CN102399889A - Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 - Google Patents
Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 Download PDFInfo
- Publication number
- CN102399889A CN102399889A CN2011103930244A CN201110393024A CN102399889A CN 102399889 A CN102399889 A CN 102399889A CN 2011103930244 A CN2011103930244 A CN 2011103930244A CN 201110393024 A CN201110393024 A CN 201110393024A CN 102399889 A CN102399889 A CN 102399889A
- Authority
- CN
- China
- Prior art keywords
- hotairm1
- gapdh
- primer
- hotiarm1
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1. An outer side primer, an inner side primer and a fluorescent probe are designed and synthesized according a gene sequence of the long-chain non-coding RNA-HOTAIRM1 and a gene sequence of a reference gene glyceraldehyde-phosphate dehydrogenase (GAPDH), and the relative expression of HOTAIRM1 in blood plasma by utilizing the two sets of primers and the specificity of the probe. Results of study indicate that the expression of HOTAIRM1 in normal colorectal mucous tissues is positive, and the expression of HOTAIRM1 in gastric cancer tissues and blood plasma of gastric cancer patients is low. Therefore the method has an instructive significance for the further study of the expression of HOTAIRM1 in tumors and the establishment of an accurate special detection method.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of people's long-chain non-coding RNA-HOTAIRM1 detection method.
Background technology
Long-chain non-coding RNA (lncRNA) is the RNA molecule of one type of length greater than 200 Nucleotide, does not possess the transcription product of the function of coded protein; Be considered to " noise " that genome is transcribed at first, the by product that the RNA polymerase II is transcribed does not have any biological function.Yet the Mammals whole genome generally is transcribed into transcript, is the mRNA of coded protein but a very little part is only arranged in these transcripts, and major part is a non-coding RNA.Non-coding RNA comprises structure RNA (like tRNA, rRNA and snRNA), becomes the adjusting RNA (microRNA and siRNA) of research focus in recent years, and the nearest lncRNA that pays close attention to of scientific circles; LncRNA accounts for nearly 80% in these non-coding RNA transcripts; And many lncRNA have the mRNA spline structure; Has PolyA tail spline structure through shearing processing; Occur in the atomization dynamically expressing and different shear-forms, the special and special phraseology in space of the time that demonstrates, these phenomenons show that the expression of lncRNA and degraded have meticulous regulatory mechanism in vivo.Therefore; LncRNA should think deeply as the hypothesis of transcribing " noise " and by product again; LncRNA expresses not only characteristic expression in the embryonic stem cell atomization, and in brain cell, has specific Subcellular Localization, and these lncRNA express and have tissue and organ specificity simultaneously.Although sub-fraction long-chain non-coding RNA function is only arranged to be explained; But can infer that lncRNA passes through certain mechanism and participated in various biological functions, modify, transcribe with translational control and shear through epigenetics and splice performance biological actions such as controlling cell cycle, differentiation and apoptosis.Obviously; LncRNA must be closely related with the incidence and development mechanism of disease; Had at present report to show the lncRNA that there are differences expression in the tumour, for example HOTAIR expresses and raises in the mammary cancer, and MALAT crosses in expression and the liver cancer HULC level rising etc. in lung cancer and colorectal cancer.HOTAIRM1 be recent findings be positioned at HOXA1 and the intergenic long-chain non-coding RNA of HOXA2, possibly and break up relevantly with the growth of myeloid cell in the hemopoietic system, and in the tire brain, also detect and remove its expression, and participate in Neural Differentiation.
Summary of the invention
The object of the invention provides a kind of method that detects long-chain non-coding RNA-HOTAIRM1; Be to design and synthesize outside primer, inboard primer and fluorescent probe, and utilize this two cover primer and probe specificity to detect the relative expression of HOTAIRM1 in blood plasma according to the gene order of long-chain non-coding RNA-HOTAIRM1 and the gene order of internal control gene GAPDH.
The present invention adopts real time fluorescent PCR method to detect a kind of long-chain non-coding RNA-HOTAIRM1, mainly comprises specificity outside primer, inboard primer and fluorescent probe, rt reagent and fluorescent PCR reagent, realizes through following steps:
(1) adopt the RNA extraction agent to extract total RNA in tissue and the blood plasma, the DNase I adopts rt reagent to carry out the synthetic cDNA of rt after removing genomic dna;
(2) prepare reaction solution with the outside primer of HOTAIRM1 and GAPDH according to following PCR reaction system respectively: the outside upstream and downstream primer primer of 1 * PCR buffer, 0.1 μ M, the archaeal dna polymerase of 1U, the dNTPs of 0.2mM; Get the cDNA template of 2 μ L, reaction volume is 20 μ L; According to 95 ℃ of sex change 5 minutes, 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ were carried out 15 circulations amplification in advance in 30 seconds.
(3) getting the preparatory amplified production of 2.0 μ L adds in the following PCR reaction solution: 1 * TaqMan universal PC R damping fluid, and the inboard upstream and downstream primer primer of 0.2 μ M and the fluorescent probe of 0.1 μ M, reaction volume are 10 μ L; According to 95 ℃ of sex change 2 minutes, 95 ℃ 15 seconds, 60 ℃ 1 minute, 40 circulations of increasing;
(4) read the Ct value according to fluorescence curve, calculate the relative expression quantity of HOTAIRM1 according to the following equation: HOTAIRM1 relative expression quantity=2
-Δ Ct(Δ Ct=Ct
HOTAIRM1-Ct
GAPDH).
The sequence of outside primer and fluorescent probe is respectively as follows in the said specificity:
HOTAIRM1 outside primer:
outer-hotiarm1-F:?GCTGGAGCGAAGAAGAGCAA，
outer-hotiarm1-R：CAAACACCCACATTTCAACCC；
The inboard primer of HOTAIRM1:
inner-hotiarm1-F：GAACTGGCGAGAGGTCTGTTTT，
inner-hotiarm1-R：CCCCATAAATCCCTCCACATT；
The HOTAIRM1 fluorescent probe:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA。
GAPDH outside primer:
outer-gapdh-F：GGCGCTGAGTACGTCGTGGA,
outer-gapdh-R：GTGGTGCAGGAGGCATTGCTGAT；
The inboard primer of GAPDH:
inner-gapdh-F：GCGTCTTCACCACCATGGA，
inner-gapdh-R：TGGTTCACACCCATGACGAA；
The GAPDH fluorescent probe is:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA。
Wherein FAM is the fluorescence report group, and TAMRA is the fluorescent quenching group.
In order to confirm the validity and the practicality of the detection blood plasma HOTAIRM1 relative expression method that the present invention sets up, the present invention has detected HOTAIRM1 relative expression quantity in colorectal cancer patients tumor tissues and the blood plasma.The result shows that this method can detect relative expression's level of HOTAIRM1 in tissue and the blood plasma effectively; And the HOTAIRM1 level is starkly lower than normal control tissue in the colorectal cancer tumor tissues; Colorectal cancer patients blood plasma HOTAIRM1 level also is starkly lower than the normal control group; The cutoff value of HOTAIRM1 level in the blood plasma is fixed on 0.003; Then the sensitivity of its diagnosis colorectal cancer is 61.46%, and specificity is 80.30%, and the AUC value is 0.780 after the ROC tracing analysis.Low expression and the low-level HOTAIRM1 in the blood plasma that above result is illustrated in the tissue possibly become new diagnosis of colorectal carcinoma mark.
Key of the present invention is the design of inboard primer of specificity and fluorescent probe sequence, and other compositions are the conventional reagent in this area in this detection method, adopts this method that HOTAIRM1 in the blood plasma is carried out relative quantification and detects.
Method provided by the invention; Through inboard primer of design HOTAIRM1 specificity and fluorescent probe sequence; Set up detection blood plasma HOTAIRM1 relative expression method, through research, the result shows that HOTAIRM1 is normally tying the expression that is positive in the mucous membrane of rectum tissue; And in stomach organization and patients with gastric cancer blood plasma, but show as low the expression; These phenomenons show that HOTAIRM1 possibly confirm that this method has practicality and validity as the new tumor markers of diagnosis of colorectal carcinoma, to further research HOTAIRM1 in tumour expression and set up accurate special detection method and have great importance.
Description of drawings
Fig. 1 detects the fluorescence curve of GAPDH in the tissue for using this method.
Fig. 2 detects the fluorescence curve of HOTAIRM1 in the tissue for using this method.
Fig. 3 detects the fluorescence curve of GAPDH in the blood plasma for using this method.
Fig. 4 detects the fluorescence curve of HOTAIRM1 in the blood plasma for using this method.
Fig. 5 is starkly lower than the pairing healthy tissues for the expression of HOTAIRM1 in 109 routine colorectal cancer tissues,
P=0.0267.
Fig. 6 has the low expression of 43 routine cancerous tissue HOTAIRM1 in the 55 routine colorectal carcinomas, the low expression of 41 routine cancerous tissue HOTAIRM1 is arranged in the 54 routine rectum cancer.
Fig. 7 is a HOTAIRM1 level in the colorectal cancer patients blood plasma, also is starkly lower than the level with 101 routine healthy persons in 150 routine colorectal cancer patients blood plasma HOTAIRM1 levels,
P<0.001.
Fig. 8 is the ROC tracing analysis of 150 routine colorectal cancer patients and 101 routine healthy person blood plasma HOTAIRM1 levels, and the AUC value is 0.780, and critical value setting is 0.003.
Embodiment
Below in conjunction with specific embodiment the present invention is described further, but protection scope of the present invention is not limited in this.Among the present invention, the above with following embodiment in, employed technology such as PCR, RNA extractive technique are the known routine techniques of this area investigative technique personnel except that specified otherwise; Employed plant and instrument, reagent etc. are this area except that specified otherwise investigative technique personnel can obtain through public approach.
Embodiment one
The design of Auele Specific Primer and fluorescent probe is with synthetic
According to the nucleotide sequence of HOTAIRM1, adopt Primer Express
TM(V3.0, American AB I company) software analysis TaqMan primer and probe site therefrom selected best of breed.Detect following with PCR primer and probe sequence:
HOTAIRM1 outside primer:
outer-hotiarm1-F:?GCTGGAGCGAAGAAGAGCAA，
outer-hotiarm1-R：CAAACACCCACATTTCAACCC；
The inboard primer of HOTAIRM1:
inner-hotiarm1-F：GAACTGGCGAGAGGTCTGTTTT，
inner-hotiarm1-R：CCCCATAAATCCCTCCACATT；
The HOTAIRM1 fluorescent probe:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA。
GAPDH outside primer:
outer-gapdh-F：GGCGCTGAGTACGTCGTGGA,
outer-gapdh-R：GTGGTGCAGGAGGCATTGCTGAT；
The inboard primer of GAPDH:
inner-gapdh-F：GCGTCTTCACCACCATGGA，
inner-gapdh-R：TGGTTCACACCCATGACGAA；
The GAPDH fluorescent probe is:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA。
Wherein FAM is the fluorescence report group, and TAMRA is the fluorescent quenching group.More than all oligonucleotide all have Invitrogen company synthetic.
Embodiment two
RNA extracts and removes DNA in tissue and the blood plasma
1. organize RNA to extract: to organize RNA to extract and adopt Invitrogen company that TRIzol is provided reagent, operate according to the reagent specification sheets fully.Get tissue adding 1ml TRIzol reagent about 200mg, subsequent use behind chloroform extraction and the isopropanol precipitating after the use homogenizer grinds.
2. blood plasma RNA extracts: blood plasma RNA extracts and adopts Invitrogen company that TRIzol-LS is provided reagent, operates according to the reagent specification sheets fully.Get 600 μ L blood plasma and add 1.8ml TRIzol-LS reagent, subsequent use behind chloroform extraction and the isopropanol precipitating.
3. DNA removes: the RNase-Free DNase Set that total RNA of extraction adopts QIAGEN company to provide removes genomic dna, operates fully to specifications.
Embodiment three
The long-chain non-coding RNA-HOTAIRM1
Detection
1. rt: get the PrimeScript RT Reagent Kit that the total RNA of 100ng adopts TAKARA company to provide respectively and carry out reverse transcription reaction, 5 * RT buffer, 4.0 μ L; PrimeScript RT Enzyme Mix I, 1.0 μ L; Oligo dT (50uM), 1.0 μ L; Random 6 mers (100 μ M), 1.0 μ L, water complement to 20 μ L.37 ℃, 15 minutes; 85 ℃, get 2.0 μ L cDNA after 5 minutes and be used to detect HOTAIRM1.
2. the detection of HOTAIRM1 level in tissue and the blood plasma: the PCR reagent that employing TAKARA company provides is according to following preparation PCR reaction solution: the outside upstream and downstream primer primer (GAPDH or HOTAIRM1) of 1 * PCR buffer, 0.1 μ M, the archaeal dna polymerase of 1U, the dNTPs of 0.2mM; Get the cDNA template of 2.0 μ L, reaction volume is 20 μ L; At ABI2720 (ABI company) PCR appearance according to 95 ℃ of sex change 5 minutes, 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ were carried out 15 circulations amplification in advance in 30 seconds.Getting the preparatory amplified production of 2.0 μ L adds in the following PCR reaction solution that ABI company provides: 1 * TaqMan Universal Master PCR Mix; 0.2 the inboard upstream and downstream primer primer (GAPDH or HOTAIRM1) of μ M and the fluorescent probe (GAPDH or HOTAIRM1) of 0.1 μ M, reaction volume is 10 μ L; Go up according to 95 ℃ of sex change 2 minutes at ABI7900 fluorescent PCR appearance (ABI company), 95 ℃ 15 seconds, 60 ℃ 1 minute, 40 circulations of increasing.The result as depicted in figs. 1 and 2 in tissue this method can effectively detect HOTAITRM1 and the expression of GAPDH in the tissue, Fig. 1 represents the amplified fluorescence curve that detects GAPDH in the tissue, Fig. 2 represents the amplified fluorescence curve that detects HOTAITRM1 in the tissue; Equally also can detect HOTAITRM1 and GAPDH level in the blood plasma like Fig. 3 and this method shown in Figure 4, Fig. 3 represents the amplified fluorescence curve that detects GAPDH in the blood plasma, and Fig. 4 represents the amplified fluorescence curve that detects HOTAITRM1 in the blood plasma.And as shown in Figure 5 in 109 routine colorectal cancer tumor tissues the HOTAIRM1 level be starkly lower than the pairing healthy tissues,
P=0.0267; 43 examples low expression in cancerous tissue arranged in the as shown in Figure 6 55 routine colorectal carcinomas, 41 examples low expression in cancerous tissue arranged in the 54 routine rectum cancer.As shown in Figure 7ly in addition also be starkly lower than the level with 101 routine healthy persons in 150 routine colorectal cancer patients blood plasma HOTAIRM1 levels,
P<0.001; Be set at 0.003 with the threshold value of HOTAIRM1 level in the blood plasma is as shown in Figure 8, then the sensitivity of its diagnosis colorectal cancer is 61.46%, and specificity is 80.30%, and the AUC value is 0.780 after the ROC tracing analysis.
< 110>Zhejiang University
< 120>a kind of method that detects long-chain non-coding RNA-HOTAIRM1
<160>?10
<210>?1
<211>?20
<212>?DNA
< 213>people
<400>?1
GCTGGAGCGAAGAAGAGCAA?20
<210>?2
<211>?21
<212>?DNA
< 213>people
<400>?2
CAAACACCCACATTTCAACCC?21
<210>?3
<211>?22
<212>?DNA
< 213>people
<400>?3
GAACTGGCGAGAGGTCTGTTTT?22
<210>?4
<211>?21
<212>?DNA
< 213>people
<400>?4
CCCCATAAATCCCTCCACATT?21
<210>?5
<211>?25
<212>?DNA
< 213>people
<400>?5
CCTGAACCCATCAACAGCTGGGAGA?25
<210>?6
<211>?20
<212>?DNA
< 213>people
<400>?6
GGCGCTGAGTACGTCGTGGA?20
<210>?7
<211>?23
<212>?DNA
< 213>people
<400>?7
GTGGTGCAGGAGGCATTGCTGAT?23
<210>?8
<211>?19
<212>?DNA
< 213>people
<400>?8
GCGTCTTCACCACCATGGA?19
<210>?9
<211>?20
<212>?DNA
< 213>people
<400>?9
TGGTTCACACCCATGACGAA?20
<210>?10
<211>?25
<212>?DNA
< 213>people
<400>?10
CCTGAACCCATCAACAGCTGGGAGA?25
Claims (2)
1. method that detects long-chain non-coding RNA-HOTAIRM1, realize through following steps:
(1) adopt the RNA extraction agent to extract total RNA in tissue and the blood plasma, the DNase I adopts rt reagent to carry out the synthetic cDNA of rt after removing genomic dna;
(2) prepare reaction solution with the outside primer of HOTAIRM1 and GAPDH according to following PCR reaction system respectively: the outside upstream and downstream primer primer of 1 * PCR buffer, 0.1 μ M, the archaeal dna polymerase of 1U, the dNTPs of 0.2mM; Get the cDNA template of 2 μ L, reaction volume is 20 μ L; According to 95 ℃ of sex change 5 minutes, 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ were carried out 15 circulations amplification in advance in 30 seconds;
(3) getting the preparatory amplified production of 2.0 μ L adds in the following PCR reaction solution: 1 * TaqMan universal PC R damping fluid; 0.2 the inboard upstream and downstream primer primer of μ M and the fluorescent probe of 0.1 μ M; Reaction volume is 10 μ L; According to 95 ℃ of sex change 2 minutes, 95 ℃ 15 seconds, 60 ℃ 1 minute, 40 circulations of increasing;
(4) read the Ct value according to fluorescence curve, calculate the relative expression quantity of HOTAIRM1 according to the following equation: HOTAIRM1 relative expression quantity=2
-Δ Ct(Δ Ct=Ct
HOTAIRM1-Ct
GAPDH);
The sequence of outside primer and fluorescent probe is respectively as follows in the said specificity:
HOTAIRM1 outside primer:
outer-hotiarm1-F:?GCTGGAGCGAAGAAGAGCAA，
outer-hotiarm1-R：CAAACACCCACATTTCAACCC；
The inboard primer of HOTAIRM1:
inner-hotiarm1-F：GAACTGGCGAGAGGTCTGTTTT，
inner-hotiarm1-R：CCCCATAAATCCCTCCACATT；
The HOTAIRM1 fluorescent probe:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA
GAPDH outside primer:
outer-gapdh-F：GGCGCTGAGTACGTCGTGGA,
outer-gapdh-R：GTGGTGCAGGAGGCATTGCTGAT；
The inboard primer of GAPDH:
inner-gapdh-F：GCGTCTTCACCACCATGGA，
inner-gapdh-R：TGGTTCACACCCATGACGAA；
The GAPDH fluorescent probe is:
hotiarm1-probe:?FAM-CCTGAACCCATCAACAGCTGGGAGA-TAMRA。
2. a kind of method that detects long-chain non-coding RNA-HOTAIRM1 according to claim 1 is characterized in that FAM is the fluorescence report group, and TAMRA is the fluorescent quenching group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103930244A CN102399889A (en) | 2011-12-01 | 2011-12-01 | Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103930244A CN102399889A (en) | 2011-12-01 | 2011-12-01 | Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102399889A true CN102399889A (en) | 2012-04-04 |
Family
ID=45882532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103930244A Pending CN102399889A (en) | 2011-12-01 | 2011-12-01 | Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102399889A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146693A (en) * | 2013-02-26 | 2013-06-12 | 中南大学 | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof |
| CN103160580A (en) * | 2013-02-26 | 2013-06-19 | 中南大学 | Application method of long-chain non-coding ribonucleic acid (RNA) gene |
| CN103952474A (en) * | 2014-03-27 | 2014-07-30 | 南京市第一医院 | Esophageal carcinoma (EC) diagnosis marker and application method thereof |
| CN103952476A (en) * | 2014-03-27 | 2014-07-30 | 南京市第一医院 | Detection and application of long non-coding RNA |
| CN105886509A (en) * | 2016-06-17 | 2016-08-24 | 中南大学 | Application of long no-coding RNA ENST00000429456 |
| CN111500734A (en) * | 2020-05-28 | 2020-08-07 | 南通大学 | Liver cancer diagnosis marker and application thereof |
-
2011
- 2011-12-01 CN CN2011103930244A patent/CN102399889A/en active Pending
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146693A (en) * | 2013-02-26 | 2013-06-12 | 中南大学 | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof |
| CN103160580A (en) * | 2013-02-26 | 2013-06-19 | 中南大学 | Application method of long-chain non-coding ribonucleic acid (RNA) gene |
| CN103146693B (en) * | 2013-02-26 | 2014-07-09 | 中南大学 | Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof |
| CN103160580B (en) * | 2013-02-26 | 2014-12-24 | 中南大学 | Application method of long-chain non-coding ribonucleic acid (RNA) gene |
| CN103952474A (en) * | 2014-03-27 | 2014-07-30 | 南京市第一医院 | Esophageal carcinoma (EC) diagnosis marker and application method thereof |
| CN103952476A (en) * | 2014-03-27 | 2014-07-30 | 南京市第一医院 | Detection and application of long non-coding RNA |
| CN103952476B (en) * | 2014-03-27 | 2018-05-15 | 南京市第一医院 | A kind of detection and application of long-chain non-coding RNA |
| CN103952474B (en) * | 2014-03-27 | 2018-05-15 | 南京市第一医院 | A kind of esophagus cancer diagnosis marker and its application method |
| CN105886509A (en) * | 2016-06-17 | 2016-08-24 | 中南大学 | Application of long no-coding RNA ENST00000429456 |
| CN105886509B (en) * | 2016-06-17 | 2018-09-25 | 中南大学 | The application of long-chain non-coding RNA ENST00000429456 |
| CN111500734A (en) * | 2020-05-28 | 2020-08-07 | 南通大学 | Liver cancer diagnosis marker and application thereof |
| CN111500734B (en) * | 2020-05-28 | 2023-04-07 | 南通大学 | Liver cancer diagnosis marker and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schaefer et al. | MicroRNAs and cancer: current state and future perspectives in urologic oncology | |
| CN102399889A (en) | Method for detecting long-chain non-coding ribonucleic acid (RNA)-HOTAIRM1 | |
| Lanza et al. | mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer | |
| Yan et al. | Circulating miRNAs as biomarkers for oral squamous cell carcinoma recurrence in operated patients | |
| Li et al. | Identification of new aberrantly expressed miRNAs in intestinal-type gastric cancer and its clinical significance | |
| CN102439169B (en) | Compositions and methods for micro-rna expession profiling of colorectal cancer | |
| Tsai et al. | Epigenetic regulation of miR‐34b and miR‐129 expression in gastric cancer | |
| Khella et al. | Exploring the role of miRNAs in renal cell carcinoma progression and metastasis through bioinformatic and experimental analyses | |
| Babu et al. | A miR-centric view of head and neck cancers | |
| Nurul-Syakima et al. | Differential microRNA expression and identification of putative miRNA targets and pathways in head and neck cancers | |
| Qin et al. | The tumor cytosol miRNAs, fluid miRNAs, and exosome miRNAs in lung cancer | |
| Silahtaroglu et al. | MicroRNAs, epigenetics and disease | |
| Tan et al. | Screening of differentially expressed microRNA in ulcerative colitis related colorectal cancer | |
| Molnár et al. | Changes in miRNA expression in solid tumors: an miRNA profiling in melanomas | |
| CN101824464A (en) | Application of miRNA (Micro-Ribonucleic Acid) expression profile in predicting sensibilities of lung cancer patients to radiotherapy | |
| WO2013038737A1 (en) | Method for detecting bladder cancer cells, primer used in method for detecting bladder cancer cells, and bladder cancer marker | |
| Świtlik et al. | Forms of diagnostic material as sources of miRNA biomarkers in hepatocellular carcinoma: a preliminary study | |
| Ghanbari et al. | Expression Analysis of Previously Verified Fecal and Plasma Down-regulated MicroRNAs (miR-4478, 1295-3p, 142-3p and 26a-5p), in FFPE Tissue Samples of CRC Patients. | |
| Dillhoff et al. | MicroRNAs in solid tumors | |
| CN105802964A (en) | cRNA-FUT8 detection applied to hepatocellular carcinoma screening and application thereof | |
| CN101798599A (en) | Purpose of hsa-miR-150 | |
| EP2657354A1 (en) | Microrna expression signature in peripheral blood of patients affected by hepatocarcinoma or hepatic cirrhosis and uses thereof | |
| Mahmoudian-Sani et al. | The role of microRNAs in human cancers | |
| CN106167822A (en) | A kind of long-chain non-coding RNA and application thereof | |
| CN101880707A (en) | Application of microRNA-21 in identifying pancreatic cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120404 |