CN102399884A - Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli - Google Patents
Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli Download PDFInfo
- Publication number
- CN102399884A CN102399884A CN2011103761585A CN201110376158A CN102399884A CN 102399884 A CN102399884 A CN 102399884A CN 2011103761585 A CN2011103761585 A CN 2011103761585A CN 201110376158 A CN201110376158 A CN 201110376158A CN 102399884 A CN102399884 A CN 102399884A
- Authority
- CN
- China
- Prior art keywords
- standard substance
- fluorescent quantitative
- pcr
- quantitative pcr
- quadruple
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic Escherichia coli. The quadruple fluorescent quantitative PCR detection kit consists of fluorescent quantitative PCR reaction liquid, a standard substance O157, a standard substance H7, a standard substance O104, a standard substance H4 and a reference substance, wherein the fluorescent quantitative PCR reaction liquid comprises PCR reaction buffer solution (which contains a mixture of magnesium chloride and deoxyribose nucleotide triphosphate, heat-resisting thermus aquaticus deoxyribonucleic acid (TaqDNA) polymerase and the like), special upstream and downstream primers and a probe. In the quadruple fluorescent quantitative PCR detection kit, O157:H7 and O 104:H4 type bacteria of the diarrheagenic Escherichia coli can be detected from a sample; and compared with the conventional ordinary PCR method and single fluorescent quantitative PCR method, the quadruple fluorescent quantitative PCR detection kit has the advantages of simplicity, convenience, quickness and accuracy; and the detected bacteria are quantitated accurately in real time, and the diagnosis of suspected patients infected with the bacteria clinically is clarified early, so that the treatment scheme is formulated in time to lower the death rate.
Description
Technical field
The invention belongs to biological technical field; The nucleic acid detection method that relates to diarrheagenic E. coli O157:H7, O104:H4 serotype in a kind of quadruple real-time fluorescence quantitative PCR detects the gastro-enteritis diarrhea patient simultaneously in same reaction tubes the stool sample can be applicable to diarrheagenic E. coli and causes that the laboratory of breaking out epidemic situation is emergent and detect.
Background technology
The intestinal bacteria that cause diarrhoea are called diarrheagenic E. coli; According to virulence factor, pathogenesis and epidemiologic feature; Usually diarrheagenic E. coli is divided into 5 types, is respectively enteropathogenic Escherichia coli (EPEC), enterotoxigenic E.Coli (ETEC), enteroinvasive E.Coli (EIEC), intestines concentration intestinal bacteria (EAEC) and EHEC (EHEC).After EHEC infected, the patient tends to occur: hemorrhagic enteritis showed as diarrhoea (bloody stool, blood appearance), stomachache and hemolytic uremic syndrome (HUS).HUS shows as renal failure, hemolytic anemia, thrombopenia, thrombus property thrombopenia purpura (TTP), can be impaired and dead because of renal failure and many internal organs, and mortality ratio reaches 3%-5%, and nearly 30% patient can stay serious sequela.O157:H7 is the main serotype of EHEC, and ground such as China Su Wan had broken out Escherichia coli O 157 in 1999: the H7 infectious diarrhea, estimate that 20,000 people infect.The German epidemic situation of breaking out was to be caused by EHEC O104:H4 serotype in 2011, death 24 examples, wherein women's 15 examples.Except that Germany, cases of infection have also been reported Introduced cases EHEC by 15 countries such as Austria, Czech, Denmark, France, Holland, Norway, Spain, Sweden, Switzerland, Britain, Luxembourg, the U.S., Canada, and part develops into hemolytic uremic syndrome.
Grow with each passing day in view of the importance of diarrheagenic E. coli in public health, thereby in gastro-enteritis and food poisoning monitoring, will carry out the detection of multiple diarrhoea bacterium, not only waste time and energy but also waste clinical samples and reagent.Conventional sense is main with traditional cultural method, not only complex operation, length consuming time but also pollution easily.Therefore, setting up a kind of technology that can rapid detection goes out diarrheagenic E. coli has great importance to China's reply potential diarrheagenic E. coli epidemic situation.
Along with the develop rapidly of Protocols in Molecular Biology and the widespread use in medical research thereof; The fluorescent quantitative PCR technique that particularly rises recent years; This method has characteristics such as accuracy height, favorable reproducibility, has been widely used in numerous areas such as gene expression research, pathogen detection, snp analysis and gene type.This method adopts complete stopped pipe to detect, and has saved the product postprocessing to PCR, has avoided crossed contamination, and the result judges by the computingmachine completion, simplified operation steps, and strengthened result's safety.Development along with fluorescent quantitation technology, instrument and Materials science; The fluorescent quantitation technology is its advantage of performance on quantitatively not only, and different fluorescent dye (FAM, HEX etc.) technology can be carried out aspect researchs such as gene type, detection in Gene Mutation and snp analysis on the 5` end mark of utilization TaqMan or TaqMan-MGB probe.Therefore, foundation is particularly important about quick, accurate, sensitive, special the gene diagnosis molecular biology method and the diagnostic kit of the multiple fluorescence quantitative PCR of O104:H4 and O157:H7 diarrheagenic E. coli.
Summary of the invention
The purpose of this invention is to provide and a kind ofly rush down Escherichia coli O 157 to causing: H7, O104:H4 quadruple fluorescent quantificationally PCR detecting kit and detection method.This test kit is made up of fluorescence quantitative PCR reaction solution, O157 standard substance, H7 standard substance, O104 standard substance, H4 standard substance, reference substance; Wherein fluorescence quantitative PCR reaction solution includes PCR reaction buffer (containing magnesium chloride and triphosphate deoxyribose nucleotide mixture, heat-resisting Taq archaeal dna polymerase etc.), specificity upstream and downstream primer and probe, and wherein specificity upstream and downstream primer, specific probe and gene standard substance sequence are respectively as follows:
O157 upstream primer-F:5 '-TGGCATGACGTTATAGGCTACAAT-3 '
O157 downstream primer-R:5 '-AGCTTGTTCTAACTGGGCTAATCCT-3 '
O157 specific probe-P:5 '-FAM-ATAGGATGACAAATATCTGCGCTGCT-BHQ1-3 '
H7 upstream primer-F:5 '-GGCGCAGGCTGCTGATT-3 '
H7 downstream primer-R:5 '-AGCTTCAAAACGTGATGCGTTAGCTG-3 '
H7 specific probe-P:5 '-HEX-CAGATTTACCCACATCAGCATG-BHQ1-3 '
O104 upstream primer-F:5 '-AGGAGTAAACAATGTCAAAGCAAC-3 '
O104 downstream primer-R:5 '-AAAATCCTTTAAACTATACGCCC-3 '
O104 specific probe-P: 5 '-ROX-ACTTGGTTTTTTTGTATTAGCAATAAGTGGTG-BHQ2-3 '
H4 upstream primer-F:5 '-GCTGGGGGTAAACAAGTCAA-3 '
H4 downstream primer-R:5 '-CAGAATCAACGACCGCATATT-3 '
H4 specific probe-P: 5 '-CY5-TGTCTTACACTGACACCGCGTCTAACA-BHQ3-3 '
O157 gene standard substance:
TGGCATGACG?TTATAGGCTA?CAATTATAGG?ATGACAAATA?TCTGCGCTGC?TATAGGATTA GCCCAGTTAG AACAAGCT
H7 gene standard substance:
GGCGCAGGCT?GCTGATTCAG?CTTCAAAACG?TGATGCGTTA?GCTGCCACCC?TTCATGCTGA TGTGGGTAAA TCTGTT
O104 gene standard substance:
TGTCGCGCAA AGAATTTCAA?CTTTACTTGG TTTTTTTGTA TTAGCAATAA GTGGTGTCAT TTCAAGTCAG GTTTCTAGGG CGTATAGTTT?AAAGGATTTT
H4 gene standard substance:
GCTGGGGGTA?AACAAGTCAA?TTTACTGTCT?TACACTGACA?CCGCGTCTAA?CAGTACTAAA TATGCGGTCG TTGATTCTG
Standard substance divide negative reference substance and positive reference substance, and the negative control article are autoclaved DEPC (diethylpyrocarbonate) treating water, and positive reference substance is the positive plasmid sample of O157, H7, O104 and H4.
Quantification kit provided by the invention is stored in-20 ℃, reduces multigelation as far as possible.
Test kit method of use of the present invention is following:
1. testing sample nucleic acid extraction: can be undertaken by ordinary method, as adopt DNA Mini Kit or other test kit of German QIAGEN company, extract according to the test kit specification sheets;
2. the detection of nucleic acid: with testing sample DNA is template; The PCR damping fluid is a HR Qpcr Master Mix damping fluid; Its final concentration is 1 *, be meant that each component concentrations is identical in the final concentration of each component of damping fluid in reaction system and the 1 * HR Qpcr Master Mix damping fluid.Usually adopt 2 * HR Qpcr Master Mix damping fluid of reaction system 1/2 volume.The composition of 1 * HR Qpcr Master Mix damping fluid is referring to the HR Qpcr Master Mix of the farsighted bio tech ltd of Shanghai brightness, Code:HR-RT01-50.
The reaction TV be 50
; 2 * qPCR Master Mix25
wherein; Each 1
of four kinds of primers (20 μ mol/L); Four kinds of probes (20 μ mol/L), 1
; Template DNA 2-3
, DEPC water supply 50
.On four look quantitative real time PCR Instruments, detect, reaction parameter is: 95 ℃ of 5min warm starts, and 95 ℃ of 10s then, 55 ℃ of 45s carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether.
3. fluorescent quantitation result report:
1. cause and rush down Escherichia coli O 157, H7, O104 and H4 probe CT value (threshold cycle separately; The cycle number that fluorescent signal in each reaction tubes is experienced when reaching the thresholding of setting) it is negative to be equal to 40.0 sample; 2. cause the sample that rushes down each probe CT value≤35 of Escherichia coli O 157, H7, O104 and H4; Detected result is corresponding positive for bacteria; Then testing sample contains to cause and rushes down Escherichia coli O 157, H7, O104 and H4 type, the fluoroscopic examination result occurs like one of them and is positive, and contains the corresponding target bacteria of positive fluorescence in the sample then to be checked.3. the CT value is ash value zone between 35～40, and the back of reforming is negative greater than 37 values.According to the typical curve that is obtained, calculate (the copy number/ml) of bacterium value in the sample to be measured.
Innovation part of the present invention is: utilization real-time fluorescence quantitative PCR technology, adopt bacterium special primer and specific fluorescence probe, and development is used to cause rushes down Escherichia coli O 157: H7, O104:H4 crowd bacterium quadruple fluorescence quantitative detection kit.This invention is through a PCR reaction; Can from sample, detect to cause and rush down Escherichia coli O 157: the existence of H7 and O104:H4 type bacterium; Easier than traditional regular-PCR and substance fluorescence quantifying PCR method, fast and accurately, and the bacterium that detects carried out in real time accurately quantitatively, the patient who infects for doubtful this bacterium clinically clarifies a diagnosis in early days; So that in time formulate regimen, reduce mortality ratio.
Description of drawings
Fig. 1, fluorescent PCR method detect and cause the sensitivity of rushing down Escherichia coli O 157; From 1 to 5 be followed successively by 1000000,100000,10000,1000,100copy.
Fig. 2, cause and rush down Escherichia coli O 157 standard substance quantitative fluorescent PCR typical curve.
Fig. 3, fluorescent PCR method detect and cause the sensitivity of rushing down intestinal bacteria H7; From 1 to 5 be followed successively by 1000000,100000,10000,1000,100copy.
Fig. 4, cause and rush down intestinal bacteria H7 standard substance quantitative fluorescent PCR typical curve.
Fig. 5, fluorescent PCR method detect and cause the sensitivity of rushing down intestinal bacteria O104; From 1 to 5 be followed successively by 1000000,100000,10000,1000,100copy.
Fig. 6, cause and rush down intestinal bacteria O104 standard substance quantitative fluorescent PCR typical curve.
Fig. 7, fluorescent PCR method detect and cause the sensitivity of rushing down intestinal bacteria H4; From 1 to 5 be followed successively by 1000000,100000,10000,1000,100copy.
Fig. 8, cause and rush down intestinal bacteria H4 standard substance quantitative fluorescent PCR typical curve.
Embodiment
Below in conjunction with specific embodiment and accompanying drawing the present invention is further described, but protection scope of the present invention is not limited in this.
Embodiment one
1 materials and methods
1.1 bacterial strain and clinical samples:
Cause and rush down Escherichia coli O 157: H7, O104:H4 type bacterium (bacterial strain through full automatic biochemical apparatus identify and Japan give birth to grind, Denmark's serum aggegation) purchase in CDC.Clinical sample derives from recent patient's stool sample, and cryopreservation also in time is transported to the laboratory after the sample collection.
1.2 primer and probe
Downloaded causing and rush down Escherichia coli O 157 all over the world from the NCBI gene pool of the U.S.: H7, O104:H4 type bacterial gene sequence.It has been carried out homology relatively, and at the genomic conservative gene of correspondence district's design specific primers and Taqman probe, sequence is following:
O157 upstream primer-F:5 '-TGGCATGACGTTATAGGCTACAAT-3 '
O157 downstream primer-R:5 '-AGCTTGTTCTAACTGGGCTAATCCT-3 '
O157 specific probe-P:5 '-FAM-ATAGGATGACAAATATCTGCGCTGCT-BHQ1-3 '
H7 upstream primer-F:5 '-GGCGCAGGCTGCTGATT-3 '
H7 downstream primer-R:5 '-AGCTTCAAAACGTGATGCGTTAGCTG-3 '
H7 specific probe-P:5 '-HEX-CAGATTTACCCACATCAGCATG-BHQ1-3 '
O104 upstream primer-F:5 '-AGGAGTAAACAATGTCAAAGCAAC-3 '
O104 downstream primer-R:5 '-AAAATCCTTTAAACTATACGCCC-3 '
O104 specific probe-P: 5 '-ROX-ACTTGGTTTTTTTGTATTAGCAATAAGTGGTG-BHQ2-3 '
H4 upstream primer-F:5 '-GCTGGGGGTAAACAAGTCAA-3 '
H4 downstream primer-R:5 '-CAGAATCAACGACCGCATATT-3 '
H4 specific probe-P: 5 '-CY5-TGTCTTACACTGACACCGCGTCTAACABHQ3-3 '
Primer and probe entrust brightness farsighted bio tech ltd in Shanghai synthetic.
1.3 the extraction of bacteria quantified standard and DNA of bacteria:
The QIAamp DNA Mini Kit of German QIAGEN company is adopted in the extraction of DNA of bacteria; Pressing the test kit specification sheets extracts; Obtain DNA of bacteria, utilize the concentration of NanoDrop ND-1000 Spectrophotometer, thereby the copy number of definite DNA is with subsequent use at 260nm measurement DNA of bacteria.
1.4 the optimization of fluorescence RT-PCR reaction system and condition:
Test kit: the HR Qpcr Master Mix that selects the farsighted bio tech ltd of Shanghai brightness for use; Code:HR-RT01-50; The by specification operation; Reaction system be 50
; 2 * HR Qpcr Master Mix 25ul wherein; Each 1
of the upper reaches and downstream primer (20 μ mol/L); Probe (20 μ mol/L) 1
; Template DNA 2-3
, DEPC water supply 50
.Reaction conditions is: 95 ℃ of 5min, and 95 ℃ of 10s then, 55 ℃ of 40s carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether.The result judges: select fluoroscopic examination model F AM, HEX, ROX, CY5; The fluorescence baseline adjustment is got 3-15 round-robin fluorescent signal MV; Threshold setting is with the vertex of threshold line just above normal negative control article, and sample is typical amplification curve, is judged as the positive.Do not have typical amplification curve, be judged as feminine gender.The optimization Test of system; Be in the reaction system of template with the positive nucleic acid of same concentrations; Primer concentration is from 0.10～1.00 μ M; Concentration and probe concentration is from 0.10～0.50 μ M, adopts the optimum concn of preferred primer of matrix method and probe, according to minimum Ct value and high fluorescent increased value (Δ Rn) best primer of selection and concentration and probe concentration.
1.5 fluorescent PCR specificity, susceptibility and replica test
Selection causes rushes down Escherichia coli O 157: H7 and O104:H4 type bacterium, extract nucleic acid, and detect the specificity of verification method with O157, H7, O104 and H4 multiple fluorescence PCR method; To the O157:H7 (2 * 10 that demarcates copy number
7Copies/ml) and O104:H4 type (2 * 10
7Copies/ml) behind the intestinal bacteria gradient dilution, the parallel fluorescent PCR that carries out reacts relatively its sensitivity.In addition, the DNA of bacteria diluent of each concentration is made 4 duplicate detection, the Ct value base of calculation that obtains is poor, the repeatability of verification method.
2 results
2.1 fluorescent PCR reaction system and condition
Select the HR Qpcr Master Mix of the farsighted bio tech ltd of Shanghai brightness for use; Code:HR-RT01-50; The by specification operation; Reaction system be 50
; 2 * HR Qpcr Master Mix, 25 ul wherein; Each 1
of four kinds of primers (20 μ mol/L); Four kinds of probes (20 μ mol/L), 1
; Template DNA 2-3
, DEPC water supply 50
.On four look quantitative real time PCR Instruments, detect, reaction parameter is: 95 ℃ of 5min warm starts, and 95 ℃ of 10s then, 55 ℃ of 45s carry out the quadruple fluoroscopic examination at 55 ℃, carry out 40 circulations altogether.
2.2 specificity test
The multiple fluorescence PCR method that the present invention sets up has specificity preferably to diarrheagenic E. coli O157:H7 and O104:H4 type, and the stool sample of the diarrhea patient of gathering in the recent period also detects positive reaction.And with equal no cross reaction such as other intestinal bacteria such as other serotype intestinal bacteria, enterobacter cloacae, campylobacter jejuni, yersinia entero-colitica, Aeromonas hydrophila, Plesiomonas shigelloides, Vibrio parahaemolyticus, vibrio fluvialis.
2.3 sensitivity test
To demarcating the diarrheagenic E. coli O157:H7 (1 * 10 of copy number
7Copies/ml) and O104:H4 (1 * 10
7Copies/ml) nucleic acid dilutes 10,100,1000,10000,100000 times respectively, detects with fluorescence PCR method, and the fluorescence PCR method detection sensitivity reaches 1 * 100,1 * 100,1 * 100 and 1 * 100 Copies/ml respectively as a result.The result is referring to Fig. 1-8.
2.4 replica test
(final concentration is 1 * 10 to diarrheagenic E. coli O157:H7
7Copies/ml) and O104:H4 (1 * 10
7Copies/ml) mix the back and become 5 different concentration by 10 times of gradient dilutions; Sample to each concentration is made 4 duplicate detection; Different IPs acid concentration detection Ct value standard deviation separately has better repeatability (referring to table 1) between 0.10～0.35 as a result.
The detection of embodiment two clinical samples
Adopt the diarrhoea syndrome questionnaire of the great special project of Eleventh Five-Year Plan-transmissible disease cause of disease Monitoring techniques platform, to 800 parts of diarrhoea of outpatient service samples of collecting from Zhejiang University Medical College The First Affiliated Hospital year September in January, 2011 to 2011 (every day defecation 3 times or above and stool be rare just, watery stool, sticking purulence just or proterties such as pus and blood stool change) detect.From the diarrhoea clinical sample of collecting, directly extract DNA of bacteria, with fluorescence PCR method testing goal pathogenic bacteria of the present invention; Adopt conventional cultural method to carry out parallel test simultaneously.As a result fluorescence PCR method detect O157:H7 a with two parts of O104:H4, fluorescence PCR method of the present invention detects the positive rate height than general culture method, and is easy and simple to handle.Fluorescence PCR method of the present invention is used for the checking of clinical sample detection to carry out 4 parallel laboratory test chambers, all obtains satisfied result.
< 110>Zhejiang University
< 120>cause and rush down intestinal bacteria quadruple fluorescent quantificationally PCR detecting kit
<160>?16
<210>?1
<211>?24
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR upstream primer sequence that designs according to the Escherichia coli O 157 antigen gene
<400>?1
TGGCATGACGTTATAGGCTACAAT?24
<210>?2
<211>?25
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR downstream primer sequence that designs according to the Escherichia coli O 157 antigen gene
<400>?2
AGCTTGTTCTAACTGGGCTAATCCT?25
<210>?3
<211>?26
<212>?DNA
< 213>artificial sequence
<220>
< 223>the TaqMan fluorescent quantitation probe sequence that designs according to the Escherichia coli O 157 antigen gene
<400>?3
ATAGGATGACAAATATCTGCGCTGCT?26
<210>?4
<211>?78
<212>?DNA
< 213>artificial sequence
<220>
< 223>the fluorescent quantitation standard substance sequence that designs according to the Escherichia coli O 157 antigen gene
<400>?4
TGGCATGACG?TTATAGGCTA?CAATTATAGG?ATGACAAATA?TCTGCGCTGC TATAGGATTA GCCCAGTTAG AACAAGCT 78
<210>?5
<211>?17
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR upstream primer sequence that designs according to intestinal bacteria Flic gene (H7)
<400>?5
GGCGCAGGCTGCTGATT?17
<210>?6
<211>?26
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR downstream primer sequence that designs according to intestinal bacteria Flic gene (H7)
<400>?6
AGCTTCAAAACGTGATGCGTTAGCTG?26
<210>?7
<211>?22
<212>?DNA
< 213>artificial sequence
<220>
< 223>the TaqMan fluorescent quantitation probe sequence that designs according to intestinal bacteria Flic gene (H7)
<400>?7
CAGATTTACCCACATCAGCATG?22
<210>?8
<211>?76
<212>?DNA
< 213>artificial sequence
<220>
< 223>according to the fluorescent quantitation standard substance sequence of Shigellae ipaH gene design
<400>?8
GGCGCAGGCT?GCTGATTCAG?CTTCAAAACG?TGATGCGTTA?GCTGCCACCC TTCATGCTGA TGTGGGTAAA TCTGTT 76
<210>?9
<211>?24
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR upstream primer sequence that designs according to intestinal bacteria O104 antigen gene
<400>?9
AGGAGTAAACAATGTCAAAGCAAC?24
<210>?10
<211>?23
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR downstream primer sequence that designs according to intestinal bacteria O104 antigen gene
<400>?10
AAAATCCTTTAAACTATACGCCC?23
<210>?11
<211>?32
<212>?DNA
< 213>artificial sequence
<220>
< 223>the TaqMan fluorescent quantitation probe sequence that designs according to intestinal bacteria O104 antigen gene
<400>?11
ACTTGGTTTTTTTGTATTAGCAATAAGTGGTG?32
<210>?12
<211>?100
<212>?DNA
< 213>artificial sequence
<220>
< 223>the fluorescent quantitation standard substance sequence that designs according to intestinal bacteria O104 antigen gene
<400>?12
TGTCGCGCAA?AGAATTTCAA?CTTTACTTGG?TTTTTTTGTA TTAGCAATAA?GTGGTGTCAT TTCAAGTCAG?GTTTCTAGGG CGTATAGTTT AAAGGATTTT 100
<210>?13
<211>?20
<212>?DNA
< 213>artificial sequence
<220>
< 223>the PCR upstream primer sequence that designs according to intestinal bacteria Flic gene (H4)
<400>?13
GCTGGGGGTAAACAAGTCAA?20
<210>?14
<211>?21
<212>?DNA
< 213>artificial sequence
<220>
< 223>according to the PCR downstream primer sequence of intestinal bacteria Flic gene (H4) gene design
<400>?14
CAGAATCAACGACCGCATATT?21
<210>?15
<211>?27
<212>?DNA
< 213>artificial sequence
<220>
< 223>according to the TaqMan fluorescent quantitation probe sequence of intestinal bacteria Flic gene (H4) gene design
<400>?15
TGTCTTACACTGACACCGCGTCTAACA?27
<210>?16
<211>?79
<212>?DNA
< 213>artificial sequence
<220>
< 223>the fluorescent quantitation standard substance sequence that designs according to the vibrio cholerae O 139 group glycosyltransferase gene
<400>?16
GCTGGGGGTA?AACAAGTCAA?TTTACTGTCT?TACACTGACA?CCGCGTCTAA CAGTACTAAA TATGCGGTCG TTGATTCTG 79
Claims (3)
1. one kind causes and rushes down intestinal bacteria quadruple fluorescent quantificationally PCR detecting kit; Form by fluorescence quantitative PCR reaction solution, O157 standard substance, H7 standard substance, O104 standard substance, H4 standard substance, reference substance; Wherein fluorescence quantitative PCR reaction solution comprises PCR reaction buffer, specificity upstream and downstream primer and specific probe; Wherein the PCR reaction buffer contains magnesium chloride and triphosphate deoxyribose nucleotide mixture, heat-resisting Taq archaeal dna polymerase, the sequence of specificity upstream and downstream primer, specific probe and standard substance respectively as follows:
O157 upstream primer-F:5 '-TGGCATGACGTTATAGGCTACAAT-3 '
O157 downstream primer-R:5 '-AGCTTGTTCTAACTGGGCTAATCCT-3 '
O157 specific probe-P:5 '-FAM-ATAGGATGACAAATATCTGCGCTGCT-BHQ1-3 '
H7 upstream primer-F:5 '-GGCGCAGGCTGCTGATT-3 '
H7 downstream primer-R:5 '-AGCTTCAAAACGTGATGCGTTAGCTG-3 '
H7 specific probe-P:5 '-HEX-CAGATTTACCCACATCAGCATG-BHQ1-3 '
O104 upstream primer-F:5 '-AGGAGTAAACAATGTCAAAGCAAC-3 '
O104 downstream primer-R:5 '-AAAATCCTTTAAACTATACGCCC-3 '
O104 specific probe-P: 5 '-ROX-ACTTGGTTTTTTTGTATTAGCAATAAGTGGTG-BHQ2-3 '
H4 upstream primer-F:5 '-GCTGGGGGTAAACAAGTCAA-3 '
H4 downstream primer-R:5 '-CAGAATCAACGACCGCATATT-3 '
H4 specific probe-P: 5 '-CY5-TGTCTTACACTGACACCGCGTCTAACA-BHQ3-3 '
O157 gene standard substance:
TGGCATGACG?TTATAGGCTA?CAATTATAGG?ATGACAAATA?TCTGCGCTGC?TATAGGATTA GCCCAGTTAG AACAAGCT
H7 gene standard substance:
GGCGCAGGCT?GCTGATTCAG?CTTCAAAACG?TGATGCGTTA?GCTGCCACCC?TTCATGCTGA TGTGGGTAAA TCTGTT
O104 gene standard substance:
TGTCGCGCAA AGAATTTCAA?CTTTACTTGG TTTTTTTGTA TTAGCAATAA GTGGTGTCAT TTCAAGTCAG GTTTCTAGGG CGTATAGTTT?AAAGGATTTT
H4 gene standard substance:
GCTGGGGGTA?AACAAGTCAA?TTTACTGTCT?TACACTGACA?CCGCGTCTAA?CAGTACTAAA TATGCGGTCG TTGATTCTG。
2. a kind of causing according to claim 1 rushed down intestinal bacteria quadruple fluorescent quantificationally PCR detecting kit; It is characterized in that; Reference substance divides negative contrast and positive control; Negative control is autoclaved diethylpyrocarbonate treating water, and positive control is the positive plasmid sample of O157, H7, O104 and H4.
3. a kind of causing according to claim 1 rushed down intestinal bacteria quadruple fluorescent quantificationally PCR detecting kit, it is characterized in that said test kit is stored in-20 ℃, reduces multigelation as far as possible.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110376158 CN102399884B (en) | 2011-11-23 | 2011-11-23 | Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110376158 CN102399884B (en) | 2011-11-23 | 2011-11-23 | Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102399884A true CN102399884A (en) | 2012-04-04 |
| CN102399884B CN102399884B (en) | 2013-09-25 |
Family
ID=45882527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110376158 Active CN102399884B (en) | 2011-11-23 | 2011-11-23 | Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102399884B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103451306A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Multi-PCR (Polymerase Chain Reaction) detecting primer group for Escherichia coli O104:H4 and reagent kit |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107805667A (en) * | 2016-09-07 | 2018-03-16 | 中国检验检疫科学研究院 | The double-colored real-time fluorescence PCR detection method of enterohemorrhagic escherichia coli |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154488A (en) * | 2011-03-01 | 2011-08-17 | 广西壮族自治区兽医研究所 | Double PCR (polymerase chain reaction) rapid detection method for escherichia coli O157:H7 and kit |
-
2011
- 2011-11-23 CN CN 201110376158 patent/CN102399884B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154488A (en) * | 2011-03-01 | 2011-08-17 | 广西壮族自治区兽医研究所 | Double PCR (polymerase chain reaction) rapid detection method for escherichia coli O157:H7 and kit |
Non-Patent Citations (1)
| Title |
|---|
| MARTINA BIELASZEWSKA ET AL.: "Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany,2011: a microbiological study", 《THE LANCET INFECTIOUS DISEASES》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103451306A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Multi-PCR (Polymerase Chain Reaction) detecting primer group for Escherichia coli O104:H4 and reagent kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102399884B (en) | 2013-09-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103509877B (en) | A kind of PCR kit for fluorescence quantitative for detecting PRV and application thereof | |
| CN103484565B (en) | The test kit of a kind of real-time fluorescence RT-PCR detection coronavirus and application thereof | |
| CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
| CN102071259A (en) | Multiplex real-time fluorescence PCR (polymerase chain reaction) detection primer and method for porcine rabies virus, porcine parvovirus and porcine circovirus type 2 | |
| CN101104867A (en) | Nest type-real time quantitative PCR method for detecting hepatitis B virus cccDNA | |
| CN103789451A (en) | Fluorescent quantitative kit for detecting coxsackie viruses A6 and A10 | |
| CN102212618B (en) | Fourfold fluorescence quantitative PCR (Polymerase Chain Reaction) kit and application | |
| CN103031386B (en) | Triple fluorescent quantitative RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) kit for detecting human calicivirus | |
| CN104630388A (en) | Dengue virus rapid classification identification detection kit | |
| Van Doornum et al. | Development and implementation of real‐time nucleic acid amplification for the detection of enterovirus infections in comparison to rapid culture of various clinical specimens | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN102534051B (en) | Kit for detecting enterovirus | |
| CN103805699A (en) | Quantitative detection method and reagent kit of GSTP1 (Glutathione S-Transferase P1) methylation for predicting hepatic failure prognosis | |
| CN105441539A (en) | Kit capable of simultaneously detecting 12 diarrhea pathogenic bacteria and application thereof | |
| CN101550452A (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN101709331B (en) | Kit for quantitatively detecting vibrio parahaemolyticus in food and clinic sample | |
| CN102399884B (en) | Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli | |
| CN101333557A (en) | Simultaneous quantitative determination process for various enteric pathogenic bacteria in environment water body example | |
| CN102260743B (en) | Multiplex fluorescence polymerase chain reaction (PCR) detection kit and method for enterohemorrhagic Escherichia coli O104:H4 | |
| Bergallo et al. | Development of a quantitative real-time PCR assay for sapovirus in children under 5-years-old in Regina Margherita Hospital of Turin, Italy | |
| CN101122563A (en) | Hepatitis E virus fluorescent quantitative PCR detection method | |
| CN103952483B (en) | DPO-PCR method is utilized to detect DPO primer sequence and the detection kit of vibrio alginolyticus | |
| CN102134598B (en) | Method for detecting Aeromonas hydrophila by FQ-PCR (fluorescent quantitative polymerase chain reaction) | |
| CN102154523B (en) | Primer for detecting human BK viral nucleic acid, fluorescent probe and application thereof | |
| CN102952897A (en) | RT-PCR (Reverse Transcription-Polymerase Chain Reaction) fluorescence detection kit for rubella virus and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |