CN102409026A - Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening - Google Patents
Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening Download PDFInfo
- Publication number
- CN102409026A CN102409026A CN2010102893012A CN201010289301A CN102409026A CN 102409026 A CN102409026 A CN 102409026A CN 2010102893012 A CN2010102893012 A CN 2010102893012A CN 201010289301 A CN201010289301 A CN 201010289301A CN 102409026 A CN102409026 A CN 102409026A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- cell
- culture medium
- hut
- tumor stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a novel method capable of largely and fast enriching and culturing stem/progenitor cell subsets in blood suspended cancer cells by an embryonic stem cell culture medium, and a culture medium composition. The embryonic stem cell culture medium is adopted, stem/progenitor cell cloning of blood cancer cells can be selected in a semisolid culture medium through adding other factors and inhibitor micromolecule compounds inhibiting glycogen synthase kinase (GSK) signal channels and tyrosine kinase, and the cloning can be massively cultured in a suspended way and amplified in the blood cancer stem cell culture medium provided by the invention. The blood cancer stem cells obtained by the method have special marks in aspects of cell morphology, stem cell gene expression, stem cell surface characteristic antigen expression and the like, the stem cell characteristic of sieved suspended stem cells is closer to that of embryonic stem cells, and the obvious drug resistance on chemotherapeutic drug is realized. The novel method and the culture medium composition have good application prospects in the aspects of blood suspended cancer stem cell enrichment and cloning, cancer stem cell special drum screening and identification and the like.
Description
Technical field
The invention belongs to the cell culture medium manufacturing in the technical field of bioengineering; More specifically; Relate to a kind of screening from the tumour cell of blood system, cultivate and the technology and the method for the corresponding tumor stem cell subgroup that increases, as screening, in-vitro evaluation model method and the experiment material of medicament for treatment of leukemia screening and biotherapy, gene therapy.
Background technology
Tumour is a kind of important diseases that threatens human health, is the second dead killer of present human diseases.White blood disease is human recycle system's a tumour, in recent years this disease be significant growing trend, and present the trend that becomes younger.People are to leukemic treatment, mainly the method through chemotherapy.Though bone marrow depression is considered to treat white blood disease and lymphadenomatous effective means,, seriously limited the bone marrow transplantation broad application because blood is joined the existence of allosome inhibition repulsive interactions such as type.Though the chemotherapy technology can significantly suppress white blood disease and lymphadenomatous propagation, that can thoroughly cure is still not general.Before about 50 years, people have proposed the notion of tumor stem cell the earliest from the generation of myelogenous leukemia and development law
1, and think that these tumor stem cells are that normal stem cell and/or progenitor cell form through sudden change.The normal hematopoiesis stem cell can continue to be divided into hematopoietic cell, like red corpuscle, thrombocyte, white corpuscle (comprising T-lymphocyte and B-lymphocyte), neutral granulocyte etc.Tumor stem cell has similar character with normal stem cell, also can break up, be proliferated into hematopoietic cell system or immature progenitor cell with genetic flaw, claims protoblast again.It is found that and verify that the effect of tumor stem cell in generation, development and the deterioration process of tumour at first is from the acute myeloid leukaemia patient samples, to isolate a kind of surface antigen CD96 male tumour cell hypotype that has
2, the number of this tumor stem cell in tumour is few, but tumour is pernicious very strong, is one of the major reason of the chemotherapy resistance of tumour, also is the important root of leukemia chemotherapy failure.Therefore, seek new, high-efficiency low-toxicity, be a major technique bottle footpath that thoroughly cures the tumour illness to tumor stem cell single-minded new tumor therapeuticing method and new medicaments sifting model.
From the clinical blood sample, marrow or leukemia cell are that the separate out suspended tumor stem cell remains a very thing of difficulty at present, and major cause is because the number of neoplastic hematologic disorder stem cell is considerably less.There are two kinds by the separation method of extensive employing
3, (1) adopts fluidic cell sorting technology or immunological magnetic bead sorting to go out to be rich in the component of tumor stem cell through the figuratrix antigen of marked tumor stem cell.Present employed surface characteristic antigen mainly contains CD9, CD33, CD44, CD90, CD96, CD110, CD123 etc.Owing to adopt single surface antigen that the separating capacity of tumor stem cell is had limitation; The tumor stem cell quantity that sub-elects with this method is few; The purity of cell damaged and stem cell is not high enough in the sepn process, is a technological barrier of restriction further investigation tumor stem cell.(2) the another kind of sorting strategy of research tumor stem cell be through cell streaming sorting technology with discharging optical dye in the neoplastic hematologic disorder, like optical dye Hoechst 33342, cell, be called the side group cell.Because the side group cell tumor stem cell that has been relative enrichment, can not reflect the character of tumor stem cell through the character of research tumour side group cell comprehensively.Therefore press for the short-cut method that directly carries out tumor stem cell screening, cultivation, amplification by the blood tumor cell strain in research and the research and development of products at present.
Summary of the invention
The present invention is mainly concerned with the novel method of a kind of sorting from the hematological system tumor cell, enrichment, cultivation and amplification neoplastic hematologic disorder stem cell.The characterizing gene, the antigenic high expression level of stem cell surface sign that have tumor stem cell with the neoplastic hematologic disorder stem cell of this method acquisition.The neoplastic hematologic disorder stem cell that obtains with this method is the external model of the novel medicament for treatment of leukemia of screening.
Core content of the present invention has following four aspects.
First aspect, the invention provides a kind of can fast culture the new method of neoplastic hematologic disorder colony.In the colony of blood tumor cell is cultivated, with embryonic stem cell substratum such as HEScGRO
TMThe factors such as middle adding jad1 are carried out the semisolid cultivation for the substratum main ingredient, and blood tumor cell can form colony.This colony has the characteristic that neoplastic hematologic disorder is done (ancestral).
It should be appreciated by those skilled in the art that embryonic stem cell substratum of the present invention is the staple that the neoplastic hematologic disorder stem cell colonies is cultivated, this embryonic stem cell substratum is not limited to HEScGRO
TM, utilize the embryonic stem cell substratum to be the basis, add the relevant composition of some cell proliferation, like cytokine.
Second aspect the invention provides the effectively additive of enrichment neoplastic hematologic disorder stem cell.This additive reaches effective inhibition differentiation of stem cells through suppressing GSK signal path and tyrosine kinase inhibitor, improves the efficient of neoplastic hematologic disorder stem cell screening.
The third aspect the invention provides the purposes of substratum of the present invention, and it can be used to prepare the stem cell of blood tumor cell.These tumour cells can be the blood tumor cell strains of having built strain, also can be primary tumor cells.
Fourth aspect the invention provides the neoplastic hematologic disorder stem cell culture reagent box that comprises core substratum of the present invention.
The 5th aspect the invention provides a kind of, efficiently new medicaments sifting model single-minded to the neoplastic hematologic disorder stem cell that be used to screen.Here new medicine is not only chemotherapeutics (chemical synthetic drug and natural drug), also comprises the modern biotechnology medicine, like albumen, polypeptide drugs and nucleic acid drug, and the small nucleic acids medicine.
Below will do further elaboration to the present invention, but embodiment does not limit protection scope of the present invention through embodiment.Those skilled in the art can not deviate from the modification and the change of the spirit and scope of the present invention according to design of the present invention and disclosed technical scheme fully, and this is also within protection scope of the present invention.
Description of drawings
Fig. 1. the acute T-lymphoblastoma of people Hut-102 inoculation culture in the semi-solid nutrient agar that contains the present invention's elaboration is spent the night and is afterwards formed the photo of Hut-102 ancestral cells (Hut-102S) colony.The magnification of cell is 100 times.
Fig. 2. the cellular form that the acute T-lymphoblastoma of people Hut-102 and its ancestral cells Hut-102S suspension culture go down to posterity.Wherein the substratum of Hut-102 is the DMEM substratum that contains 10% foetal calf serum, and Hut-102S is a stem cell media disclosed by the invention.The magnification of cell is 100 times.
Fig. 3. the clonal growth of human promyelocytic leukemia K562 cell in semi-solid stem cell media.The magnification of cell is 100 times.
Fig. 4. the relevant stem cell expression of gene of the acute T-lymphoblastoma of people Hut-102 and its ancestral cells Hut-102S.Getting people β-actin gene is internal control gene.
Fig. 5. the expression of the acute T-lymphoblastoma of people Hut-102 and the relevant stem cell antigen of its ancestral cells Hut-102S.
Fig. 6. the expression of the special surface antigen of the stem cell of human promyelocytic leukemia K562 cell.
Fig. 7. the amount effect curve of adriamycin and vincristine difference Hut-102 and Hut-102S cell inhibitory effect.Wherein scheming A is the restraining effect curve of Zorubicin on cell proliferation, and figure B is the restraining effect curve of vincristine(VCR) on cell proliferation.The culture condition of Hut-102 and Hut-102S is identical with Fig. 2; Hut-102 and Hut-102S cell be 5000/hole of inoculation in 96 orifice plates respectively; The adriamycin and vincristine that adds different concns after spending the night respectively; After continue cultivating 48h, measure the relative number of viable cell, and be 0 inhibiting rate with the experimental port that does not add chemotherapeutic with viable cell numeration test kit.
Embodiment
Below will do further detailed elaboration to the present invention through embodiment.But, will be understood by those skilled in the art that following embodiment only is presented for purposes of illustration, does not limit protection scope of the present invention, the spirit and scope of the present invention are limited accompanying Claim.The relevant technician in this area can not deviate from the modification and the change of the spirit and scope of the present invention according to design of the present invention and disclosed technical scheme fully, and this is also within protection scope of the present invention.
The lymphadenomatous tumour ancestral cells of embodiment 1.T-colony is cultivated, amplification
Hut-102 is available from U.S. cell bank ATCC (TIB-162) for the strain of people T-lymphocytoma; Cell cultures is used and is contained 10% foetal calf serum (PAA; FCS500) DMEM substratum (DM10140021), cultivate in the T-25 Tissue Culture Flask that Coring company produces because of ltd of WaSunChina by Beijing button; Culture condition is 37 ℃, 5%CO
2Cell went down to posterity once in per two days.The colony of blood tumor cell is cultivated and in the 35mm of Corning company petridish, is carried out.Lower floor's shop one deck of petridish contains the DMEM semisolid medium of 1% agarose.Other gets new neoplastic hematologic disorder stem cell media (prescription is seen table 1) and is made into 1 milliliter of 0.3% agarose substratum, and inoculates 1000 Hut-102 cells therein, be layered on gently behind the mixing 1% agarose above.The prescription of suspension tumor stem cell substratum disclosed by the invention is seen table 1.Cell is at 37 ℃, 5%CO
2Cultivate in the cell culture incubator.Examined under a microscope in 5th, and can see that the formation of cell colony (see figure 1) was arranged.The more present widely used hemopoietic stem cell colony cultural method of this method is more effectively quicker.Present normally used method is cultivated the blood cell progenitor cell to be needed more than 2 weeks usually.
Table 1: culture medium prescription is used in the screening of suspension tumor stem cell, amplification:
| Composition | Content |
| The DMEM basic medium | 0-30％(v/v) |
| Embryonic stem cell substratum HEScGRO | 70-100％(v/v) |
| DII4 | 0-2mg/ml |
| FGF2 | 0-1mg/ml |
| Jag1 | 0-2mg/ml |
| CHIR99021 | 0-300nM |
[0025]?
| PD173074， | 0-1μM |
| PD184352 | 0-1μM |
| PD0325901 | 0-1μM |
The single colony of Hut-102 is chosen in Tissue Culture Flask, and in the neoplastic hematologic disorder stem cell media (37 ℃, 5%CO
2) suspension culture.Tumor stem cell can increase in a large number.Fig. 2 demonstration is compared with wild-type Hut-102, the stem cell regular shape, and rounded, cell is bigger slightly than wild-type.
The embodiment 2. early cell ancestral cells colony of children's grain leukemia K 562 cell strain cultivates, increases
Human promyelocytic leukemia K562 cell strain available from U.S. cell bank ATCC (?); Cell cultures is used and is contained 10% foetal calf serum (PAA; FCS500) DMEM substratum (DM10140021), cultivate in the T-25 Tissue Culture Flask that Coring company produces because of ltd of WaSunChina by Beijing button; Culture condition is 37 ℃, 5%CO
2Cell went down to posterity once in per 3 days.The colony of blood tumor cell is cultivated and in the 35mm of Corning company petridish, is carried out.Lower floor's shop one deck of petridish contains the DMEM semisolid medium of 1% agarose.Other gets new neoplastic hematologic disorder stem cell media (prescription is seen table 1) and is made into 1 milliliter of 0.3% agarose substratum, and inoculates 1000 K562 cells therein, be layered on gently behind the mixing 1% agarose above.Cell is at 37 ℃, 5%CO
2Cultivate in the cell culture incubator.Examined under a microscope in 5th, and can see that the formation of cell colony (see figure 3) was arranged.Above-mentioned clone is chosen, transfer to amplification cultivation in the stem cell media disclosed by the invention, obtain to have the promyelocytic leukemia cell subgroup of stem cell characteristic.The present invention provides the assurance of research material for the behavioural characteristic of research K562 stem cell, because be difficult to obtain a large amount of K562 stem cells with traditional separation method.
The stem cell genetic expression of embodiment 3. lymphoma stem cells
The Hut-102 new subtype (Hut-102S) that to screen, cultivates in order to verify is a tumor stem cell, and the variation of several cells and characteristic of stem expression conditions of this cell subsets is measured.What select here is to use commonplace Nanog, these four genes of Oct4 and Sox2 in the research embryonic stem cell.Used PCR primer is seen table 2, and day RT-PCR test kit (KR114) of root biotech company is adopted in the PCR experiment, and carries out according to the test kit process specifications.Fig. 4 has provided the gel photograph at the PCR of Hut-102 and Hut-102S product.Show among the figure that internal control gene β-actin is identical with expression amount among the Hut-102S at Hut-102; Stem cell marker gene NANOG does not express in Hut-102; In Hut-102S, express significantly and rise; And the SOX2 gene decline to a certain degree occurs in the expression of Hut-102S, does not change and the expression of stem cell gene Oct4 in Hut-102 and Hut-102S is significant.Bibliographical information is arranged recently
4CD90 and CD110 are characteristic indication things of identifying acute lymphoblast knurl stem cell; But be to use the CD90 of the tumor stem cell Hut-102S that the present invention prepares and expression and the wild-type cell of CD110 not to have difference; Both CD90 express and all become positive, and the expression of CD110 all becomes negative (result does not show).The above results has verified that the blood tumor cell hypotype of using preparation method of the present invention and substratum to obtain has the allelic expression of stronger stem cell, meets the characteristic of neoplastic hematologic disorder stem cell, and is different from the T-lymphoma stem cell of having identified.
The primer sequence that table 2PCR uses
| Gene | Forward primer | Reverse primer |
| NANOG | TTCGCCTATGCCTGTGATTTGT | CTCCAGAAGTGGGTTGTTTGCC |
| OCT4 | AGAAGGATGTGGTCCGAGTGT | CCAGAGTGGTGACGGAGACAG |
| SOX2 | CAGCCCCCCTGTGGTTACCTCTTCC | CTCTATTGCACCCCTCCCATTTCCC |
| CD90 | CCCAGTGAAGATGCAGGTTT | GACAGCCTGAGAGGGTCTTG |
| CD110 | TCGTAGCGAGAGGACGATTG | GGAGGAGGGAGAGGGACAGC |
The cell airflow classification of the molecular surface mark of embodiment 4. lymphoma stem cells
When sign, sorting neoplastic hematologic disorder stem cell, the surface antigen mark of characteristic is a kind of method that is widely used, and wherein surface antigen CD34 and CD44 are to use two marks more widely
3T-lymphocytoma Hut-102 is the blood tumor cell that the transgenation defective forms in the hemopoietic stem cell atomization, and the Hut-102S stem cell should possess some characteristics of hemopoietic stem cell.Fig. 5 has provided with fluorescently-labeled monoclonal antibody and has detected in Hut-102S and the Hut-102 cell in CD34 and CD44 expression positive cells ratio through the cell flow sorter.Employed monoclonal antibody is the product (CD34CAT:550618 of BD bioscience company; CD44CAT:555478), the flow cell sorter that carries out cell sorting is the FACSCalibur of BD company.From figure, can see that the cell of CD34 surface antigen positive in Hut-1-2S accounts for 74.2%; The cell of CD44 surface antigen positive accounts for 90.8%; And the cell of CD34 surface antigen positive only accounts for 2.24% in Hut-102 wild-type tumour cell, and the cell of CD44 surface antigen positive only accounts for 4.84%.CD34 and CD44 high expression level simultaneously are the surface characteristic of tumor stem cell among the slow graininess white blood disease CML that has identified, but in the progenitor cell of the acute lymphoblast knurl of having identified, the positive expression of CD34 are only arranged, and do not have the positive expression of CD44
3The remarkable enhancing that hemopoietic stem cell figuratrix antigens c D34 and CD44 express has verified that further cell that method provided by the present invention and screening of medium go out has more the characteristic of stem cell than wild-type blood tumor cell; Being a kind of Shinkansen cell subsets of Hut-102 blood tumor cell, also is the leukemic a kind of new tumor stem cell of T-ALL.
Embodiment 5. is the express cell airflow classification of the molecular surface mark of children's grain leukemic stem cells early
Adopt CD34 and CD44 (it is the same to originate) to K562 with and stem cell hypotype K562S carried out the sorting of TSA expression; The result is as shown in Figure 6; CD34 and CD44 do not express basically in the K562 cell; The CD34 positive cell only accounts for 2.86%, and the CD34 positive cell reaches 81.47% in K562S; The CD44 positive cell is merely 1.76% in the K562 cell, and among the K562S CD44 positive cell reach 50.85%, verified and used the tumour cell of culture medium prescription disclosed by the invention screening to have the tumor stem cell characteristic.
Embodiment 6. neoplastic hematologic disorder stem cells are to the chemotherapeutics tolerance
Chemotherapeutic in chemotherapy of tumors medicine, the especially leukemia treating that uses clinically at present all can cause the generation of the multidrug resistance phenomenon of tumour.It is consistent that this multidrug resistance phenomenon is considered to have resistance with tumor stem cell.Fig. 6 shows that with the prepared neoplastic hematologic disorder stem cell Hut-102S of method provided by the invention the chemotherapeutics adriamycin and vincristine is had significant resistance.In 96 orifice plates, plant the Hut-102 and the Hut-102S in 5000/hole respectively; The DMEM that contains 10% foetal calf serum or the stem cell media overnight cultures provided by the invention that add 100ul respectively; In every hole, add Zorubicin or vincristine(VCR) respectively, make its final concentration as shown in Figure 5.After cell administration continued is cultivated 48h, adopt CCK-8 test kit (JC680) to survey the relative reactivity of other cell, and adopt graphpad prism computed in software Hut-102 and Hut-102S IC adriamycin and vincristine
50Value is respectively the IC of Hut-102 cell to Zorubicin
50Be 1.3ng/ml, to the IC of vincristine(VCR)
50Be 1.6ng/ml; The Hut-102S tumor stem cell is to the IC of Zorubicin
50Be 95 μ g/ml, to the IC of vincristine(VCR)
50Be 8.9 μ g/ml.Tumor stem cell Hut-102S has improved 7.3 * 10 to the resistance index of Zorubicin than wild-type Hut-102
4Doubly, to vincristine(VCR), the resistance index has improved 5.6 * 10
3Doubly.Table 2 has been listed above-mentioned testing data.Data show that the resistance exponential increase of the neoplastic hematologic disorder stem cell Hut-102S that screens, cultivates with method disclosed by the invention and culture medium prescription is higher than resistance multiple (5) approved 100 times in the present resistance research far away also greater than the tumor stem cell of reporting at present and the resistance index of its wild-type.It is not see in document and the patent that Hut-102S has so high resistance to adriamycin and vincristine in the past.Present research field at tumor stem cell; The SP cell that people generally accept tumour has the characteristic of tumor stem cell; But strong with dryness, the tumor stem cell (like the tumor stem cell Hut-102S of the present invention's preparation) with the expression of multiple embryo or adult stem cell characterizing gene is compared, and it is strong that its drug-resistant intensity can not show a candle to tumor stem cell.Present embodiment explains that the neoplastic hematologic disorder stem cell with method that the present invention set forth and material prepn is new neoplastic hematologic disorder chemotherapeutic treatment method of research and the valid model that screens new high efficiency anti-tumor chemotherapy new drug.This model also provides the external model basis for leukemic biotherapy simultaneously.
Table 3 adriamycin and vincristine is to Hut-102 and Hut-102S cell inhibitory effect IC
50Experiment parameter
Annotate: resistance index=IC
50(Hut-102)/IC
50(Hut-102S)
Reference
(1)Jordan?CT，(2007)The?leukemic?stem?cell.Best?Pract?Res?Clin?Haematol.20，13-18.
(2)Hosen?N，Park?CY，Tatsumi?N，(2007)CD96is?a?leukemic?stem?cell-specific?marker?in?human?acute?myeloid?leukemia.PNAS?2007)
(3)Yamazaki?H，Nishida?H，Iwata?S，Dang?NH，Morimoto?C.(2009)CD90and?CD110correlate?with?cancer?stem?cell?potentials?in?human?T-acute?lymphoblastic?leukemia?cells.Biochem?Biophys?Res?Commun.383，172-)
(4)Deng?C，Zhang?Q，(2010)Leukemia?stem?cells?in?drug?resistance?and?metastasis.Chin?Med?J?123，954-960.
(5)Zhao?X，Yang?L，Hu?J，Ruan?J.(2010)miR-138might?reverse?multidrug?resistance?of?leukemia?cells?Leukemia?Research?Volume?34，1078-1082)，
Claims (8)
- One kind can be in a large number and fast enriching and method and the culture medium prescription of cultivating the suspension tumor stem cell.
- 2. right 1 requires described fast enriching and the method for cultivating the suspension tumor stem cell to be made up of following several key links:A) prepare the tumour cell suspension that is separated from each other; B) preparation of the suspension tumor stem cell semisolid medium of serum-free; C) suppress the interpolation of differentiation of stem cells composition, D) accelerate the supply of stem cells hyperplasia composition, E) tumor stem cell and semisolid medium mixes, cultivates and change liquid.
- 3. right 1 and 2 requires the method and the culture medium prescription of described cultivation suspension tumor stem cell; Must or have at the embryonic stem cell substratum and add an amount of Delta-like4 (D114), Jagged 1 (Jag1) and FGF2 composition in the embryonic stem cell substratum of similar functions.
- 4. right 1 and 2 requires the method and the culture medium prescription of described cultivation suspension tumor stem cell; Must in substratum, add and suppress GSK signal pathway inhibitor and tyrosine kinase inhibitor; These suppressor factor comprise but are not limited to CHIR99021; PD173074, PD184352, PD0325901 etc.
- 5. desired culture medium prescription can comprise the basic medium of interpolation in the right 1, like DMEM, and RPMI1640; The concentration range of adding is 0-30% (volume).
- 6. right 1 requires described suspension tumor stem cell culture medium prescription can manufacture the different culture test kit, breeds needed growth factor, cytodifferentiation suppressor factor comprising difference suspension tumor stem cell.
- 7. the neoplastic hematologic disorder stem cell markers of method of the application of the invention of right 1 requirement and/or substratum acquisition can be used for the diagnosis of tumour and the assessment of result of treatment.
- 8. the neoplastic hematologic disorder stem cell of method of the application of the invention of right 1 requirement and/or substratum acquisition can be used for screening, assessment and the use of chemotherapeutics.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102893012A CN102409026A (en) | 2010-09-25 | 2010-09-25 | Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102893012A CN102409026A (en) | 2010-09-25 | 2010-09-25 | Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102409026A true CN102409026A (en) | 2012-04-11 |
Family
ID=45911377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102893012A Pending CN102409026A (en) | 2010-09-25 | 2010-09-25 | Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102409026A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978163A (en) * | 2012-11-17 | 2013-03-20 | 黄兵 | Technology for enriching and amplifying adherent stem cells with no differentiation |
| CN103045539A (en) * | 2012-12-14 | 2013-04-17 | 黄兵 | Method for enrichment and non-differentiation amplification of suspension stem cells |
| CN104312976A (en) * | 2014-10-14 | 2015-01-28 | 广州市搏克肿瘤研究所 | Separating method of tumor stem cells |
| CN111118099A (en) * | 2018-10-30 | 2020-05-08 | 启迪汉洱康（嘉兴）生物科技有限公司 | Method for screening leukemia high-flux drugs |
-
2010
- 2010-09-25 CN CN2010102893012A patent/CN102409026A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978163A (en) * | 2012-11-17 | 2013-03-20 | 黄兵 | Technology for enriching and amplifying adherent stem cells with no differentiation |
| CN103045539A (en) * | 2012-12-14 | 2013-04-17 | 黄兵 | Method for enrichment and non-differentiation amplification of suspension stem cells |
| CN104312976A (en) * | 2014-10-14 | 2015-01-28 | 广州市搏克肿瘤研究所 | Separating method of tumor stem cells |
| CN111118099A (en) * | 2018-10-30 | 2020-05-08 | 启迪汉洱康（嘉兴）生物科技有限公司 | Method for screening leukemia high-flux drugs |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pezoldt et al. | Neonatally imprinted stromal cell subsets induce tolerogenic dendritic cells in mesenteric lymph nodes | |
| Que et al. | Establishment and characterization of a patient-derived circulating lung tumor cell line in vitro and in vivo | |
| Sharma et al. | Mimicking the functional hematopoietic stem cell niche in vitro: recapitulation of marrow physiology by hydrogel-based three-dimensional cultures of mesenchymal stromal cells | |
| CN110373388A (en) | A kind of culture medium and organoid cultural method for organoid culture | |
| Richichi et al. | Marker-independent method for isolating slow-dividing cancer stem cells in human glioblastoma | |
| CN101538554A (en) | Survivability-screened cancer stem cells, preparation method, application and kit as well as antigen composite thereof, preparation method, application and kit | |
| US8765390B2 (en) | Identification and isolation of squamous carcinoma stem cells | |
| Zhao et al. | Interleukin-22 aggravates murine acute graft-versus-host disease by expanding effector T cell and reducing regulatory T cell | |
| KR101298012B1 (en) | Process for preparing lymphocytes comprising activated natural killer cells for targeting cancer cells and pharmaceutical composition comprising the same | |
| CN102409026A (en) | Novel method capable of enriching and amplifying suspended blood cancer stem cells, novel culture medium and application thereof to drug screening | |
| CN107043749B (en) | A kind of separant induction method of tumor-infiltrated T lymphocyte | |
| CN115651903B (en) | High-lethality immune cell population, and culture method, reagent composition and application thereof | |
| KR102123489B1 (en) | Compostion for culturing nk cell and method for culturing nk cell by using the same | |
| Modi et al. | Molecular insights of metastasis and cancer progression derived using 3D cancer spheroid co-culture in vitro platform | |
| CN102690784A (en) | Establishment and application of hepatocellular carcinoma cell line HCC-LY10 | |
| CN101560496A (en) | Dendritic cell carried by tumor stem cell antigen and subjected to tolerance screening, preparation method and application thereof, kit and vaccine comprising dendritic cell | |
| Li et al. | Autocrine factors sustain glioblastoma stem cell self-renewal | |
| CN102409025A (en) | New method of screening and enriching solid tumor stem cell | |
| CN103045539A (en) | Method for enrichment and non-differentiation amplification of suspension stem cells | |
| CA2168348A1 (en) | Novel stem cell marker | |
| CN102978163A (en) | Technology for enriching and amplifying adherent stem cells with no differentiation | |
| Kim et al. | Single‐cell analysis demonstrates how nutrient deprivation creates apoptotic and quiescent cell populations in tumor cylindroids | |
| CN102690785A (en) | Establishment and application of hepatocellular carcinoma cell line HCC-LY5 | |
| US20140356291A1 (en) | IDH1-Mutated Human Glioblastoma Cell Lines and Xenografts | |
| Farrell et al. | Pediatric glioblastoma cells inhibit neurogenesis and promote astrogenesis, phenotypic transformation and migration of human neural progenitor cells within cocultures |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| DD01 | Delivery of document by public notice |
Addressee: Huang Bing Document name: Notification that Application Deemed to be Withdrawn |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120411 |