2011-11-07 CN CN 201110348074 patent/CN102433271B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555461A (en) * | 2009-04-07 | 2009-10-14 | 福州大学 | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof |
Non-Patent Citations (2)
| Title |
|---|
| 侯进慧 等: "一株产低温纤维素酶细菌的初步分析", 《生物学通报》, vol. 45, no. 8, 31 December 2010 (2010-12-31) * |
| 侯进慧，蔡侃，孔文刚: "基于生物信息学方法对一株产纤维素酶细菌的初步分析", 《生物技术》, vol. 21, no. 2, 30 April 2011 (2011-04-30) * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102936601A (en) * | 2012-11-22 | 2013-02-20 | 徐州工程学院 | Endoglucanase coding gene, recombinase and application |
| CN104046632A (en) * | 2014-05-28 | 2014-09-17 | 苏州科技学院 | Application of phragmites australis high methionine gene LwHM1 and coding protein thereof |
| CN104164439A (en) * | 2014-05-28 | 2014-11-26 | 苏州科技学院 | Gene coding high methionine protein of barnyard grass, and its application |
| CN104046632B (en) * | 2014-05-28 | 2016-05-18 | 苏州科技学院 | The application of reed homomethionin gene LwHM1 and encoding proteins thereof |
| CN104164439B (en) * | 2014-05-28 | 2018-04-27 | 苏州科技学院 | A kind of gene for encoding barnyard grass homomethionin albumen and its application |
| CN108342498A (en) * | 2018-03-13 | 2018-07-31 | 中国农业科学院饲料研究所 | A kind of PCR detection method of the general bacterium of pineapple |
| CN111690539A (en) * | 2020-07-07 | 2020-09-22 | 安徽农业大学 | Screening and application of high-efficiency straw cellulose decomposition bacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102433271B (en) | 2013-01-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101555461B (en) | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof | |
| CN102433271B (en) | Preparation and use of cellulase producing strain P5 | |
| CN101654660B (en) | Bacillus subtillis strain containing ramie degumming activity, preparation and application thereof | |
| CN102002467B (en) | Bacillus cereus DA3 strain and preparation method and application thereof | |
| CN104694424B (en) | One plant of Bacillus amyloliquefaciens strain for being isolated from producing protease in fermented soya bean | |
| CN107475172B (en) | Method for obtaining Geobacillus stearothermophilus spores | |
| CN113061555A (en) | Screening and application of bacillus strain for producing cellulase | |
| CN105567592A (en) | Bacillus subtilis capable of simultaneously producing pectase and hemicellulase, screening method and applications thereof | |
| Wang et al. | Isolation of Bacillus cereus P05 and Pseudomonas sp. X12 and their application in the ramie retting | |
| WO2021190585A1 (en) | Quick isolation method for salt-tolerant cellulose decomposing bacteria | |
| CN110317746B (en) | Cellulose degrading bacterium CX10 from termite intestinal tract and application thereof | |
| CN113005054B (en) | Bacillus amyloliquefaciens SS-ZC-26 and preparation method and application thereof | |
| CN101423808A (en) | Resuscitation fluids of VBNC salmonella and preparation method thereof and resuscitation method | |
| CN107475145B (en) | Strain for producing medium-high temperature resistant cellulase and screening method thereof | |
| CN112824524B (en) | Bacterial cellulose producing strain and separation identification and yield analysis thereof | |
| CN101397587B (en) | Method for preparing live bacteria internal standard based on gene substitution technique | |
| Zhang et al. | Cellulose-degrading strains: their screening and application to corn straw in low-temperature environments | |
| CN104388366B (en) | A kind of Acinetobacter bauamnnii and its cultural method and application | |
| CN108048350A (en) | Fit cold cellulase producing bacteria | |
| CN104726385B (en) | Bacterial strain and its application and preparation method with high-cellulose enzymatic activity | |
| CN103266064A (en) | Penicillium oxalicum LJ302 capable of degrading chlortetracycline | |
| CN111705008B (en) | Bacillus firmus CX8 from termite intestinal tract and application thereof | |
| Ibrahim et al. | Screening and identifying of cellulolytic bacteria from Alas Purwo National Park | |
| CN113717876B (en) | Broussonetia papyrifera leaf endophytic bacterium with lignocellulose degradation function | |
| CN103468602A (en) | Bacterial strain H1 capable of producing cellulase and enzyme production culture medium of bacterial strain H1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130116 Termination date: 20131107 |