CN102408161A - Biological active early warning marking method for chemical industry wastewater treatment - Google Patents
Biological active early warning marking method for chemical industry wastewater treatment Download PDFInfo
- Publication number
- CN102408161A CN102408161A CN2011103104070A CN201110310407A CN102408161A CN 102408161 A CN102408161 A CN 102408161A CN 2011103104070 A CN2011103104070 A CN 2011103104070A CN 201110310407 A CN201110310407 A CN 201110310407A CN 102408161 A CN102408161 A CN 102408161A
- Authority
- CN
- China
- Prior art keywords
- pcr
- dna
- dgge
- sewage treatment
- buffer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a biological active early warning marking method for chemical industry wastewater treatment, which specifically comprises the following steps of: extracting microorganism genome total DNA in active sludge of a sewage treatment system, and screening bacterial seeds by enrichment culture method and identifying; amplifying the microorganism genome total DNA by universal primers of V6-V8 areas of bacterial 16SrDNA; carrying out PCR-DGGE (Polymerase Chain Reaction Denaturing Gradient Gel Electrophoresis) analysis to the PCR product, and creating community succession mode in normal running system; finding bacterial strains closely related with COD (Chemical Oxygen Demand) change in the system, and using RAPD (Random Amplified Polymorphic DNA) technique to obtain specific molecular marker genes of pure culture strains; and directly judging if functional bacteria are existent for monitoring the sewage treatment system by PCR of specific molecular marker genes of functional bacteria. The invention solves the difficult problem that the current sewage treatment system cannot effectively and stably run, and the method is simple, convenient and fast to operate and can effectively monitor running situation of the sewage treatment system.
Description
Technical field
What the present invention relates to is a kind of biological activity early warning marking method that is used for chemical wastewater treatment, can be applied to the monitoring of operation of sewage disposal system situation, belongs to environmental microorganism molecular ecology field.
Background technology
The biological treatment of waste water does not add medicament, does not have secondary pollution; Under the condition of gentleness through enzyme catalysis can be efficiently, accomplish relatively completely, processing costs is cheap; Require wide in range to waste water quality; Treatment effect is good, has not only removed organism, pathogenic agent, toxic substance etc., can also remove stink, enhances the transparency, and reduces colourity etc.For Sewage treatment systems, usually guarantee the steady running of Sewage treatment systems through monitoring to water quality, like the chemical parameters of control and monitoring water quality (like COD, NH
3-N, NO
3-N, PO
4 3--P and dissolved oxygen) and physical parameter (like hydraulic detention time), realize the processing up to standard of waste water.But only through controlling and monitor the chemistry and the physical parameter of water quality; Can not guarantee the operation efficient steady in a long-term of treatment system, the comprehensive wastewater from chemical industry of particularly high saliferous has supersalinity, high density, difficult degradation, characteristics that change of water quality is big; If control is talked about improperly to operating parameter; Very easily cause the instability of system, thereby influence standard wastewater discharge, environment is affected.In the biological treatment of waste water; Mikrobe is the main body of treatment system, therefore need start with from mikrobe, monitors through composition, abundance, distribution and function yeast to microflora; The molecular marking technique of combined function bacterial strain carries out monitoring and early warning to Sewage treatment systems; Through the succession rule of microflora's space structure of community and the variation monitoring system operation situation of function stem, the Adjustment System operating parameter guarantees the steady running of Sewage treatment systems in advance.
Denaturing gradient gel electrophoresis (Denaturing Gradient Gel Electrophoresis; DGGE) technology can be differentiated the difference of 1 base; Be widely used in the research of microbial ecology and microbial diversity; This detection means is sensitive quick, has avoided strain separating consuming time traditionally, can further identify the bacterial classification that traditional method can't be separated.
Randomly amplified polymorphic DNA technology (Randomly Amplified Polymorphic DNA; RAPD) as a kind of new dna fingerprinting analytical method; Not only have characteristics such as conventional round pcr is quick, safe, easy, sensitivity; And its primer has versatility, do not need the nucleotide sequence of clear and definite target gene in advance.
Have at present and utilize the patented claim that microflora constitutes in the wastewater treatment of PCR-DGGE technical Analysis, like the functional flora special molecular detection method in the Industrial Wastewater Treatment of Shanghai university of communications invention (CN1995389, open day on July 11st, 2007); The method that the analysis municipal sewage sludge microflora that Tongji University proposes constitutes (CN1584051, open day on February 23rd, 2005); The detection method (CN101440406A) of a kind of functional flora that Harbin Institute of Technology proposes stability in water treatment system.Above-mentioned patent relates separately to the detection method of function yeast in the WWT and the analytical procedure that microflora forms; Steady running to promoting Sewage treatment systems has active effect, combines and is applied to Sewage treatment systems but the Sewage treatment systems structure of community is not changed detection with function yeast.Sewage treatment systems is moved as a whole, only through to the compositional analysis of function yeast in the system or biological community structure, and running condition that can not the effective monitoring Sewage treatment systems.Biological community structure variation detection in the Sewage treatment systems and function yeast detection are combined, and through the active early warning of system biological, mikrobe is formed in the Adjustment System, Sewage treatment systems is monitored the steady running that guarantees Sewage treatment systems.The patent research report that does not also have at present biological community structure and function yeast in the wastewater treatment.
Summary of the invention
The objective of the invention is to detect the blank that exists, proposed a kind of biological activity early warning marking method that is used for chemical wastewater treatment to biological community structure in the comprehensive wastewater from chemical industry and function yeast.Through PCR-DGGE technology and technological the combining of RAPD, the operation conditions of monitoring Sewage treatment systems, the operation conditions of diagnostic process system has solved deficiency of the prior art in advance.
The biological activity early warning marking method that is used for chemical wastewater treatment provided by the invention comprises:
(1) the total DNA of microbial genome in the active sludge in each reaction tank of extraction Sewage treatment systems identifies through the method strain screening of enrichment culture and to it simultaneously;
(2) screening PCR-DGGE primer: be respectively V3 district, V6-V8 district, V9 district universal primer, and optimize denaturing agent scope and electrophoresis time;
(3) with the V6-V8 district of the total DNA of V6-V8 district universal primer amplification microbial genome of bacterial 16 S rDNA;
(4) the PCR product is carried out PCR-DGGE and analyze, and the DNA band in the collection of illustrative plates is carried out sequencing analysis;
(5) find the DGGE band that carrying capacity is bigger in community succession through the analysis of PCA carrying capacity, the mikrobe of these band representatives is the operating functional microbials of system, and it is identified; The bacterial strain that screens in the integrating step (1) simultaneously finds in the system to change closely-related bacterial strain with COD, and this bacterial strain can be used for judging running situation;
(6) use the RAPD technology to obtain the specific molecular marker gene of bacterial strain pure culture bacterial strain, through the PCR of function yeast specific molecular marker gene, directly the arbitration functions bacterium have a situation, Sewage treatment systems is monitored.
The process for extracting of the described genome DNA of step (1) is:
1. sample pretreatment: measure the 30mL active sludge sample in each reaction tank respectively, 10000rpm, 4 ℃ of centrifugal 5min abandon supernatant; The TENP buffer (TENP buffer consist of 50mM Tris, 20mM EDTA, 100mM NaCl, 1%PVP and pH=10) that adds 100mL in the deposition adds the granulated glass sphere of 4 sterilizations, vortex vibration 2min, and the same centrifugally operated is abandoned supernatant; The saline water that adds 100mL, washed twice;
2. lysis: pretreated mud sample is taken by weighing pack into the EP pipe of 1.5mL of 0.2g respectively; The Extraction Buffer that adds 600uL; Extraction Buffer consists of 100mM Tris, 100 mM EDTA, 200 mM NaCl, 2%CTAB and pH8.0, and vortex vibration 5min adds the SDS Buffer of 600uL again; The Tris that consists of 100mM of SDS Buffer, NaCl, 2%SDS and the pH8.0 of 200mM, 5min turns upside down;
3. multigelation: the EP pipe is put into-80 ℃ of refrigerator 15min, and 50 ℃ of water-bath 2min repeat 3 times;
4. Deproteinization: add isopyknic phenol: chloroform: the solution extracting albumen of primary isoamyl alcohol=25:24:1 is not till have egg white layer and occur; Draw supernatant and add new EP pipe, the solution that adds isopyknic chloroform: primary isoamyl alcohol=24:1 is removed residual phenol, 15000rpm; 3min draws supernatant;
5. DNA separation and purification: add isopyknic isopropanol precipitating DNA, 15000rpm, 6min; Abandon supernatant, 70% washing with alcohol that adds 500mL in the deposition is dry, deposition is dissolved in the TE buffer of 40uL; TE buffer consists of pH=8.0; The Tris-Cl of 10mM pH8.0, the EDTA of 1mM pH8.0 ,-20 ℃ of preservations are subsequent use.
The described PCR program of step (3) is:
The PCR reaction is 50 μ L systems, consists of: contain 2.5 mM Mg
2+10 * PCR buffer, 5 μ L; 2.5 the dNTPs 5 μ L of mM; The upstream primer V6-8F-GC 1 μ L of 20 mM; The downstream primer V6-8R 1 μ L of 20 mM; Template DNA 1～10 ng; Taq enzyme 0.5 μ L; Add ultrapure water to 50 μ L at last;
The PCR program is Touchdown PCR:94 ℃ of preparatory sex change 5 min; 94 ℃ of sex change 1 min, 65 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, and per afterwards two circulations reduce by 1 ℃, totally 20 circulations; 94 ℃ of sex change 1 min, 55 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, totally 15 circulations; Last 72 ℃ are extended 10 min.
The said concrete operations of step (4) are:
Gum concentration is 6%, consists of acrylic amide: methylene diacrylamide=37.5:1; The denatured gradient scope is 30%～70%, and the compound method of denaturing agent is to contain the urea of 7 mol/L and 40% deionized formamide in 100% the denaturing agent; Consisting of 20 mM Tris, 10 mM glacial acetic acids, 0.5 mM EDTA, in 1 * TAE damping fluid of pH7.4,60 ℃, 160V moves 4 h; After electrophoresis finished, to gel-colored 15min, 3min decoloured with the EB solution of 1mg/L; With gel imaging system gel is analyzed, the gained image carries out analyzing and processing with Bio-Rad Quantity One software.
The said concrete operations of step (5) are:
Use SPSS software, find the bigger DGGE band of carrying capacity through its PCA carrying capacity analysis, and molecular biology identification is carried out in its order-checking; Find out band brightness flop and the relevant band of COD degradation efficiency variation in the DGGE collection of illustrative plates, the dna sequence dna that from these bands, obtains just can be used for following the tracks of and detection and the COD of system and remove the relevant microbial strains of efficient; Obtain pure bacterial strain through the bacterial classification in the Sewage treatment systems being carried out the separation and purification evaluation, itself and the total DNA of microbial genome are carried out the PCR-DGGE analysis.
Advantage of the present invention and positively effect:
The invention solves the effectively difficult problem of steady running of present chemical wastewater treatment system; Variation monitoring through biological community structure variation and function yeast; Can shift to an earlier date the Adjustment System operating parameter; Avoided after system's operation goes wrong, adjusting again, thereby the continous-stable that guarantees treatment system moves, and has practiced thrift lot of manpower and material resources.This method is used to monitor the running condition of difficult degradation wastewater from chemical industry Sewage treatment systems, easy and simple to handle fast, operation conditions that can the effective monitoring Sewage treatment systems.
Description of drawings
Fig. 1 is that the active sludge microorganism genome DNA collection of illustrative plates of each process section: M is λ-Hind III digest DNA Marker; 1-4: anaerobism section, anoxic section, CBR (in Aerobic Pond, adding filler), aerobic section.
Fig. 2 is that PCR-DGGE optimizes collection of illustrative plates: A figure is the optimization of primer; B figure is the optimization of time; C figure is the optimization of denaturing agent scope, and left figure denaturing agent scope is 40%～60%, and right figure denaturing agent scope is 30%～70%.
Fig. 3 is the PCR-DGGE collection of illustrative plates of normal operational system: 1-4: anaerobism section, anoxic section, CBR (in Aerobic Pond, adding filler), aerobic section.
Fig. 4 is that the community succession patterns of normal operational system: A1, A2, O1, O2 are respectively anaerobism section, anoxic section, CBR (in Aerobic Pond, adding filler), aerobic section.
Fig. 5 is that random primer amplified production electrophoretogram: Lane1,14,23 is λ-Hind III digest DNA Marker; Lane2,6,10,15,19 is E.coli DH5 α; Lane3,7,11,16,20 is HK1; Lane4,8,12,17,21 is HK2; Lane5,9,13,18,22 is HK3; Lane2-5 is primer S21; Lane6-9 is primer S22; Lane10-13 is primer S23; Lane15-18 is primer S24; Lane19-22 is primer S25.
Fig. 6 is the specific sequence of bacterial strain HK1.
Embodiment
Embodiment 1:
Through concrete application example, the chemical wastewater treatment system is described below
Biological activity early warning marking method, specific as follows:
1, the extraction of the total DNA of microbial genome and bacterial screening, evaluation in the active sludge of comprehensive each process section of chemical industry Waste Water Treatment.
(1) extraction of total DNA
The active sludge sample picks up from hydrolysis acidification pool, anoxic pond and the Aerobic Pond of Hangu, Binhai New Area in Tianjin industrial park sewage work.Extract genome according to following method behind the sample collecting: 1. sample pretreatment: measure the active sludge sample of 30mL, 10000rpm, 4 ℃ of centrifugal 5min abandon supernatant.The TENP buffer of adding 100mL in the deposition (50mM Tris, 20mM EDTA, 100mM NaCl, 1%PVP pH=10), adds the granulated glass sphere (diameter 6mm) of 4 sterilizations, vortex vibration 2min, the same centrifugally operated is abandoned supernatant.The saline water that adds 100mL, washed twice.2. lysis: pretreated mud sample is taken by weighing pack into the EP pipe of 1.5mL of 0.2g respectively, add Extraction Buffer (100mM Tris, the 100 mM EDTA of 600uL; 200 mM NaCl, 2%CTAB, pH8.0); Vortex vibration 5min adds SDS Buffer (Tris of 100mM, the NaCl of 200mM of 600uL again; 2%SDS, pH8.0), 5min turns upside down.3. multigelation: the EP pipe is put into-80 ℃ of refrigerator 15min, and 50 ℃ of water-bath 2min repeat 3 times.4. Deproteinization: add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) extracting albumen is not till have egg white layer and occur; Draw supernatant and add new EP pipe, add isopyknic chloroform: primary isoamyl alcohol (24:1) is removed residual phenol, 15000rpm; 3min draws supernatant.5. DNA separation and purification: add isopyknic isopropanol precipitating DNA, 15000rpm, 6min; Abandon supernatant, 70% washing with alcohol that adds 500mL in the deposition is dry, and deposition is dissolved in the TE buffer of 40uL, and (pH 8.0; 10mM Tris-Cl (pH8.0); 1mM EDTA (pH8.0)), the quality and the integrity of 0.7% detected through gel electrophoresis genomic dna ,-20 ℃ of preservations are subsequent use.Can find out that by Fig. 1 active sludge microorganism genome DNA size is about 23kb, extract more completely that quality is better.
(2) screening of bacterial classification, evaluation
The method of gradient dilution, spread plate is carried out separation and purification to the bacterium in the active sludge.Get 200 μ L diluent applying solid LB (peptone 10 g/L, yeast powder 5 g/L, NaCl 5g/L, agar powder 1.2%) flat boards, be inverted overnight cultures for 37 ℃.Each bacterium colony that form on the flat board is different separation of ruling repeatedly is until obtaining single bacterium.After dilution was coated with flat board, the quantity of dull and stereotyped last three kinds of bacterium was more, respectively called after HK1, HK2, HK3.
DNA of bacteria extracts the little extraction reagent kit of genomic dna that adopts Beijing hundred Imtech.
Use the increase 16S rDNA of each bacterial strain of bacterial 16 S rDNA universal primer 27F (5 ' AGAGTTTGATCTGGCTCAG-3 ') and 1501R (5'-AAGGAGGTGATCCAGCC-3').Pcr amplification system (50 μ L): 10 * Buffer (contains Mg
2+) 5 μ L, 10 mM dNTP, 4 μ L, the Taq enzyme 1 μ L of 5 U/ μ L, 10 mM upstream primers, 2.5 μ L, 10 mM downstream primers, 2.5 μ L, ddH
2O 34 μ L, template DNA 1 μ L.The PCR reaction conditions is: 95 ℃ of 5min; 95 ℃ of 30 s, 55 ℃ of 30s, 72 ℃ of 90s, totally 30 circulations; 72 ℃ of 10min.Through identifying that HK1 does
Pseudomonas putida, 20h is interior to be 96% to 300mg/L toluene degradation rate.HK2 does
EnterobacterSp., the degrading aniline rate to 250mg/L is 99.03% in the 15h.HK3 is Alpha proteobacterium, and 5 days is 51% to 30mg/L anthracene degradation rate.
2, screening PCR-DGGE primer: be respectively V3 district, V6-V8 district, V9 district universal primer, and optimize denaturing agent scope and electrophoresis time.
Select different PCR-DGGE primers respectively for use: V3 district, V6-V8 district, V9 district universal primer; At 160V; In the time of 60 ℃, the denaturing agent scope is 40%-60%, and electrophoresis 3.5h carries out DGGE to the PCR product and analyzes; Confirm V6-V8 district universal primer for being fit to the best primer of this system's waste water, see shown in the A figure of Fig. 2; Use V6-V8 district universal primer, at 160V, in the time of 60 ℃, the denaturing agent scope is 40%-60%, appearance on different time respectively, and electrophoresis time is 3h, 3.5h, 4h confirms that electrophoretic Best Times is 4h, shown in the B that sees Fig. 2 schemes; When using V6-V8 district universal primer, optimize the denaturing agent scope, confirm that the denaturing agent scope of the best is 30%-70%, shown in the C that sees Fig. 2 schemes with electrophoresis time 4h.Through screening PCR-DGGE primer, optimization denaturing agent scope and electrophoresis time, the PCR-DGGE top condition of confirming wastewater from chemical industry is 160V, 60 ℃, and electrophoresis 4h, the denaturing agent scope is 30%-70%.
3, with the V6-V8 district of the total DNA of V6-V8 district universal primer amplification microbial genome of bacterial 16 S rDNA.
The PCR reaction is 50 μ L systems: 10 * PCR buffer (contains Mg
2+2.5 mmol/L) 5 μ L; DNTPs (2.5 mmol/L) 5 μ L; Upstream primer V6-8F-GC (20 mmol/L) 1 μ L; Downstream primer V6-8R (20 mmol/L) 1 μ L; Template DNA 1～10 ng; Taq enzyme 0.5 μ L; Add ultrapure water to 50 μ L at last.The PCR program is Touchdown PCR:94 ℃ of preparatory sex change 5 min; 94 ℃ of sex change 1 min, 65 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, and per afterwards two circulations reduce by 1 ℃, totally 20 circulations; 94 ℃ of sex change 1 min, 55 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, totally 15 circulations; Last 72 ℃ are extended 10 min.
4, the PCR product in the V6-V8 district of the total DNA of microbial genome is carried out PCR-DGGE and analyze, set up the community succession patterns under the normal operational system, and the band of represent dominant bacteria is carried out sequencing analysis, the standard diagram that normally moves as system.
Gum concentration is that 6% (acrylic amide: methylene diacrylamide=37.5:1), the denatured gradient scope was 30%～70% (containing the urea of 7 mol/L and 40% deionized formamide in 100% the denaturing agent).1 * TAE (20 mM Tris, 10 mM glacial acetic acids, 0.5 mM EDTA, pH7.4) in the damping fluid, 60 ℃, 160V moves 4 h.After electrophoresis finished, to gel-colored 15min, 3min decoloured with the EB solution of 1mg/L.With gel imaging system gel is analyzed, the gained image carries out analyzing and processing with Bio-Rad Quantity One software, draws the similarity matrix of each reaction tank mikrobe of system, sees shown in Figure 3ly, is the DGGE collection of illustrative plates under the normal operational system.Through SPSS software the similarity matrix of each reaction tank mikrobe is analyzed, set up community succession patterns, see shown in Figure 4.
5, find the DGGE band that carrying capacity is bigger in community succession through the analysis of PCA carrying capacity, these bands play an important role in community succession, are the operating functional microbials of system, and it is identified; The bacterial strain that screens in the integrating step (1) simultaneously finds in the system to change closely-related bacterial strain with COD, and this bacterial strain can be used for judging running situation;
Detect the degradation efficiency of COD in each reaction tank of industrial park, Hangu sewage work every day; Simultaneously it being carried out PCR-DGGE analyzes; Find out band brightness flop and the relevant band of COD degradation efficiency variation in the DGGE collection of illustrative plates, the dna sequence dna that from these bands, obtains just can be used for following the tracks of and detection and the COD of system and remove the relevant microbial population of efficient.Bacterial classification in the Sewage treatment systems has been carried out the separation and purification evaluation; Screen 3 strain bacterium; Be respectively HK1, HK2, HK3, itself and the total DNA of microbial genome carried out PCR-DGGE analyze, obtaining HK1, HK2, HK3 is the bacterial classification of system and the position of existence thereof; The brightness flop of finding HK1 is relevant with the variation of O pond COD degradation efficiency, explains that this bacterium is the relevant population of O pond COD removal ability.This bacterium has the potentiality that system running state is monitored.
6, use the RAPD technology to obtain the specific molecular marker gene of bacterial strain pure culture bacterial strain, through the PCR of function yeast specific molecular marker gene, directly the arbitration functions bacterium have a situation, Sewage treatment systems is monitored.
The concrete operations step of said step 6 is: use 10 base random primer A series (S21-S40) and C series (S61-S80) totally 40 random primers functional bacterial classification HK1, HK2, HK3 in the system are carried out the RAPD analysis.40 all primers all have amplification in four bacterial strains, clip size is between 0.1～0.7kb.Wherein there are 32 primer amplifications to go out special dna fragmentation, promptly have polymorphum.It is clear to choose 20 banding patterns, and has the primer of specific amplification products band, carries out repeated experiment, and the repeatability of master tape is 93%.Wherein primer S22, S24, S25 have the specific amplification band respectively in HK1, HK2, HK3.With special degree difference called after HK1-S22, HK2-S24, HK3-S25, and measure its 16S rDNA sequence.The gene fragment of HK1 does not obtain the gene fragment similar with it in NCBI, explain that this fragment possibly be suitable as the exceptional function marker gene of this bacterial strain in Sewage treatment systems.RAPD sees shown in Figure 5 to the analysis of HK-1, HK-2, HK-3.
The RAPD mark is converted into sequence-specific molecule marker: according to the gene order of the HK1-22 that obtains, use Oligo 6.0 design primers, the RAPD mark is converted into sequence-specific molecule marker, the specificity of this primer is strengthened.Upstream primer HK1U:TGCCGAGCTGCATGATTTTAAACGG; Downstream primer HK1F:GCTGGAATGGGCGAATTCGTCTTTT.
The specificity check of primer: this primer shows the specificity to HK-1; With the active sludge genomic dna in industrial park, Hangu Sewage treatment systems Aerobic Pond, chemosynthesis pharmacy waste water treatment system, simulation alkaline sewage treatment system, the domestic sewage processing system; With this mark Waste Water Treatment and pure growth are carried out the pcr amplification detection, confirm the specificity of mark.The PCR detected result shows only just can amplify the fragment consistent with contrasting the purifying clip size in containing the sample of HK-1; And do not contain not amplification in the sample of HK-1 at other; The result shows that this primer has stable specificity to HK-1, and the specific sequence of HK-1 is seen shown in Figure 6.
Auele Specific Primer through HK-1 directly detects HK-1 in the system, finds the minimizing along with HK-1 quantity, and the removal efficient of system COD decreases; Through in system, adding HK-1, recover gradually in the removal efficient of the constant next system COD of situation of other operating parameters.
Claims (5)
1. biological activity early warning marking method that is used for chemical wastewater treatment is characterized in that this method comprises:
(1) the total DNA of microbial genome in the active sludge in each reaction tank of extraction Sewage treatment systems identifies through the method strain screening of enrichment culture and to it simultaneously;
(2) screening PCR-DGGE primer: be respectively V3 district, V6-V8 district, V9 district universal primer, and optimize denaturing agent scope and electrophoresis time;
(3) with the V6-V8 district of the total DNA of V6-V8 district universal primer amplification microbial genome of bacterial 16 S rDNA;
(4) the PCR product is carried out PCR-DGGE and analyze, and the band in the collection of illustrative plates is carried out sequencing analysis;
(5) find the bigger DGGE band of carrying capacity through the analysis of PCA carrying capacity, the mikrobe of these band representatives is the operating functional microbials of system, and it is identified; The bacterial strain that screens in the integrating step (1) simultaneously finds in the system to change closely-related bacterial strain with COD, and this bacterial strain can be used in the judgement running situation;
(6) use the RAPD technology to obtain the specific molecular marker gene of bacterial strain pure culture bacterial strain, through the PCR of function yeast specific molecular marker gene, directly the arbitration functions bacterium have a situation, Sewage treatment systems is monitored.
2. method according to claim 1 is characterized in that the process for extracting of the described genome DNA of step (1) is:
1. sample pretreatment: measure the 30mL active sludge sample in each reaction tank respectively, 10000rpm, 4 ℃ of centrifugal 5min abandon supernatant; The TENP buffer that adds 100mL in the deposition, TENP buffer consists of 50mM Tris, 20mM EDTA, 100mM NaCl, 1%PVP and pH=10, adds the granulated glass sphere of 4 sterilizations, vortex vibration 2min, the same centrifugally operated is abandoned supernatant; The saline water that adds 100mL, washed twice;
2. lysis: pretreated mud sample is taken by weighing pack into the EP pipe of 1.5mL of 0.2g respectively; The Extraction Buffer that adds 600uL; Extraction Buffer consists of 100mM Tris, 100 mM EDTA, 200 mM NaCl, 2%CTAB and pH8.0, and vortex vibration 5min adds the SDS Buffer of 600uL again; The Tris that consists of 100mM of SDS Buffer, NaCl, 2%SDS and the pH8.0 of 200mM, 5min turns upside down;
3. multigelation: the EP pipe is put into-80 ℃ of refrigerator 15min, and 50 ℃ of water-bath 2min repeat 3 times;
4. Deproteinization: add isopyknic phenol: chloroform: the solution extracting albumen of primary isoamyl alcohol=25:24:1 is not till have egg white layer and occur; Draw supernatant and add new EP pipe, the solution that adds isopyknic chloroform: primary isoamyl alcohol=24:1 is removed residual phenol, 15000rpm; 3min draws supernatant;
5. DNA separation and purification: add isopyknic isopropanol precipitating DNA, 15000rpm, 6min; Abandon supernatant, 70% washing with alcohol that adds 500mL in the deposition is dry, deposition is dissolved in the TE buffer of 40uL; TE buffer consists of pH=8.0; The Tris-Cl of 10mM pH8.0, the EDTA of 1mM pH8.0 ,-20 ℃ of preservations are subsequent use.
3. method according to claim 1 is characterized in that the described PCR program of step (3) is:
The PCR reaction is 50 μ L systems, consists of: contain 2.5 mM Mg
2+10 * PCR buffer, 5 μ L; 2.5 the dNTPs 5 μ L of mM; The upstream primer V6-8F-GC 1 μ L of 20 mM; The downstream primer V6-8R 1 μ L of 20 mM; Template DNA 1～10 ng; Taq enzyme 0.5 μ L; Add ultrapure water to 50 μ L at last;
The PCR program is Touchdown PCR:94 ℃ of preparatory sex change 5 min; 94 ℃ of sex change 1 min, 65 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, and per afterwards two circulations reduce by 1 ℃, totally 20 circulations; 94 ℃ of sex change 1 min, 55 ℃ of renaturation 1 min, 72 ℃ are extended 1 min, totally 15 circulations; Last 72 ℃ are extended 10 min.
4. method according to claim 1 is characterized in that the said concrete operations of step (4) are:
Gum concentration is 6%, consists of acrylic amide: methylene diacrylamide=37.5:1; The denatured gradient scope is 30%～70%, and the compound method of denaturing agent is to contain the urea of 7 mol/L and 40% deionized formamide in 100% the denaturing agent; Consisting of 20 mM Tris, 10 mM glacial acetic acids, 0.5 mM EDTA, in 1 * TAE damping fluid of pH7.4,60 ℃, 160V moves 4 h; After electrophoresis finished, to gel-colored 15min, 3min decoloured with the EB solution of 1mg/L; With gel imaging system gel is analyzed, the gained image carries out analyzing and processing with Bio-Rad Quantity One software.
5. method according to claim 1 is characterized in that the said concrete operations of step (5) are:
Use SPSS software, find the bigger DGGE band of carrying capacity through its PCA carrying capacity analysis, and molecular biology identification is carried out in its order-checking; Find out band brightness flop and the relevant band of COD degradation efficiency variation in the DGGE collection of illustrative plates, the dna sequence dna that from these bands, obtains just can be used for following the tracks of and detection and the COD of system and remove the relevant microbial strains of efficient; Obtain pure bacterial strain through the bacterial classification in the Sewage treatment systems being carried out the separation and purification evaluation, itself and the total DNA of microbial genome are carried out the PCR-DGGE analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103104070A CN102408161A (en) | 2011-10-14 | 2011-10-14 | Biological active early warning marking method for chemical industry wastewater treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103104070A CN102408161A (en) | 2011-10-14 | 2011-10-14 | Biological active early warning marking method for chemical industry wastewater treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102408161A true CN102408161A (en) | 2012-04-11 |
Family
ID=45910561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103104070A Pending CN102408161A (en) | 2011-10-14 | 2011-10-14 | Biological active early warning marking method for chemical industry wastewater treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102408161A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103215254A (en) * | 2013-04-26 | 2013-07-24 | 东华大学 | Method for extracting activated sludge sample DNA (Deoxyribonucleic Acid) in SBR (Styrene Butadiene Rubber) |
| CN103789300A (en) * | 2014-02-26 | 2014-05-14 | 济南大学 | Extraction method of metagenome DNA (deoxyribonucleic acid) in activated sludge for treating epoxypropane saponification wastewater |
| CN108866047A (en) * | 2018-08-14 | 2018-11-23 | 南京林业大学 | A kind of genome DNA extracting method based on multigelation mode |
| CN110204142A (en) * | 2019-05-08 | 2019-09-06 | 上海市政工程设计研究总院（集团）有限公司 | A kind of biological synergetic water quality detection system and its detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101140260A (en) * | 2007-10-08 | 2008-03-12 | 国家海洋环境监测中心 | PAGE analysis method of 16S-23S rRNA ISR amplified product |
| JP2008271785A (en) * | 2006-08-01 | 2008-11-13 | Kubota Corp | Method for detecting dechlorination microorganism |
-
2011
- 2011-10-14 CN CN2011103104070A patent/CN102408161A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008271785A (en) * | 2006-08-01 | 2008-11-13 | Kubota Corp | Method for detecting dechlorination microorganism |
| CN101140260A (en) * | 2007-10-08 | 2008-03-12 | 国家海洋环境监测中心 | PAGE analysis method of 16S-23S rRNA ISR amplified product |
Non-Patent Citations (1)
| Title |
|---|
| 余彬彬等: "硝基苯废水驯化过程中细菌群落结构的变化", 《浙江大学学报(理学版)》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103215254A (en) * | 2013-04-26 | 2013-07-24 | 东华大学 | Method for extracting activated sludge sample DNA (Deoxyribonucleic Acid) in SBR (Styrene Butadiene Rubber) |
| CN103789300A (en) * | 2014-02-26 | 2014-05-14 | 济南大学 | Extraction method of metagenome DNA (deoxyribonucleic acid) in activated sludge for treating epoxypropane saponification wastewater |
| CN103789300B (en) * | 2014-02-26 | 2015-08-12 | 济南大学 | A kind of extracting method of epoxy propane saponified wastewater active sludge macro genome DNA |
| CN108866047A (en) * | 2018-08-14 | 2018-11-23 | 南京林业大学 | A kind of genome DNA extracting method based on multigelation mode |
| CN110204142A (en) * | 2019-05-08 | 2019-09-06 | 上海市政工程设计研究总院（集团）有限公司 | A kind of biological synergetic water quality detection system and its detection method |
| CN110204142B (en) * | 2019-05-08 | 2023-04-18 | 上海市政工程设计研究总院（集团）有限公司 | Biological cooperative water quality detection system and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Udaiyappan et al. | Microalgae-bacteria interaction in palm oil mill effluent treatment | |
| Chu et al. | Microbial characterization of aggregates within a one-stage nitritation–anammox system using high-throughput amplicon sequencing | |
| Wang et al. | Antibiotic resistome in a landfill leachate treatment plant and effluent-receiving river | |
| Hailei et al. | Metagenomic insight into the bioaugmentation mechanism of Phanerochaete chrysosporium in an activated sludge system treating coking wastewater | |
| Fujitani et al. | Isolation of sublineage I N itrospira by a novel cultivation strategy | |
| CN101475987B (en) | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor | |
| Wang et al. | Characteristics of bacterial populations in an industrial scale petrochemical wastewater treatment plant: Composition, function and their association with environmental factors | |
| Zhang et al. | Microbial characteristics of a methanogenic phenol-degrading sludge | |
| Xiao et al. | Effect of trace hydrazine addition on the functional bacterial community of a sequencing batch reactor performing completely autotrophic nitrogen removal over nitrite | |
| CN109593868B (en) | Characteristic nucleotide sequence for detecting pseudomonas bacteria, and specific primer, kit and detection method thereof | |
| CN102408161A (en) | Biological active early warning marking method for chemical industry wastewater treatment | |
| Papadia et al. | Comparison of different pilot scale bioreactors for the treatment of a real wastewater from the textile industry | |
| US9567648B1 (en) | Detection of foaming and bulking bacteria in wastewater | |
| Molina-Munoz et al. | Effect of the concentration of suspended solids on the enzymatic activities and biodiversity of a submerged membrane bioreactor for aerobic treatment of domestic wastewater | |
| Fernandez et al. | How the bacterial community of a tannery effluent responds to bioaugmentation with the consortium SFC 500-1. Impact of environmental variables | |
| Urrea-Valencia et al. | Molecular techniques to study microbial wastewater communities | |
| Wen et al. | Performance and microbial characteristics of bioaugmentation systems for polyacrylamide degradation | |
| KR20090103345A (en) | Methods for Identification and Culture of Anaerobic Ammonium Oxidizer in Microbial Resources | |
| Kapley et al. | Genomic tools in bioremediation | |
| Baek et al. | Diversity and abundance of ammonia-oxidizing bacteria in activated sludge treating different types of wastewater | |
| CN104745684A (en) | Method for detecting community structures and abundance of nitrite oxidizing bacteria in wastewater | |
| Lin et al. | Microbial community variation and functions to excess sludge reduction in a novel gravel contact oxidation reactor | |
| Ziembinska et al. | Comparison of ammonia-oxidizing bacterial community structure in membrane-assisted bioreactors using PCR-DGGE and FISH | |
| CN110358811B (en) | Method for optimizing loop-mediated isothermal amplification reaction | |
| Khelifi et al. | Fermentative and sulphate-reducing bacteria associated with treatment of an industrial dye effluent in an up-flow anaerobic fixed bed bioreactor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120411 |