CN102424828A - Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof - Google Patents
Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof Download PDFInfo
- Publication number
- CN102424828A CN102424828A CN2011103597449A CN201110359744A CN102424828A CN 102424828 A CN102424828 A CN 102424828A CN 2011103597449 A CN2011103597449 A CN 2011103597449A CN 201110359744 A CN201110359744 A CN 201110359744A CN 102424828 A CN102424828 A CN 102424828A
- Authority
- CN
- China
- Prior art keywords
- gene
- xynbt
- xylanase
- recombinant plasmid
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A gene capable of increasing an expression level of aspergillus niger xylanase, a recombinant plasmid and a host cell thereof relate to optimal codon optimization, GC content adjusting and optimization of cis-acting element and sequential-repetitive sequence on a xylanase gene from aspergillus niger. According to design of a site-directed mutagenesis primer, artificial reconstruction on an original aspergillus niger xylanase gene is carried out to obtain an xylanase gene xynBT over-expressed in pichia pastoris. The reconstructed aspergillus niger xylanase gene xynBT has an expression level in pichia pastoris increased by 2.6 times, compared with that of an original gene xynB; during high density fermentation in a 3 L fermentation cylinder, the xylanase gene xynBT has an expression level in pichia pastoris reaching 20424.2 U / mL. The invention can be applied to molecule reconstruction on the xylanase gene and production of a recombinant xylanase, and can substantially increase the expression level of the xylanase.
Description
Technical field
The invention belongs to fields such as molecular biology and genetically engineered, relate in particular to the pichia spp cell behind a kind of improved black mold xylanase gene and recombinant plasmid and the recombinant plasmid.
Background technology
Xylan is one of staple of broad leaved plant and grass cell walls, extensively is present in fruit, cereal and the stalk.The full name of zytase is β-1; 4-endoxylanase or 1; 4-β-xylan wood sugar lytic enzyme (EC 3.2.1.8), its function is inner 1,4 glycosidic link generation xylooligosaccharides of hydrolyzed xylan trunk chain or oligosaccharide (the Curr Opin Biotechnol that has side shoot; 1996,7 (3): 337-342).
Along with development of biology, people recognize zytase gradually in paper industry, biochemical industry, and in the industry such as food and feed boundless application prospect are arranged.In paper-making process, the xylan that is deposited on the fiber is the extractive major obstacle of xylogen, and the application of zytase can improve the extract content of xylogen; Handle the drainability that straw pulp can significantly improve straw pulp with zytase, performances such as fragility improve pulp brightness and intensity, make straw pulp can be used for producing high-quality paper product; Simultaneously, the pre-treatment of zytase can reduce chlorine and the consumption of chlorine-containing compound in the bleaching, thereby alleviates the pollution to environment.The biochemical products xylooligosaccharides is important food or pharmaceutical prod additive, and the preparation method of widespread use at present extracts xylan from corn cob, produces oligose with xylanase hydrolysis again.During food-processing, the xylan of using in the xylanase hydrolysis flour makes water redistribute mutually with gluten mutually at piperylene, can improve quality, structure, mellowness and the quality guaranteed period of flour products widely; The polysaccharose substance that contains in fruit juice and the beer has influenced pure degree, zytase can degrade these polysaccharide make it the clarification.The use of zytase can also improve the nutritive ingredient of farm crop silage, helps (Chinese food journal, 2005,5 (1): 1-8) of digesting and assimilating of animal.
Research for zytase and gene thereof has formed focus.But though existing hundreds of zytase is purified or gene clone, the output of zytase is not high; Even used genetic engineering bacterium, the biotech firm that zytase can be provided at present in the world still seldom.Simultaneously, the zytase of different sources has different character.And the zytase of originated from fungus has the high and molecular weight features of smaller of enzyme activity with respect to the zytase of bacterial origin; Penetrate into lignocellulose raw material more easily; Thereby the raising hydrolysis efficiency (Appl Microbiol Biotechnol, 2005,64:1412-1419).
Black mold is the production bacterial strain of zytase.But through the optimization of nutritional condition and culture condition, the Xylanase activity of black mold still can not satisfy the needs in the industry, and cost is higher.Research shows, to the gene of zytase clone, transformation and the recombinant expressed most effectual way that is considered to fundamentally to significantly improve Xylanase activity.Research shows, the difference of exogenous protein expression is the influence that receives expression condition on the one hand, on the other hand, and by the characteristic decision of foreign gene itself.From existing domestic and international present Research, the optimization of exogenous gene expression is concentrated on Optimizing Conditions of Fermentation basically.Mainly comprise: (1) saccharomycetic stand density, culture temperature and pH; (2) concentration of methanol induction and induction time.Through the optimization of these culture condition, improved the expression of exogenous object protein amount.But in fact, significantly improve the expression of exogenous object protein amount, its upper reaches technology is most important.Its technology mainly comprises: the optimization of (1) gene internal structure.Can foreign gene express or express the influence that height at first receives the foreign gene internal structure in pichia pastoris phaff, also be to express successful prerequisite and primary factor.Wherein, When foreign gene was expressed in the host, same seed amino acid can have 1～6 codon, but different hosts is different to the same amino acid whose codon usage frequency of encoding; Some codon usage frequency is very high; Some uses hardly, and the gene that efficiently expresses tends to the synonym of using part specific, and these codons are the superior codon that replants the biological high-efficiency expressing gene.The preferences of Here it is codon.At present, all there is the scholar that the usage of pichia spp partial password is analyzed both at home and abroad.With Arg is example, and it is obviously different that the 6 kinds of codons of encoding efficiently express gene, poor efficiency expressing gene frequency of utilization at yeast, and codon CGA and CGG frequency of utilization are 0, and codon CGC uses hardly, and the AGA frequency of utilization is the highest.Research shows, in yeast, expresses the codon that higher gene adopts yeast itself to be had a preference for often; Those foreign genes that are rich in the pichia spp rare codon are difficult to efficiently expressed in pichia spp.Do not changing under the prerequisite that amino acid forms, with encoding exogenous proteic codon optimized be the zymic preference codon, can realize foreign protein significantly improving at yeast expression in vivo or expression amount.Up to the present, the black mold xylanase gene being carried out directional transformation is implemented in overexpression in the pichia spp and does not also see the research report at home and abroad.
Summary of the invention
The technical problem that solves: the objective of the invention is to increase substantially black mold xylanase gene expression level, obtain the black mold xylanase gene xynBT of overexpression in pichia spp, and efficiently express.Therefore pichia spp cell behind a kind of improved xylan gene and recombinant plasmid and the recombinant plasmid is provided.
Technical scheme:
Improve the gene of black mold zytase expression amount, nucleotide sequence xynBT such as SEQ ID NO.1 are said.
The recombinant plasmid that comprises above-mentioned SEQ ID NO.1 nucleotide sequence.
Recombinant plasmid pPICZ alpha-the xynBT that comprises above-mentioned SEQ ID NO.1 nucleotide sequence.
Comprise the recombinant plasmid preparation method of the said black mold xylanase gene of SEQ ID NO.1, step is:
(1) xynBT's is synthetic: design one group of 28 oligonucleotide, said 28 oligonucleotide sequences such as SEQ ID NO.2～SEQ ID NO.29 are said; The acquisition of the xylanase gene xynBT of black mold: take the two-step pcr amplification technique, the first step, reaction system 50 μ L, wherein whole 28 Oligonucleolide primers 100nM of 5 μ L; 4 μ L dNTP Mixture (comprising dATP, dGTP, dCTP and dTTP): each 2.5mM, 5 μ L, 10 * PCR Buffer, 2.5U Ex Taq adds water and supplies 50 μ L; Reaction conditions is: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 59 ℃ of annealing 30s; 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min; Second step, pcr amplification gene xynBT, reaction system 50 μ L: comprise the reaction product 2 μ L of the first step, primer SEQ ID NO.2:10 μ M 1 μ L; Primer SEQ ID NO.29:10 μ M 1 μ L, 4 μ L dNTP Mixture: each 2.5mM, 5 * PCR Buffer, 10 μ L, 2.5U Ex Taq; Add water and supply 50 μ L, reaction conditions is: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 59 ℃ of annealing 30s; 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min;
(2) structure of recombinant plasmid pPICZ alpha-xynBT: the improved gene xynBT that will obtain and pPICZ α-A carry out the substep enzyme with restriction endonuclease EcoR I, Sac II respectively and cut, and rubber tapping is reclaimed respectively, concentrate back 16 ℃ of reactions and spend the night; The host bacterium is used the competent cell of Top10F ', is coated on the LLB flat board, and the LLB flat board contains 25 μ g/mL Zeocin; The inversion flat board spends the night; Select single bacterium colony in 5mL liquid LLB, contain 25 μ g/mL Zeocin among the LLB, 37 ℃; 200rpm cultivates 8h, obtains recombinant plasmid pPICZ alpha-xynBT.
The pichia spp host cell that contains above-mentioned recombinant plasmid.
Concrete scheme content is:
Comprise original gene clone, gene analysis and directional transformation and efficiently express.
1. the gene order (accession number is AF490982) with reference to the black mold zytase of having delivered on the Genebank designs primer; DNA with the black mold that extracts is that template is carried out PCR; Obtain the gene complete sequence; Obtain goal gene through removing intron, and the pMD19-T carrier is arrived in gene clone, obtaining recombinant plasmid pMD19-T-xynB (specifically seeing embodiment 1).
2. according to following principle black mold xylanase gene xynB sequence is carried out directional transformation: 1) select the higher codon of frequency of utilization in pichia spp for use; 2) because the pichia spp degree of glycosylation is lower, the glycosylation site in the xynB gene remains unchanged; 3) for reducing the minimum free energy (MFE) of mRNA secondary structure, in base layout process, removed and be rich in the GC district and be rich in the AT zone; 4) make GC content near pichia spp self actual content; 5) improve translation termination efficient.Assisting down of DNAWorks software, be benchmark with pichia spp codon usage frequency table, be main purpose to improve this gene codon frequency of utilization, the codon of employing height or moderate frequency of utilization is optimized the codon of xynB.And be used for new gene synthetic oligonucleotide and think through designing one group 28; The utilization dna synthesizer obtains this group Oligonucleolide primers through chemosynthesis; This group Oligonucleolide primers is adjacent on same chain; And with its complementary chain some bases are arranged are eclipsed, and the melting temperature(Tm) of overlapping region is controlled at about 55 ℃.Obtain brand-new black mold xylanase gene xynBT with two-step pcr, and finally obtain the recombinant plasmid pPICZ alpha-xynBT (specifically seeing embodiment 2) of overexpression in pichia yeast.
3. efficiently expressing of black mold zytase:
3.1 utilize BMGY and BMMY the reorganization pichia yeast to be produced enzymic fermentation in 250mL triangular flask shaking culture.Positive transformant is inoculated into activation on the YPD flat board, cultivates 2d for 28 ℃, the order bacterium colony is in 10mL BMGY liquid nutrient medium; 30 ℃, the 200rpm shaking table is cultivated 48h, in the time of between OD600 reaches 2～6; Centrifugal, abandon supernatant, wash thalline 1～2 time with aseptic ultrapure water.To use BMMY inducing culture dilution thalline to OD600=1, and replace tampon with 4 layers of gauze, in 30 ℃, the 250rpm shaking table is cultivated.Timing sampling 1mL bacterium liquid is added 1mL BMMY, 0.5% (V/V) methyl alcohol simultaneously, and through behind 13 days abduction deliverings, the activity of recombined xylanase reaches 1408U/mL.
3.2 utilize the industrial foundation salt culture medium that the reorganization pichia yeast is produced enzymic fermentation; Fermentation condition is: the initial pH that ferments is 6.0; And adding 4.35mL PTM1/L (fermented liquid) respectively, the Histidine of concentration 3%wt and 18mL vitamin H storing solution (vitamin H mass concentration 0.02%wt) are in fermented liquid.After treating the glycerine approach exhaustion in the substratum; The glycerine stage is added in entering; Flow velocity with 0.6mL glycerine/min/L (fermented liquid) flows the glycerine that adds concentration 50%wt in substratum; Add the Histidine of 12mLPTM1/L (concentration 50%wt glycerine) and concentration 3%wt simultaneously, reach 240g/L until the thalline weight in wet base.Stop to add glycerine, treat that glycerine runs out after, keep starvation 2h, get into the methanol induction stage.PH is adjusted into 5.0, at first joins in the fermentor tank and induce, add the Histidine of 12mLPTM1/L (methyl alcohol) and 3% simultaneously, keep this stage 2-4h with the speed of 3.6mL methyl alcohol/h/L (fermented liquid).The methyl alcohol flow velocity is increased to 7.2mL methyl alcohol/h/L (fermented liquid), and keeps 2h.The methyl alcohol flow velocity is increased to 10.9mL methyl alcohol/h/L (fermented liquid), and along with the prolongation of fermentation time, the recombined xylanase expression amount raises gradually, and protein content also raises gradually, and to inducing 72h, Xylanase activity reaches the climax.Expressing quantity reaches 584.4g/L, and the maximum enzyme vigor reaches 20424.2IU/mL (specifically seeing embodiment 3).
Beneficial effect of the present invention: through design rite-directed mutagenesis primer, primary black mold xylanase gene is carried out artificial reconstructed, the xylanase gene xynBT that obtains at the pichia spp overexpression.The expression amount of improved black mold xylanase gene xynBT in pichia yeast improved 2.6 times than original gene xynB, and when 3L fermentor tank middle-high density fermented, the expression level of xylanase gene xynBT in pichia spp reached 20424.2U/mL.
Description of drawings
Fig. 1 recombinant plasmid pPICZ alpha-xynBT;
Fig. 2 is the high density fermentation result of 3L fermentor tank, ▲ expression protein concentration, and ■ representes the activity of zytase;
Fig. 3 is the protein electrophoresis figure of expression of recombinant yeast zytase.
Embodiment
Embodiment 1: the clone of black mold xylanase gene and expression
1.1 the extraction of black mold genomic dna (fine works molecular biology experiment guide (the 4th edition) Beijing: Science Press, 2005)
(1) the activatory Aspergillus niger strain is inoculated on the liquid nutrient medium, 28-30 ℃, 150rpm cultivated 2 days.
(2) filter to collect mycelium, clean fully with sterilized water washing 3-4 time to substratum, drain that to put into liquid nitrogen after afterwards wrapping with tinfoil freezing.
(3) get the mortar that the 2g mycelium is put into precooling, add an amount of liquid nitrogen grinding and grind to form powdery until the black-koji mould filament.
(4) the mycelia powder is placed some EP pipes, adding is preheating to 65 ℃ CTAB extract (adding accounts for the mercaptoethanol of extract 2%wt).Concussion makes it abundant mixing, bathes 45-60min, mixing frequently in 65 ℃ of temperature.
(5) in EP pipe, add isopyknic mixed solution (phenol: chloroform: primary isoamyl alcohol volume ratio 25: 24: 1), mixing, the centrifugal 20-30min of 12000rpm.
(6) draw upper strata water in the EP pipe, repeat extracting with phenol/chloroform/primary isoamyl alcohol mixed solution.
(7) in extract, add the ice-cold 5M LiCl of 0.5 times of extract volume and the Virahol of 0.6 times of extract volume simultaneously, mixing, room temperature leaves standstill 20min, and the centrifugal 10min of 12000rpm abandons supernatant.
(8) in centrifugation, add 1mL 70%vt ethanol, the deposition that thoroughly suspends leaves standstill 10min, and the centrifugal 10min of 12000rpm abandons supernatant.Repeat once, air-dry, reclaim deposition.
(9) deposition heavily is dissolved in the TE damping fluid of RNAase that 50 μ L contain 50 μ g/mL, 37 ℃ of incubation 1h.
(10) upwards add the 3M sodium acetate (pH 5.2) of 0.1 times of volume and the absolute ethyl alcohol of 3 times of volumes in the step system ,-20 ℃ of insulation 1h behind the mixing.
(11) 12000rpm, 4 ℃, 30min is centrifugal, carefully outwells clear liquid.
(12) add 500 μ L70%vt ethanol again, room temperature leaves standstill 10min, and 4 ℃, the centrifugal 30min of 12000rpm.
(13) abandon clean supernatant, air-dry on Bechtop.
(14) adding 50 μ L TE damping fluids are resuspended ,-20 ℃ of preservations.
1.2 design of primers
Go up the black mold xylanase gene of announcing with reference to NCBI, carry out homology analysis, according to upstream and downstream 2 Auele Specific Primer XynB prime-f1 and the XynB prime-r1 of conserved sequence design black mold xylanase gene xynB; The xynB gene is carried out sequential analysis, adopt Overlapping Extension PCR method, synthetic a pair of part complementary strides across the primer XynB prime-f2 and the XynB prime-r2 of xynB intron, like table 1:
Table 1PCR amplification xynB gene primer and removal intron primer
| Primers | DNA?Sequence(5′-3′) |
| XynB?prime-f1 | ATGCTCACCAAGAACCTTCTC |
| XynB?prime-r1 | TTACTGAACAGTGATGGACG |
| XynB?prime-f2 | TAATGTCCTGCGCACTTCCAGGG |
| XynB?prime-r2 | AGTGCGCAGGACATTACCTACAG |
| XynB?prime-f3 | CCC TCTAGATTACTGAACAGTGATGGAGGA |
| XynB?prime-m | CCC GAATTCGTTCCCCACGACTCTGTC |
1.3 the clone of xylanase gene xynB
The synthetic primer is diluted to the 10mM working fluid with the TE damping fluid.For the ease of follow-up TA clone, and taking into account fidelity, use the EX Taq polysaccharase of TaKaRa company to carry out pcr amplification, is template with the DNA of black mold, carries out PCR with primer XynB prime-f1 and XynB prime-r1, and amplification condition is for being 94 ℃, 5min; Time out adds EX Taq polysaccharase, adds the sealing of 40 μ L Yellow Protopet 2As; 35 circulations (94 ℃, 30s; 53 ℃, 30s; 72 ℃, 1min); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations.
1.4xynB the removal of intron
For obtaining xylanase gene xynB cDNA sequence, utilize PCR method to obtain two end portions complementary xynB sequence fragment P1 and P2, PCR reaction system and condition are: the gene 100ng that 1.3 amplifications obtain; XynB prime-f1/r2 (10 μ M) 2 μ L, XynB prime-f2/r1 (10 μ M) 2 μ L, dNTP Mixture (each 2.5mM) 4 μ L; 10 * PCR Buffer, 5 μ L, EX Taq2.5U adds water to 50 μ L; Reaction conditions: 94 ℃, 5min; Time out adds EX Taq polysaccharase, adds the sealing of 40 μ L Yellow Protopet 2As; 35 circulations (94 ℃, 30s; 53 ℃, 30s; 72 ℃, 30s); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations.
Utilize the two ends complementary xynB Gene Partial sequence P1 and the P2 that obtain, obtain complete xynB cDNA complete sequence, each 100ng of reaction system and condition: P1 and P2 through PCR method; XynB prime-f1/r2 (10 μ M) 2 μ L, XynB prime-f2/r1 (10 μ M) 2 μ L, dNTP Mixture (each 2.5mM) 4 μ L; 10 * PCR Buffer, 5 μ L, EX Taq 2.5U adds water to 50 μ L; Reaction conditions: 94 ℃, 5min; Time out adds EX Taq polysaccharase, adds the sealing of 40 μ L Yellow Protopet 2As; 35 circulations (94 ℃, 30s; 53 ℃, 30s; 72 ℃, 1min); 72 ℃, 10min; Reaction stops, 4 ℃ of insulations.After obtaining gene fragment, carry out the TA clone, obtain recombinant plasmid pMD19-T-xynB.
1.5 the structure of recombinant plasmid pPICZ alpha-xynB and expression
With the above-mentioned pMD19-T-xynB plasmid that builds is that template is carried out pcr amplification, uses the Prime STAR HS archaeal dna polymerase of TaKaRa company, reaction system 50 μ L.Comprise pMD19-T-xynB 0.5 μ L, XynB prime-f3 (10 μ M) 2 μ L, XynB prime-m (10 μ M) 2 μ L, dNTP Mixture (each 2.5mM) 4 μ L, 5 * PCR Buffer, 10 μ L, Prime STAR HS 0.5 μ L adds ddH
2O to 50 μ L.
Reaction conditions: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 53 ℃ of annealing 30s, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min, get 5 μ L reaction product electrophoresis detection.
The goal gene that obtains is carried out substep enzyme with restriction endonuclease EcoR I, Xba I respectively with pPICZ α-A cut, and the recovery of tapping rubber respectively, concentrated back 16 ℃ of connections are spent the night.The host bacterium is used the competent cell of Top10F ', is coated on LLB flat board (containing 25 μ g/mL Zeocin), is inverted flat board and spends the night, and selects single bacterium colony in 5mL liquid LLB (containing 25 μ g/mL Zeocin), and 37 ℃, 200rpm cultivates 8h.Extract recombinant plasmid and carry out sequence verification, obtain containing recombinant plasmid pPICZ alpha-xynB of original gene xynB.Use BstX I that recombinant plasmid pPICZ α-xynB is carried out single endonuclease digestion.After electrophoresis detection, enzyme cut entirely, purifying enzyme was cut product, the DNA after concentrating with 10 μ L ddH2O are resuspended.
Get 80 μ L competence pichia spp cells and mix, change in the 0.2cm electricity revolving cup of precooling with the linearizing recombinant plasmid pPICZ alpha-xynB of 10 μ L.Ice bath 5min.The pichia spp parameter of recommending according to institute's using appts shocks by electricity.After electric shock finishes, add the 1M sorbyl alcohol of 1mL precooling immediately, content is transferred in the sterilization centrifuge tube.After 1～2h was left standstill in 30 ℃ of water-baths, the cell after 200 μ L are transformed was coated on and contains on the 500 μ g/mL Zeocin YPDS flat boards, is inverted for 30 ℃ and cultivates 2～4d.
Picking list bacterium colony is put transformant in order on MMH and MDH flat board.With GS115/HIS+Muts Ablumin and GS115/HIS+Mut+ β-gal is control strain.Cultivated 2 days for 30 ℃.Growth on the MDH normal and on MMH the poor growth or the positive transformant of transformant of not growing.The picking positive transformant.
Positive transformant is inoculated into activation on the YPD flat board, cultivates 2d for 28 ℃, the order bacterium colony is in 10mL BMGY liquid nutrient medium; 30 ℃, the 200rpm shaking table is cultivated 48h, in the time of between OD600 reaches 2～6; Centrifugal, abandon supernatant, wash thalline 1～2 time with aseptic ultrapure water.To use BMMY inducing culture dilution thalline to OD600=1, and replace tampon with 4 layers of gauze, in 30 ℃, the 250rpm shaking table is cultivated.Timing sampling 1mL bacterium liquid is added 1mL BMMY, 0.5% (V/V) methyl alcohol simultaneously, and through behind 13 days abduction deliverings, the activity of recombined xylanase reaches 526U/mL.
Embodiment 2: black mold xylanase gene xynB sequence is carried out directional transformation
Through the codon sequence of optimized gene, the antisense codon that can adapt to isoacceptor and the host of tRNA waves the abundance of the adorned Nucleotide in position, the formation of the secondary structure that also helps simultaneously translating.In yeast, express the codon that higher gene adopts yeast itself to be had a preference for often, research also is illustrated in all 61 codons has 25 to be that yeast is had a preference for.If contain more Pichia anomala expression rare codon in the foreign gene, then meeting produces ink-bottle effect and influences expression in translation process.Black mold and pichia spp use the existence of preference property to distinguish significantly at codon, and the frequency of utilization of most codons in pichia spp among the black mold xylanase gene xynB is on the low side.Black mold xylanase gene xynB sequence is compared and be optimized according to dna sequence dna on-line analysis (http://www.kazusa.or.jp/codon); On the basis that does not change its amino acid sequence coded; Change the codon that the pichia spp utilization ratio is lower in the xynB gene into codon that pichia spp is had a preference for, avoid the successive rare codon to appear in the gene order.
The generation of the secondary structure remarkably influenced protein translation in translation initiation district (TIR).TIR is the cis sequence of translation initiation.When the secondary structure that reduces TIR stable, help improving translation initiation efficient, improve the stability of mRNA, thereby improve expression of exogenous gene.MRNA 3 ' end coding region also plays crucial effect in gene expression regulation.It can regulate and control mRNA stability and degradation rate in vivo, controls its utilising efficiency, the remarkably influenced expression of exogenous gene.Therefore, under the assistance of RNAfold software, the black mold xylanase gene xynB after the optimization avoids the G+C district occurring being rich in and being rich in the A+T district in base layout process, to reduce the minimum free energy of RNA secondary structure, to stablize the structure of RNA.
The gene of many high A+T content can not effectively be transcribed owing to before ripe, stop.Specific A+T is rich in the district and can be used as polyadenylic acid or transcription termination signal, causes only producing the mRNA of low-level or brachymemma.And foreign gene G+C content more helps expression of gene during near the actual total G+C content of pichia spp self.G+C content is higher among the black mold xylanase gene xynB, is higher than the content in the pichia spp gene far away.Therefore, we consider simultaneously to reduce G+C content, and avoid A+T to be rich in the district when revising the pichia spp preference codon.
Preference codon according to pichia yeast is optimized the black mold xylanase gene, and avoids G+C to be rich in the district being rich in the district with A+T, reducing mRNA secondary structure minimum free energy, the transformation period of prolongation mRNA.Rrna combines and the structure of mRNA stability is optimized to influencing simultaneously, and for avoiding xylanase gene in translation process, premature termination reduces the zone of being rich in AT through increasing GC.Compare with original series, 155 bases are changed, and G+C content has original 57.7% to be reduced to 43.6%, and this is more near the contained G+C content of pichia spp self.And be the basis with the xylanase gene xynB sequence that derives from black mold; Use DNAMAN software (Nucleic Acids Res., 2002,30 (10): e43); Designed one group of 28 oligonucleotide, the utilization dna synthesizer obtains this group oligonucleotide through chemosynthesis
The two-step pcr amplification technique is taked in the acquisition of artificial evolution's xylanase gene xynBT.Step is: xynBT's is synthetic: design one group of 28 oligonucleotide, said 28 oligonucleotide sequences such as SEQ ID NO.2～SEQ ID NO.29 are said; The two-step pcr amplification technique is taked in the acquisition of the xylanase gene xynBT of black mold; The first step, whole 28 Oligonucleolide primers 100nM of reaction system 50 μ L:5 μ L, 4 μ L dNTP Mixture, each 2.5mM; 5 μ L, 10 * PCR Buffer, 2.5U Ex Taq adds water and supplies 50 μ L; Reaction conditions is: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 59o ℃ of annealing 30s; 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min; Second step, pcr amplification gene xynBT, reaction system 50 μ L: comprise upper mattress thing 2 μ L, primer SEQ ID NO.2,10 μ M, 1 μ L; Primer SEQ ID NO.29,10 μ M1 μ L, dNTP Mixture, each 2.5mM, 4 μ L; 5 * PCR Buffer, 10 μ L, 2.5U Ex Taq adds water and supplies 50 μ L, and reaction conditions is: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s; 59 ℃ of annealing 30s, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min.
Embodiment 3: the structure of recombinant plasmid pPICZ alpha-xynBT and the preparation of recombined xylanase
3.1 the structure of recombinant plasmid pPICZ alpha-xynBT and the linearization for enzyme restriction of expression vector
The improved gene xynBT that obtains and pPICZ α-A are carried out substep enzyme with restriction endonuclease EcoR I, Xba I respectively cut, and the recovery of tapping rubber respectively, concentrated back 16 ℃ of connections are spent the night.The host bacterium is used the competent cell of Top10F ', is coated on LLB flat board (containing 25 μ g/mL Zeocin), is inverted flat board and spends the night, and selects single bacterium colony in 5mL liquid LLB (containing 25 μ g/mL Zeocin), and 37 ℃, 200rpm cultivates 8h.Extract recombinant plasmid and carry out sequence verification, obtain containing recombinant plasmid pPICZ alpha-xynBT (figure-1) of the gene xynBT after the optimization.The correct positive transformant of evaluation is cultivated in a large number, adopted the method for big upgrading grain to extract recombinant plasmid pPICZ alpha-xynBT.Use BstX I recombinant plasmid pPICZ alpha-xynBT to carry out single endonuclease digestion.Electrophoresis detection.After enzyme cut entirely, purified pcr product was with 10 μ L ddH
2The DNA that O is resuspended after concentrating.
3.2 the electric shock of pichia spp transforms
After Pichi strain GSl15 activation, be inoculated in the 500mL YPD substratum, 30 ℃ are cultured to OD600 is 1.3～1.5.4 ℃, centrifugal 5min under the 1500rpm condition, collecting cell is used the aqua sterilisa washed cell of 500mL, 250mL precooling respectively.4 ℃, centrifugal under the 1500rpm condition, with the suspension of 1M sorbyl alcohol, the washed cell of 20mL precooling.Use the 1M sorbyl alcohol suspension cell of 1mL precooling at last, to the about 1.5mL of final volume.Get the above-mentioned cell of 80 μ L and mix, change in the 0.2cm electricity revolving cup of precooling with the linearizing recombinant plasmid pPICZ alpha-xynBT of 10 μ L.Ice bath 5min.The pichia spp parameter of recommending according to institute's using appts shocks by electricity.After electric shock finishes, add the 1M sorbyl alcohol of 1mL precooling immediately, content is transferred in the sterilization centrifuge tube.After 1～2h was left standstill in 30 ℃ of water-baths, the cell after 200 μ L are transformed was coated on and contains on the 500 μ g/mL Zeocin YPDS flat boards, is inverted for 30 ℃ and cultivates 2～4d.
3.3 the screening of recombinant yeast pichia pastoris and evaluation
Picking list bacterium colony is put transformant in order on MMH and MDH flat board.With GS115/HIS
+Mut
sAblumin and GS115/HIS
+Mut
+β-gal is a control strain.Cultivated 2 days for 30 ℃.Growth on the MDH normal and on MMH the poor growth or the positive transformant of transformant of not growing.The picking positive transformant.
3.4 the abduction delivering of recombinant yeast pichia pastoris engineering strain
Positive transformant is inoculated into activation on the YPD flat board, cultivates 2d for 28 ℃, the order bacterium colony is in 10mL BMGY liquid nutrient medium; 30 ℃, the 200rpm shaking table is cultivated 48h, in the time of between OD600 reaches 2～6; Centrifugal, abandon supernatant, wash thalline 1～2 time with aseptic ultrapure water.To use BMMY inducing culture dilution thalline to OD600=1, and replace tampon with 4 layers of gauze, in 30 ℃, the 250rpm shaking table is cultivated.Timing sampling 1mL bacterium liquid is added 1mL BMMY, 0.5% (V/V) methyl alcohol simultaneously.Sample is centrifugal 5min under 12000rpm, gets supernatant and is stored in 4 ℃ and is used to detect enzyme and lives.Through behind 13 days abduction deliverings, the activity of recombined xylanase reaches 1408IU/mL, is more than 2.6 times of mutator gene expression amount not.
3.5 the high density fermentation of recombinant yeast pichia pastoris
Fermention medium (FM21): (85%) H
3PO
426.7mL, CaSO
42H
2O 0.93g, K
2SO
418.2g, MgSO
47H
2O 14.9g, KOH 4.13g, Glycerol 50mL, 100mM K
2PO
4-KH
2PO
4Damping fluid 100mL adds ultrapure water to 1L.
PTM1 trace element: CuSO
45H
2O 6.0g, NaI 0.08g, MnSO
4H
2O 3.0g, NaMoO
42H
2O0.2g, H
3BO
30.02g, CoCl
20.5g, ZnCl
220.0g, FeSO
47H
2O 65.0g, H
2SO
45.0mL, add ultrapure water to 1L, with the membrane filtration degerming of 0.22 μ m.
Utilize the industrial foundation salt culture medium in the 3L fermentor tank, the recombinant bacterial strain after optimizing to be carried out the high density fermentation of zytase.The recombined xylanase genetic engineering bacterium is lined on the YPD culture medium flat plate, and activation in the 28-30 ℃ of thermostat container is until growing single bacterium colony.Single colony inoculation that outward appearance is good is in the 10mLBMGY substratum, and 28 ℃, 180rpm cultivates 24h.Primary seed solution is inoculated in the BMGY substratum of 300mL by 1% inoculum size, and 28 ℃, 180rpm cultivates 24h.Inoculum size by 10% is fermented the industrial foundation salt culture medium that secondary seed is inoculated in 3L.Before the fermentation, the industrial foundation salt culture medium is regulated pH to 6.0 with ammoniacal liquor, and add 4.35mL PTM1/L (fermented liquid) respectively, the Histidine of concentration 3%wt and 18mL vitamin H storing solution (biotin concentration 0.02%wt) are in fermented liquid.After treating the glycerine approach exhaustion in the substratum; The glycerine stage is added in entering; Flow velocity with 0.6mL glycerine/min/L (fermented liquid) flows the glycerine that adds concentration 50%wt in substratum; Add the Histidine of 12mL PTM1/L (concentration 50%wt glycerine) and concentration 3%wt simultaneously, reach 240g/L until the thalline weight in wet base.Stop to add glycerine, treat that glycerine runs out after, keep starvation 2h, get into the methanol induction stage.PH is adjusted into 5.0, at first joins in the fermentor tank and induce, add the Histidine of 12mLPTM1/L (methyl alcohol) and concentration 3%wt simultaneously, keep this stage 2-4h with the speed of 3.6mL methyl alcohol/h/L (fermented liquid).The methyl alcohol flow velocity is increased to 7.2mL methyl alcohol/h/L (fermented liquid), and keeps 2h.The methyl alcohol flow velocity is increased to 10.9mL methyl alcohol/h/L (fermented liquid), until fermentation ends.Whole fermentation stage, DO is controlled at more than 20%.Every 12h collects sample detection yeast thalline weight in wet base and OD600, induces the every 12h in beginning back to measure recombined xylanase activity and protein content, and carries out SDS-PAGE and analyze.Expressing quantity reaches 584.4g/L, and the maximum enzyme vigor reaches 20424.2U/mL.
Sequence table
< 110>Nanjing Forestry University
< 120>gene and the recombinant plasmid and the host cell of raising black mold zytase expression amount
<130>
<160> 35
<170> PatentIn?version?3.3
<210> 1
<211> 624
<212> DNA
< 213>artificial sequence
<400> 1
gttcctcacg?actccgttgt?tgaaagatca?gatgctttgc?ataagctttc?agaaagaagt 60
acaccatctt?ccaccggaga?gaacaatggt?ttttactata?gtttctggac?tgatggtgga 120
ggtgacgtta?catacaccaa?cggagatgct?ggttcatata?cagtcgaatg?gagtaacgtt 180
ggtaattttg?tcggaggtaa?aggatggaac?ccaggttccg?cccaagacat?tacttactct 240
ggaactttca?caccttccgg?aaatggttac?ttgtcagttt?atggttggac?tacagatcca 300
cttatcgaat?actacatcgt?tgagagttac?ggagactata?atcctggttc?tggaggtact 360
tacaagggaa?ccgttacttc?tgatggttcc?gtctacgaca?tctacacagc?caccagaact 420
aacgctgcct?ccatccaggg?tacagcaacc?tttactcaat?attggtcagt?tagacagaat 480
aagagagttg?gaggtactgt?caccacttct?aaccatttca?atgcatgggc?taaattggga 540
atgaaccttg?gtactcacaa?ttatcaaatc?gtcgcaacag?agggttacca?aagttcagga 600
agtagttcta?ttactgttca?atag 624
<210> 2
<211> 31
<212> DNA
< 213>artificial sequence
<400> 2
cccgaattcg?ttcctcacga?ctccgttgtt?g 31
<210> 3
<211> 39
<212> DNA
< 213>artificial sequence
<400> 3
cttatgcaaa?gcatctgatc?tttcaacaac?ggagtcgtg 39
<210> 4
<211> 42
<212> DNA
< 213>artificial sequence
<400> 4
aaagatcaga?tgctttgcat?aagctttcag?aaagaagtac?ac 42
<210> 5
<211> 46
<212> DNA
< 213>artificial sequence
<400> 5
tgttctctcc?ggtggaagat?ggtgtacttc?tttctgaaag?cttatg 46
<210> 6
<211> 47
<212> DNA
< 213>artificial sequence
<400> 6
catcttccac?cggagagaac?aatggttttt?actatagttt?ctggact 47
<210> 7
<211> 47
<212> DNA
< 213>artificial sequence
<400> 7
tgtaacgtca?cctccaccat?cagtccagaa?actatagtaa?aaaccat 47
<210> 8
<211> 40
<212> DNA
< 213>artificial sequence
<400> 8
gatggtggag?gtgacgttac?atacaccaac?ggagatgctg 40
<210> 9
<211> 42
<212> DNA
< 213>artificial sequence
<400> 9
actccattcg?actgtatatg?aaccagcatc?tccgttggtg?ta 42
<210> 10
<211> 45
<212> DNA
< 213>artificial sequence
<400> 10
gttcatatac?agtcgaatgg?agtaacgttg?gtaattttgt?cggag 45
<210> 11
<211> 44
<212> DNA
< 213>artificial sequence
<400> 11
gaacctgggt?tccatccttt?acctccgaca?aaattaccaa?cgtt 44
<210> 12
<211> 44
<212> DNA
< 213>artificial sequence
<400> 12
gtaaaggatg?gaacccaggt?tccgcccaag?acattactta?ctct 44
<210> 13
<211> 42
<212> DNA
< 213>artificial sequence
<400> 13
ccggaaggtg?tgaaagttcc?agagtaagta?atgtcttggg?cg 42
<210> 14
<211> 45
<212> DNA
< 213>artificial sequence
<400> 14
ggaactttca?caccttccgg?aaatggttac?ttgtcagttt?atggt 45
<210> 15
<211> 47
<212> DNA
< 213>artificial sequence
<400> 15
cgataagtgg?atctgtagtc?caaccataaa?ctgacaagta?accattt 47
<210> 16
<211> 46
<212> DNA
< 213>artificial sequence
<400> 16
tggactacag?atccacttat?cgaatactac?atcgttgaga?gttacg 46
<210> 17
<211> 47
<212> DNA
< 213>artificial sequence
<400> 17
tccagaacca?ggattatagt?ctccgtaact?ctcaacgatg?tagtatt 47
<210> 18
<211> 45
<212> DNA
< 213>artificial sequence
<400> 18
gagactataa?tcctggttct?ggaggtactt?acaagggaac?cgtta 45
<210> 19
<211> 44
<212> DNA
< 213>artificial sequence
<400> 19
tcgtagacgg?aaccatcaga?agtaacggtt?cccttgtaag?tacc 44
<210> 20
<211> 43
<212> DNA
< 213>artificial sequence
<400> 20
cttctgatgg?ttccgtctac?gacatctaca?cagccaccag?aac 43
<210> 21
<211> 40
<212> DNA
< 213>artificial sequence
<400> 21
ctggatggag?gcagcgttag?ttctggtggc?tgtgtagatg 40
<210> 22
<211> 41
<212> DNA
< 213>artificial sequence
<400> 22
taacgctgcc?tccatccagg?gtacagcaac?ctttactcaa?t 41
<210> 23
<211> 47
<212> DNA
< 213>artificial sequence
<400> 23
ctcttattct?gtctaactga?ccaatattga?gtaaaggttg?ctgtacc 47
<210> 24
<211> 46
<212> DNA
< 213>artificial sequence
<400> 24
attggtcagt?tagacagaat?aagagagttg?gaggtactgt?caccac 46
<210> 25
<211> 44
<212> DNA
< 213>artificial sequence
<400> 25
cccatgcatt?gaaatggtta?gaagtggtga?cagtacctcc?aact 44
<210> 26
<211> 46
<212> DNA
< 213>artificial sequence
<400> 26
ttctaaccat?ttcaatgcat?gggctaaatt?gggaatgaac?cttggt 46
<210> 27
<211> 46
<212> DNA
< 213>artificial sequence
<400> 27
gcgacgattt?gataattgtg?agtaccaagg?ttcattccca?atttag 46
<210> 28
<211> 45
<212> DNA
< 213>artificial sequence
<400> 28
actcacaatt?atcaaatcgt?cgcaacagag?ggttaccaaa?gttca 45
<210> 29
<211> 58
<212> DNA
< 213>artificial sequence
<400> 29
ccctctagac?tattgaacag?taatagaact?acttcctgaa?ctttggtaac?cctctgtt 58
<210> 30
<211> 21
<212> DNA
< 213>artificial sequence
<400> 30
atgctcacca?agaaccttct?c 21
<210> 31
<211> 20
<212> DNA
< 213>artificial sequence
<400> 31
ttactgaaca?gtgatggacg 20
<210> 32
<211> 23
<212> DNA
< 213>artificial sequence
<400> 32
taatgtcctg?cgcacttcca?ggg 23
<210> 33
<211> 23
<212> DNA
< 213>artificial sequence
<400> 33
agtgcgcagg?acattaccta?cag 23
<210> 34
<211> 30
<212> DNA
< 213>artificial sequence
<400> 34
ccctctagat?tactgaacag?tgatggagga 30
<210> 35
<211> 27
<212> DNA
< 213>artificial sequence
<400> 35
cccgaattcg?ttccccacga?ctctgtc 27
Claims (5)
1. improve the gene of black mold zytase expression amount, it is characterized in that nucleotide sequence xynBT such as SEQ ID NO.1 are said.
2. the recombinant plasmid that comprises the said SEQ ID of claim 1 NO.1 nucleotide sequence.
3. recombinant plasmid pPICZ alpha-the xynBT that comprises the said SEQ ID of claim 1 NO.1 nucleotide sequence.
4. comprise the recombinant plasmid preparation method of the said raising black mold of SEQ ID NO.1 zytase expression amount gene, it is characterized in that step is:
(1)
XynBTSynthetic: design one group of 28 oligonucleotide, said 28 oligonucleotide sequences such as SEQ ID NO.2～SEQ ID NO.29 are said; The xylanase gene of black mold
XynBTAcquisition: take the two-step pcr amplification technique, the first step, reaction system 50 μ L, wherein whole 28 Oligonucleolide primers 100 nM of 5 μ L; 4 μ L dNTP Mixture: each 2.5 mM, 5 μ L, 10 * PCR Buffer, 2.5 U Ex Taq add water and supply 50 μ L; Reaction conditions is: 94 ℃ of preparatory sex change 5 min, 94 ℃ of sex change 30 s, 59 ℃ of annealing 30 s; 72 ℃ of 1 min, 30 circulations, 72 ℃ are extended 10 min; Second step, pcr amplification gene xynBT, reaction system 50 μ L: comprise the reaction product 2 μ L of the first step, primer SEQ ID NO.2:10 μ M 1 μ L; Primer SEQ ID NO.29:10 μ M 1 μ L, 4 μ L dNTP Mixture: each 2.5 mM, 5 * PCR Buffer, 10 μ L, 2.5 U Ex Taq; Add water and supply 50 μ L, reaction conditions is: 94 ℃ of preparatory sex change 5 min, 94 ℃ of sex change 30 s, 59 ℃ of annealing 30 s; 72 ℃ of 1 min, 30 circulations, 72 ℃ are extended 10 min;
(2) structure of recombinant plasmid pPICZ alpha-xynBT: the improved gene that will obtain
XynBTUse restriction endonuclease respectively with pPICZ α-A
EcoR I,
SacII carries out the substep enzyme and cuts, and rubber tapping is reclaimed respectively, concentrates back 16 ℃ of reactions and spends the night; The host bacterium is used the competent cell of Top10F ', is coated on the LLB flat board, and the LLB flat board contains 25 μ g/mL Zeocin; The inversion flat board spends the night, and selects single bacterium colony in 5 mL liquid LLB, contains 25 μ g/mL Zeocin among the LLB; 37 ℃, 200 rpm cultivate 8h, obtain recombinant plasmid pPICZ alpha-xynBT.
5. carry the pichia spp host cell of the said recombinant plasmid of claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103597449A CN102424828A (en) | 2011-11-15 | 2011-11-15 | Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103597449A CN102424828A (en) | 2011-11-15 | 2011-11-15 | Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102424828A true CN102424828A (en) | 2012-04-25 |
Family
ID=45958857
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103597449A Pending CN102424828A (en) | 2011-11-15 | 2011-11-15 | Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102424828A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876693A (en) * | 2012-10-19 | 2013-01-16 | 中山大学 | Xylanase gene xynB as well as expression vector and application of Xylanase gene xynB |
| CN103305428A (en) * | 2013-06-26 | 2013-09-18 | 武汉合缘绿色生物工程有限公司 | Aspergillus niger strain and application thereof |
| CN107699584A (en) * | 2017-09-30 | 2018-02-16 | 武汉轻工大学 | The preparation method of xylanase gene, recombinant expression carrier, recombinant strains, zytase and preparation method thereof and feed |
| CN112501041A (en) * | 2020-12-03 | 2021-03-16 | 西安德诺海思医疗科技有限公司 | Pichia pastoris high-density fermentation medium and fermentation method thereof |
-
2011
- 2011-11-15 CN CN2011103597449A patent/CN102424828A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| KINOSHITA ET AL.: "Cloning of the xynNBgene encoding xylanase B from Aspergillusniger and its expression in Aspergillus kawachii", 《J. FERMENT. BIOENG》 * |
| LI ，ET AL.: "SYNONYMOUS CONDON USAGE BIAS AND OVEREXPRESSION OF A SYNTHETIC xynB GENE FROM Aspergillus niger NL-1 IN Pichia pastoris", 《BIORESOURCE》 * |
| LI F.: "Synthetic construct xylanase precursor (xynB) gene, complete cds.", 《EMBL-BANK: HQ385274.1》 * |
| LI,F.: "Synthetic construct xylanase precursor (xynB) gene,complete cds", 《GENBANK: HQ385274.1》 * |
| 李飞等: "木聚糖酶基因xynB在不同大肠杆菌表达系统中的表达比较", 《应用与环境生物学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876693A (en) * | 2012-10-19 | 2013-01-16 | 中山大学 | Xylanase gene xynB as well as expression vector and application of Xylanase gene xynB |
| CN103305428A (en) * | 2013-06-26 | 2013-09-18 | 武汉合缘绿色生物工程有限公司 | Aspergillus niger strain and application thereof |
| CN103305428B (en) * | 2013-06-26 | 2015-02-18 | 武汉合缘绿色生物工程有限公司 | Aspergillus niger strain and application thereof |
| CN107699584A (en) * | 2017-09-30 | 2018-02-16 | 武汉轻工大学 | The preparation method of xylanase gene, recombinant expression carrier, recombinant strains, zytase and preparation method thereof and feed |
| CN112501041A (en) * | 2020-12-03 | 2021-03-16 | 西安德诺海思医疗科技有限公司 | Pichia pastoris high-density fermentation medium and fermentation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106701606B (en) | Genetic engineering candida utilis capable of degrading and utilizing kitchen waste and construction method thereof | |
| CN102471780A (en) | Compositions and methods for improved saccharification of biomass | |
| CN104651383A (en) | Recombinant pichia pastoris engineering bacteria and production method thereof | |
| CN104130951A (en) | Recombinant pichia pastoris engineering bacteria and metabolic recombinant xylanase as well as preparation of metabolic recombinant xylanase | |
| CN101910404A (en) | Methods for increasing starch content in plants | |
| CN102405291A (en) | Methods for increasing starch content in plant cobs | |
| CN102424828A (en) | Gene capable of increasing expression level of aspergillus niger xylanase, recombinant plasmid and host cell thereof | |
| CN104975039A (en) | Recombinant plasmid and application of recombinant plasmid to degrading cellulose raw material | |
| CN103789282B (en) | The preparation method of a kind of high temperature mannase ManAHr and gene thereof and application | |
| CN108048473A (en) | A kind of feruloyl esterase gene, engineering strain and preparation method and purposes | |
| CN101469325B (en) | Secretory expression method for exoinulinase from Kluyveromyces marxianus | |
| CN108977470B (en) | Method for producing polyunsaturated fatty acid-rich oil by adopting lignocellulose | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN104560741B (en) | A kind of temperature control starts the structure of the aspergillus niger genetic engineering bacterium of expression cellulose excision enzyme | |
| CN101544985B (en) | Optimized sequence of alpha-galactosidase gene and efficient expression strain | |
| CN105695492B (en) | Pectin lyase optimized gene and expression vector and application thereof | |
| CN102399803B (en) | Improved beta-glucosidase gene and preparation of recombinase thereof | |
| CN104974945B (en) | Saccharomyces cerevisiae for over-expressing MIG1 gene and preparation method and application thereof | |
| CN108893501B (en) | Method for preparing DHA (docosahexaenoic acid) by adopting lignocellulose | |
| Ritter et al. | The influence of sorbitol on the production of cellulases and xylanases in an airlift bioreactor | |
| CN108977493B (en) | Method for preparing astaxanthin by adopting lignocellulose | |
| CN103146726A (en) | Aspergillus niger alpha-glucosidase gene and high-efficiency expression method thereof | |
| CN111100853B (en) | Xylanase xyn11A, and coding gene and application thereof | |
| CN103789283B (en) | A kind of neutral arabinofuranosidase Abf43 and gene thereof and application | |
| CN103045629A (en) | Lactase glucose depression knockout vector pMD19/HPT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120425 |