CN102399767B - Cellulose Cel5A with wide pH range as well as gene and application - Google Patents
Cellulose Cel5A with wide pH range as well as gene and application Download PDFInfo
- Publication number
- CN102399767B CN102399767B CN 201110346171 CN201110346171A CN102399767B CN 102399767 B CN102399767 B CN 102399767B CN 201110346171 CN201110346171 CN 201110346171 CN 201110346171 A CN201110346171 A CN 201110346171A CN 102399767 B CN102399767 B CN 102399767B
- Authority
- CN
- China
- Prior art keywords
- cel5a
- cellulase
- wide
- scope
- cellulose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering, in particular to a cellulose Cel5A with wide pH range as well as a gene and an application. The invention provides a cellulose Cel5A with wide pH range, wherein the cellulose Cel5A has an amino acid sequence shown by SEQ ID NO.1 or 2. And the invention also provides a gene for encoding the cellulose Cel5A with wide pH range, as well as a recombinant vector, a recombinant strain and an application thereof, wherein the nucleotide sequence of the gene is shown by SEQ ID NO.3, 4 or 5, and the recombinant vector and the recombinant strain both contain the genes. The cellulose Cel5A with wide pH range, provided by the invention, has the advantages of extremely good thermal resistance, can be applied to feed industry, food industry, medicine industry and the like for animals and fishes, and can be also applied to papermaking and textile and printing industries.
Description
Technical field
The present invention relates to the genetically engineered field, particularly, the present invention relates to a kind of wide pH scope cellulase Cel5A and gene and application.
Background technology
Mierocrystalline cellulose be glucose with the polysaccharide that β-the Isosorbide-5-Nitrae glycosidic link connects into, be one of topmost renewable resources of occurring in nature.These renewable resourcess will obtain to utilize, and are very important parts to cellulosic degraded.Cellulosic degraded needs three kinds of enzyme synergies, comprise: endo cellulase (endo-1,4-β-d-glucanase, EC 3.2.1.4 is called for short EG), this fermentoid acts preferentially on the noncrystalline domain of cellulosic molecule inside, random hydrolysis β-1, the 4-glycosidic link with the brachymemma of long chain cellulose molecule, produces in a large number the small molecules Mierocrystalline cellulose with non reducing end; Circumscribed cellulase (EC 3.2.1.91 is called for short CBH for exo-1,4-β-d-glucanase or cellobiohydrolase), it is terminal that this fermentoid acts on the Mierocrystalline cellulose linear molecule, and hydrolysis β-Isosorbide-5-Nitrae glycosidic link is cut next cellobiose molecule at every turn; Beta-glucosidase enzyme (β-d-glucosidase, EC 3.2.1.21 are called for short BG), this fermentoid acts on the non-reducing end of cellobiose or cell-oligosaccharide, produces glucose molecule.
Cellulase extensively is present in the natural organism, and microorganism is the important sources of cellulase, and a lot of microorganisms comprise all cellulase-producing (Zhang Chuanfu etc., information biology, 2006,1 (5): 34-36) such as bacterium, actinomycetes, fungi.Microbial cellulase has the obvious advantages such as vigor is high, cost is low, steady sources, extraction convenience.Press the optimum pH of cellulase catalyzed reaction, it can be divided into acidic cellulase (optimum pH is 3.0-5.0), neutral cellulase (optimum pH is 6.0-8.0) and alkali cellulose enzyme (optimum pH is 8.0-11.0) (Zhang YHP et al.Biotechnol Adv 2006,24:62-481.).
Cellulase in papermaking, brewage, the field such as weaving, feed, bioenergy all be with a wide range of applications (WongKK, et al.Microbiol Rev 1988,52:305-317.).But, different industrial application demand cellulases of different nature, for example, the cellulase that fodder industry needs needs under acid and neutrallty condition high reactivity is arranged, and textile industry needs neutral alkaline-resisting cellulase.The wooden mould institute cellulase-producing optimal pH of present industrial widespread use is about 5.0, and optimum temperuture can not satisfy the industrial requirements of cotton goods washing arrangement industry, paper-making pulping industry between 50-60 ℃.Because cotton fibre is alkaline-resisting not acidproof, fragile after the strongly-acid processing (permitted to love homeland etc., the application of neutral cellulase in Cotton Fabric, printing and dyeing, 2006,21,11-12).Therefore, obtaining novel research with neutral cellulase of alkaline-resisting high temperature is significant.The clone with separate have neutrality, the cellulase of Heat stability is good can better be applied to the fields such as weaving.
The present invention has obtained a new cellulase, under acid and neutral alkaline condition, all has high activity and stability, simultaneously, this cellulase has excellent heat resistance, can be applicable to the fodder production of animal and fish, be applied to the industry such as food, medicine, can also be applied to papermaking and textile printing and dyeing industry simultaneously.
Summary of the invention
The purpose of this invention is to provide a kind of wide pH scope cellulase Cel5A.
A further object of the present invention provides the gene cel5A of the above-mentioned wide pH scope cellulase of coding.
Another object of the present invention provides the recombinant vectors that comprises above-mentioned wide pH scope cellulose enzyme gene.
Another object of the present invention provides the recombinant bacterial strain that comprises above-mentioned wide pH scope cellulose enzyme gene.
Another object of the present invention provides a kind of method for preparing above-mentioned wide pH scope cellulase.
Another object of the present invention provides above-mentioned wide pH scope Mierocrystalline cellulose application of enzymes.
The present invention separates from Bispora antennata CBS 126.38 and obtains a kind of new high temperature resistant wide pH scope cellulase Cel5A, and its aminoacid sequence is shown in SEQ ID NO.1:
MRFSTPLLAT SLMASVFGSP VITTKRSNSS TFQFFGVNES GAEFGQTNIP
STTAIGTLMD KGMNTFRIAF LMERLAQNSM TATLDATYLA DLRKVVEYIT
HNFGRYAGSV ITSTADFGTF WANVASQFKD DEKVVFDCNN EFHDMPSNDL
VRGLNQACVD 180
GVRGAGATEQ WIFVEGTSYT GAWTWVSSGN GDALISLTDP SDKIVYEMHQ
YLDSDGSGTS 240
SECVSSTIGA ERIATATAWL KANNKRGILG EFAGGVNTQC QTAVMGLLDA
LVTDKAVWMG 300
ALWWGGGPWW GDYSFGMEAG SGVGAYEGYI DILTKYV 337
Wherein, 337 amino acid of this zymoprotein total length and a terminator codon, N holds 18 signal peptide sequences " MRFSTPLLAT SLMASVFG " that amino acid is its prediction.
Therefore, the aminoacid sequence of ripe cellulase Cel5A is shown in SEQ ID NO.2:
SPVITTKRSN SSTFQFFGVN ESGAEFGQTN IPGTLGTDYT WPSTTAIGTL
MDKGMNTFRI 60
AFLMERLAQN SMTATLDATY LADLRKVVEY ITGRGGYAVL DPHNFGRYAG
SVITSTADFG 120
TFWANVASQF KDDEKVVFDC NNEFHDMPSN DLVRGLNQAC
VDGVRGAGAT EQWIFVEGTS 180
YTGAWTWVSS GNGDALISLT DPSDKIVYEM HQYLDSDGSG TSSECVSSTI
GAERIATATA 240
WLKANNKRGI LGEFAGGVNT QCQTAVMGLL DALVTDKAVW
MGALWWGGGP WWGDYSFGME 300
AGSGVGAYEG YIDILTKYV 319
Maturation protein is comprised of 319 amino acid and a terminator codon, and theoretical molecular is 34.5kDa, and this enzyme belongs to glycosyl hydrolase the 5th family.The cellulase aminoacid sequence is carried out the BLAST comparison in GenBank find, be up to 63% with the sequence identity of the putative protein that derives from Sclerotinia sclerotiorum 1980, be up to 55.3% with the sequence identity of the cellulase EGI of Thermoascus aurantiacus.Illustrate that cellulase Cel5A is a kind of new cellulase.
The invention provides the gene of the above-mentioned cellulase of coding, this enzyme full length gene 1168bp, sequence is shown in SEQ ID NO.3:
atgcgcttct caacccccct cctcgccaca agcctcatgg cttcagtctt tggatcacca 60
gtcataacca ccaaacgctc aaactcaagt accttccaat ttttcggcgt caacgaatca 120
ggcgctgaat tcggacaaac caacatcccc ggtactctag gaacagacta cacatggccc 180
tccacaaccg ccatcggaac tttgatggat aaagggatga acaccttccg aatcgccttc 240
ctcatggaac ggctcgctca gaatagcatg acggctaccc ttgacgcaac atacctcgcc 300
gatctccgca aggttgtgga atacatcact gggaggggag gctatgcggt tttagatcca 360
cataactttg ggaggtatgc tgggagtgtg attacttcca ccgcggattt tgggactttt 420
tgggcgaatg ttgcaagcca gtttaaggat gatgagaagg tggtgtttga ttgtaataat 480
gagtttcatg atatgccgtc gaatgatttg gttagggggt tgaatcaggc ttgtgttgat 540
ggggtgaggg gtgctggtgc gacggagcag tggatttttg ttgaaggaac tgtttgttcc 600
cctccccata tccccctata aactcgctaa cgcaaaacag tcttacacgg gagcatggac 660
atgggtatct tccggaaatg gcgacgccct tatttcactt accgatccat ctgataaaat 720
cgtttatgag atgcatcaat atctcgactc tgatggctca ggcacttctt ccgaatgtgt 780
ttcttccacc attggtgccg aaagaatcgc taccgcaact gcttggttga aggcgaataa 840
caaacgaggg attctgggcg agttcgcggg gggtgtgaat acgcagtgtc agactgctgt 900
gatgggtttg cttgatgctt tggtcacgga taaggcggtt tggatggggg ctttgtggtg 960
gggtggtgga ccggtatgtt tattctgctc tgttttccat tcatgatgtt gcgagatttt 1020
atatgttgtc tcctgagagg ggttccgaat ggtaaatgct gacttgtttt tcttctagtg 1080
gtggggagat tacagttttg ggatggaggc tgggagtggg gttggggctt atgagggata 1140
cattgatatt ttaacaaagt atgtgtag 1168
The present invention also provides the cDNA sequence of the above-mentioned cellulase of encoding, total length 1014bp, shown in SEQ ID NO.4:
atgcgcttct caacccccct cctcgccaca agcctcatgg cttcagtctt tggatcacca 60
gtcataacca ccaaacgctc aaactcaagt accttccaat ttttcggcgt caacgaatca 120
ggcgctgaat tcggacaaac caacatcccc ggtactctag gaacagacta cacatggccc 180
tccacaaccg ccatcggaac tttgatggat aaagggatga acaccttccg aatcgccttc 240
ctcatggaac ggctcgctca gaatagcatg acggctaccc ttgacgcaac atacctcgcc 300
gatctccgca aggttgtgga atacatcact gggaggggag gctatgcggt tttagatcca 360
cataactttg ggaggtatgc tgggagtgtg attacttcca ccgcggattt tgggactttt 420
tgggcgaatg ttgcaagcca gtttaaggat gatgagaagg tggtgtttga ttgtaataat 480
gagtttcatg atatgccgtc gaatgatttg gttagggggt tgaatcaggc ttgtgttgat 540
ggggtgaggg gtgctggtgc gacggagcag tggatttttg ttgaaggaac ttcttacacg 600
ggagcatgga catgggtatc ttccggaaat ggcgacgccc ttatttcact taccgatcca 660
tctgataaaa tcgtttatga gatgcatcaa tatctcgact ctgatggctc aggcacttct 720
tccgaatgtg tttcttccac cattggtgcc gaaagaatcg ctaccgcaac tgcttggttg 780
aaggcgaata acaaacgagg gattctgggc gagttcgcgg ggggtgtgaa tacgcagtgt 840
cagactgctg tgatgggttt gcttgatgct ttggtcacgg ataaggcggt ttggatgggg 900
gctttgtggt ggggtggtgg accgtggtgg ggagattaca gttttgggat ggaggctggg 960
agtggggttg gggcttatga gggatacatt gatattttaa caaagtatgt gtag 1014
Wherein, the base sequence of signal peptide is: " ATGCGCTTCT CAACCCCCCT CCTCGCCACAAGCCTCATGG CTTCAGTCTT TGGA ".Therefore, the gene order of encoding mature cellulase is shown in SEQ ID NO.5:
tcaccagtca taaccaccaa acgctcaaac tcaagtacct tccaattttt cggcgtcaac 60
gaatcaggcg ctgaattcgg acaaaccaac atccccggta ctctaggaac agactacaca 120
tggccctcca caaccgccat cggaactttg atggataaag ggatgaacac cttccgaatc 180
gccttcctca tggaacggct cgctcagaat agcatgacgg ctacccttga cgcaacatac 240
ctcgccgatc tccgcaaggt tgtggaatac atcactggga ggggaggcta tgcggtttta 300
gatccacata actttgggag gtatgctggg agtgtgatta cttccaccgc ggattttggg 360
actttttggg cgaatgttgc aagccagttt aaggatgatg agaaggtggt gtttgattgt 420
aataatgagt ttcatgatat gccgtcgaat gatttggtta gggggttgaa tcaggcttgt 480
gttgatgggg tgaggggtgc tggtgcgacg gagcagtgga tttttgttga aggaacttct 540
tacacgggag catggacatg ggtatcttcc ggaaatggcg acgcccttat ttcacttacc 600
gatccatctg ataaaatcgt ttatgagatg catcaatatc tcgactctga tggctcaggc 660
acttcttccg aatgtgtttc ttccaccatt ggtgccgaaa gaatcgctac cgcaactgct 720
tggttgaagg cgaataacaa acgagggatt ctgggcgagt tcgcgggggg tgtgaatacg 780
cagtgtcaga ctgctgtgat gggtttgctt gatgctttgg tcacggataa ggcggtttgg 840
atgggggctt tgtggtgggg tggtggaccg tggtggggag attacagttt tgggatggag 900
gctgggagtg gggttggggc ttatgaggga tacattgata ttttaacaaa gtatgtgtag 960
Dna sequence dna and cDNA sequence alignment analytical results show: the structure gene cel5A total length 1 of cellulase Cel5A, and 168bp contains 2 introns, and its sequence is respectively: 592-640bp and 974-1,078bp, the long 1041bp of cDNA.
The present invention also provides the recombinant vectors that comprises above-mentioned cellulose enzyme gene cel5A, is preferably pPIC9-cel5A.Cellulase encoding gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, being preferably the cellulose enzyme gene that will remove signal peptide is inserted between the SnaB I and NotI restriction enzyme site on the plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulated and control by it, obtain expression of recombinant yeast plasmid pPIC9-cel5A.
The present invention also provides the recombinant bacterial strain that comprises above-mentioned cellulose enzyme gene, is preferably recombinant pichia yeast strain GS115/cel5A.
The present invention also provides a kind of method for preparing above-mentioned wide pH scope cellulase Cel5A, may further comprise the steps:
1) with above-mentioned recombinant vectors transformed host cell, gets recombinant bacterial strain;
2) cultivate recombinant bacterial strain, induce the expression of recombinant fiber element enzyme Cel5A; And
3) reclaim the also expressed cellulase Cel5A of purifying.
Wherein, preferred described host cell is Pichia pastoris, cerevisiae, Bacillus coli cells or filamentous fungal cells, preferably with expression of recombinant yeast Plasmid Transformation Pichia pastoris (Pichic pastoris) GS115, obtain recombinant bacterial strain GSll5/cel5A.
The present invention also provides the application of above-mentioned wide pH scope cellulase Cel5A, and preferably it is in the application in feed, food, medicine, papermaking and textile industry of hydrocellulose and this enzyme.
The invention provides a new cellulose enzyme gene, the cellulase of its coding has wide pH adaptive scope, this cellulase has excellent heat resistance, can be applicable to the fodder industry of animal and fish, be applied to the industry such as food, medicine, can also be applied to papermaking and textile printing and dyeing industry simultaneously.
Description of drawings
The SDS-PAGE of Fig. 1 recombinant fiber element enzyme analyzes; M.Marker; 1. fermented liquid supernatant; 2. purifying cellulose enzyme Cel5A; 3. de-glycosylation cellulase Cel5A.
The optimal pH curve of Fig. 2 cellulase Cel5A.
The pH beta stability line of Fig. 3 cellulase Cel5A.
Fig. 4 cellulase Cel5A optimum temperuture curve.
The thermostability curve of Fig. 5 cellulase Cel5A under 50 ℃ and 60 ℃ of conditions.
Embodiment
The present invention will be further described below in conjunction with the drawings and specific embodiments.
Following examples do not limit the present invention, unspecified operation steps please refer to " molecular cloning experiment guide " third edition corresponding section (J. Pehanorm Brooker E.F. is Ritchie etc. not, Science Press) or consults the specification sheets of used kit among the embodiment.
The experiment material that following examples adopt is as follows:
1, bacterial strain and carrier: intestinal bacteria (Escherichia coli) Trans1 competent cell is available from the full formula in Beijing King Company, pichia spp (Pichia pastoris) GS115, the pPIC9 carrier bacterium is all available from Invitrogen company, Bispora antennataCBS 126.38 is available from Royal Dutch biotechnology institute culture collection center (Centraalbureau voor Schimmelcultures, Netherlands).
2, test kit, toolenzyme and biochemical reagents: DNA recovery test kit is TakaRa company product, molecular weight of albumen Marker is available from Fermentas company, test used various restriction enzymes and Taq enzyme all available from TakaRa company, ligase enzyme is available from Invitrogen company, the cellulase substrate is Sigma company product, and other chemical reagent is domestic analytical reagent.
3, substratum:
Escherichia coli culture medium is the LB substratum: 1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0;
YPD substratum: 1% yeast extract, 2% peptone, 2% glucose;
MD solid medium: YNB 13.4g/L, glucose 20g/L, vitamin H 4 * 10
-4G/L, agar powder 20g/L;
BMGY substratum: yeast extract 10g/L, peptone 20g/L, yeast nitrogen (YNB) 13.4g/L, vitamin H 4 * 10
-4G/L, glycerine 10mL/L;
The BMMY substratum: replace outside the glycerine divided by 0.5% methyl alcohol, all the other compositions are identical with BMGY.
The product enzyme testing of characteristic of embodiment 1 fungi Bispora antennata CBS 126.38
Bispora antennata CBS 126.38 after the malt extract culture medium culturing, is inoculated in (0.2% MgSO in the inducing culture
47H
2O, 0.1% KH
2PO
4, 0.1% CuSO
45H
2O, 0.1% CaCl
2, 0.5% peptone, 1% corn cob meal, 1% wheat bran, pH 5.0), cultivate 3～4d for 30 ℃, measure the activity of its cellulase-producing and hemicellulase.This bacterium is the High Cellulase Production bacterial strain after measured.
The clone of embodiment 2 fungi Bispora antennata CBS 126.38 cellulase encoding gene cel5A
3 days mycelium of liquid culture is put into mortar with the aseptic filter paper filtration, add the 2mL extracting solution, grind 5min, then lapping liquid is placed the 50mL centrifuge tube, 65 ℃ of water-bath cracking 20min, every the 10min mixing once, at 4 ℃ of centrifugal 5min of lower 10000rpm.Get supernatant extrct foreigh protein removing in phenol/chloroform, get again supernatant and add the equal-volume Virahol, after room temperature leaves standstill 5min, 4 ℃ of centrifugal 10min of lower 10000rpm.Abandon supernatant, precipitation is with 70% washing with alcohol twice, and vacuum-drying adds an amount of TE and dissolves, place-20 ℃ for subsequent use.
Synthesized degenerate primer P1 (5 '-TAYGARWTBCAYCARTAYCTNGA-3 ') according to glycoside hydrolase regulator gene conserved sequence (YEM/FHQYLD and WWAG/AGPW) design, P2 (5 '-CCATGGNCCNCCNGCCCACCA-3 ') (wherein: Y=C/T, R=A/G, B=C/G/T, W=A/T, N=A/T/G/C).Carry out pcr amplification take Bispora antennata CBS 126.38 total DNA as template.The PCR reaction parameter is: 95 ℃ of 5min; 94 ℃ of 30sec, 55-45 ℃ of 30sec (wherein the rear renaturation drop in temperature of each circulation is 1 ℃), 72 ℃ of 1min, then 10 circulations enter second cycling program: 94 ℃ of 30sec, 45 ℃ of 30sec, 72 ℃ of 1min are after 25 circulations; 72 ℃ of 10min, agarose electrophoresis detects.Obtain an about 250bp fragment, after this fragment is reclaimed and pEASY-T
3Carrier links to each other and order-checking.
According to measuring sequence results, in the GenBank of NCBI, utilize BLASTX[http: //www.ncbi.nlm.nih.gov/BLAST] carry out sequence alignment, judge that tentatively this gene fragment is the cellulose enzyme gene fragment, and carry out the Study on Similarity of this fragment.The sequence identity of the cellulase FII-CMCase in this sheet segment length and Aspergillus aculeatus source is up to 73%.
The nucleotide sequence that obtains according to order-checking designs the TAIL-PCR primer:
U1(5′-CATCCAAACCGCCTTATCCGTGACCAAAGC-3′)，
U2(5′-GCAAACCCATCACAGCAGTCTGACACTGC-3′)，
U3(5′-CACATTCGGAAGAAGTGCCTGAGCCATCAG-3′)；
D1(5′-GCATCAATACCTGGACTCTGATGGCTCAGG-3′)，
D2(5′-CCGAATGTGTTTCTTCCACCATTGGTGCCG-3′)，
D3(5′-GGGTTTGCTTGATGCTTTGGTCACGGATAAGG-3′)。
Obtain the flanking sequence of known sequence by TAIL-PCR, amplification obtains sending after product reclaims the order-checking of three rich Bioisystech Co., Ltd.The core fragment that degenerated primer is obtained splices with the flanking sequence that obtains through TAIL-PCR and obtains the cel5A full-length gene.Show the gene fragment that this gene DNA total length is a long 1168bp (SEQ ID NO.3) through sequential analysis.
The acquisition of the cDNA sequence of embodiment 3 cellulose enzyme genes
Extract total RNA of Bispora antennata CBS 126.38, utilize ThermoScript II to obtain the chain of cDNA, then this strand cDNA increases to design appropriate primer Cel5AF (5 '-ATGCGCTTCTCAACCCCCCTCCTCGC-3 ') and Cel5AR (5 '-CTACACATACTTTGTTAAAATATCAATGTATCCCTCATAAGCCC-3 '), obtain the cDNA sequence of cellulase, amplification obtains sending after product reclaims the order-checking of three rich Bioisystech Co., Ltd.
Find that genomic dna sequence and the cDNA the sequencing results of this gene cellulase show after genome sequence by cellulase relatively and the cDNA sequence, the structure gene total length 1 of cellulase Cel5A, 168bp, contain 2 introns, its sequence is respectively: 592-640bp and 974-1,078bp, the long 1041bp of cDNA.N holds 18 signal peptide sequences that amino acid is its prediction.Sequence on cellulase Cel5A cDNA sequence encoding albumen and the GeneBank is carried out homology and is relatively found, it is up to 63% with the sequence identity that derives from the putative protein of Sclerotinia sclerotiorum 1980, is up to 55.3% with the sequence identity of the cellulase EGI of Thermoascus aurantiacus.
The structure of embodiment 4 recombinant expression vectors
Express primer according to the cDNA sequences Design:
F：5′-GGG
TACGTATCACCAGTCATAACCACCAA-3′；
R：5′-GGG
GCGGCCGCCTACACATACTTTGTTAAAA-3′；
Introduce respectively restriction endonuclease SnaBI and NotI restriction enzyme site at the end of expressing primer, take the cDNA of cellulase as template, carry out pcr amplification, obtain the encoding sequence of cellulase Cel5A maturation protein.Expression vector pPIC9 is carried out double digestion (SnaBI+NotI), simultaneously with the gene cel5A double digestion (SnaBI+NotI) of the coding of cellulase maturation protein, and be connected with expression vector pPIC9, transform intestinal bacteria Trans1 competent cell, send order-checking through PCR checking positive colony, thereby obtain containing the recombinant plasmid pPIC9-cel5A of Bispora antennata CBS 126.38 cellulose enzyme genes.Equally, to include signal peptide sequence cellulase Cel5A cDNA by enzyme cut, method of attachment inserts and to have removed among the expression vector pPIC9 of α-factor signal peptide sequence, obtains to contain the recombinant plasmid pPIC-cel5A-1 of gene cel5A of the coding cellulase of signal peptide sequence.
The acquisition of the recombinant bacterial strain of embodiment 5 high efficient expressions
Respectively recombinant vectors pPIC9-cel5A and pPIC-cel5A-1 are transformed Pichia pastoris GS115 after the BglII line style, coating MD is dull and stereotyped, treat after 3 days that bacterium colony grows, with the toothpick of the bacterium of going out picking list bacterium colony from the long MD plate that two kinds of transformants are arranged respectively, put first on the MM according to numbering, dull and stereotyped upper 30 ℃ of the MD that puts again corresponding numbering cultivated 1～2 day, grew to bacterium colony.Two kinds of transformants of energy normal growth on the MD flat board are inoculated in respectively in the centrifuge tube that 5mL BMGY substratum is housed, 30 ℃, 260rpm shaking table are cultivated the centrifugal supernatant that goes behind the 48h, add again 1mL in the centrifuge tube and contain the BMMY substratum of 0.5% methyl alcohol, behind 30 ℃, 260rpm inducing culture 48h, the centrifuging and taking supernatant is used for enzymic activity and detects, and therefrom filters out respectively two kinds of transformants with cellulase activity.Obtain recombinant pichia yeast strain GS115/cel5A and GS115/cel5A-1.Filter out respectively the bacterial strain through two kinds of carriers conversions that enzyme is lived, be total to 100 clones of picking, wherein 33 measure cellulase activity, and positive rate is 33%.
The activation analysis of embodiment 6 recombinant fibers element enzyme
Adopt the DNS colorimetry to survey reducing sugar content.Get 4 test tubes, wherein conduct contrast, contrast only adds 900ul 1% Xylo-Mucine (CMCNa) substrate, other three parallel samples will add 100uL enzyme liquid and 900uL 1% CMC substrate, be placed on 50 ℃ of water-bath 10min, all add 1.5mL DNS afterwards in sample and contrast, boiling water bath 5min measures its OD value at 540nm.
The cellulase activity unit definition: under certain condition, it is 1 activity unit (IU) that per minute decomposition Xylo-Mucine generates the required enzyme amount of 1 μ mol reducing sugar.
Preparation and the purifying of embodiment 7 recombinant fibers element enzyme Cel5A
The preparation of recombinant fiber element enzyme Cel5A: the high expression level bacterial strain that transforms separately through above-mentioned two kinds of carriers that will screen is inoculated in respectively the 1000mL triangular flask that 200mL BMGY substratum is housed, 30 ℃, the 250-280rpm shaking table was cultivated 2 days, the centrifugal 5min of nutrient solution 3250rpm, get precipitation (as far as possible supernatant being eliminated), adding 100mL contains the BMMY substratum of 0.5% methyl alcohol, again at 30 ℃, and the 250-280rpm inducing culture.For the volatilization loss of compensation methyl alcohol, add methanol solution every 12h in the bacterium liquid, make the methanol concentration in the bacterium liquid remain on 0.5%, until 48h is centrifugal with thalline, get the supernatant fermented liquid.Measure the Mierocrystalline cellulose enzyme activity.The expression amount of the recombinant fiber element enzyme of recombinant bacterial strain GS115/cel5A is about 20U/mL, and by contrast, the expression amount of the recombinant fiber of recombinant bacterial strain GSll5/cel5A-1 element enzyme is lower than the former.
Pichia spp induces the cellulase Cel5A of generation to cross molecular sieve purification, gets Peak Activity and obtains single band through the SDS-PAGE detection, and molecular weight is about 21.7kDa and predicted molecular weight suitable (seeing Fig. 1).
The zymologic property of embodiment 8 cellulase Cel5A is measured
1, the optimal pH of recombinant fiber element enzyme Cel5A and the mensuration of pH stability
Purified cellulase Cel5A carries out enzymatic reaction to measure its optimal pH under different pH.Used damping fluid is the 0.1mol/L citric acid-Sodium phosphate dibasic damping fluid of pH 3.0-8.0 and 0.1mol/L glycine-sodium hydrate buffer solution of pH 9.0-11.0.The cellulase Cel5A of purifying is in the buffer system of different pH values, and 37 ℃ of lower pH adaptive results (seeing Fig. 2) that measure show: the suitableeest action pH of Cel5A is 5.0, in the enzymic activity of pH 4.0-7.0 maintenance more than 50%.
Enzyme liquid is processed 1h in the damping fluid of different pH values, measure enzymic activity with the pH stability of studying enzyme again under normal temperature, result's (seeing Fig. 3) shows: Cel5A is very stable between 4.0-10.0 in the pH scope, keeps the enzyme more than 80% to live.
2, the optimum temperuture of recombinant fiber element enzyme Cel5A and the mensuration of thermostability
Under the 0.1mol/L of pH 5.0 citric acid-Sodium phosphate dibasic buffer solution system and different temperature (0-70 ℃), carry out enzymatic reaction.Enzyme reaction optimum temperuture measurement result (seeing Fig. 4) shows, 50 ℃ of the optimum temperatures of Cel5A, and temperature still has the enzyme about 40% to live when being higher than 60 ℃.
Measure the enzyme activity of cellulase when being incubated respectively 10,20,30,40,50,60 minutes under the differing temps (50 ℃, 60 ℃), draw the Thermostability curve.The result still has the enzyme more than 90% to live Heat stability is good (seeing Fig. 5) behind 50 ℃ of lower 60min of processing.
Claims (9)
1. one kind wide pH scope cellulase Cel5A is characterized in that, its aminoacid sequence is shown in SEQ ID NO.1 or 2, and wherein, described wide pH scope is pH 4.0-10.0.
2. one kind wide pH scope cellulose enzyme gene cel5A is characterized in that, the wide pH scope cellulase Cel5A claimed in claim 1 that encodes, and wherein, described wide pH scope is pH 4.0-10.0.
3. wide pH scope cellulose enzyme gene cel5A according to claim 2 is characterized in that, the nucleotide sequence of described gene is shown in SEQ ID NO.3,4 or 5.
4. the recombinant vectors that comprises claim 2 or 3 described wide pH scope cellulose enzyme gene cel5A.
5. recombinant vectors according to claim 4 is characterized in that, described recombinant vectors is pPIC9-cel5A.
6. the recombinant bacterial strain that comprises claim 2 or 3 described wide pH scope cellulose enzyme gene cel5A.
7. recombinant bacterial strain according to claim 6 is characterized in that, described recombinant bacterial strain is Pichia yeast.
8. method for preparing wide pH scope cellulase Cel5A, wherein, described wide pH scope is pH4.0-10.0, it is characterized in that, may further comprise the steps:
1) with the recombinant vectors transformed host cell of claim 4, gets recombinant bacterial strain;
2) cultivate recombinant bacterial strain, induce the expression of recombinant fiber element enzyme Cel5A; And
3) reclaim the also expressed cellulase Cel5A of purifying.
9. the described wide pH scope cellulase Cel5A of claim 1 is used for the application of degraded cellulose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110346171 CN102399767B (en) | 2011-11-04 | 2011-11-04 | Cellulose Cel5A with wide pH range as well as gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110346171 CN102399767B (en) | 2011-11-04 | 2011-11-04 | Cellulose Cel5A with wide pH range as well as gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102399767A CN102399767A (en) | 2012-04-04 |
| CN102399767B true CN102399767B (en) | 2013-05-01 |
Family
ID=45882418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110346171 Active CN102399767B (en) | 2011-11-04 | 2011-11-04 | Cellulose Cel5A with wide pH range as well as gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102399767B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624137A (en) * | 2003-12-01 | 2005-06-08 | 广西大学 | Coding gene of cellulose of glycosyl hydrolase family 5 and its application |
| CN101372693A (en) * | 2008-07-01 | 2009-02-25 | 吉林大学 | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use |
-
2011
- 2011-11-04 CN CN 201110346171 patent/CN102399767B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1624137A (en) * | 2003-12-01 | 2005-06-08 | 广西大学 | Coding gene of cellulose of glycosyl hydrolase family 5 and its application |
| CN101372693A (en) * | 2008-07-01 | 2009-02-25 | 吉林大学 | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use |
Non-Patent Citations (4)
| Title |
|---|
| 一株嗜酸性产纤维素酶真菌的特性及产酶条件优化;谢天文;《应用与环境生物学报》;20000630(第6期);全文 * |
| 产耐碱性纤维素酶丝状真菌的筛选及鉴定;姚强;《山东大学学报(理学版)》;20050131(第1期);全文 * |
| 姚强.产耐碱性纤维素酶丝状真菌的筛选及鉴定.《山东大学学报(理学版)》.2005,(第1期),全文. |
| 谢天文.一株嗜酸性产纤维素酶真菌的特性及产酶条件优化.《应用与环境生物学报》.2000,(第6期),全文. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102399767A (en) | 2012-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Florencio et al. | Secretome analysis of Trichoderma reesei and Aspergillus niger cultivated by submerged and sequential fermentation processes: enzyme production for sugarcane bagasse hydrolysis | |
| Robl et al. | The capability of endophytic fungi for production of hemicellulases and related enzymes | |
| CN102762727B (en) | The host cell of the enzyme for lignocellulose degradation material can be produced | |
| CN103348005B (en) | Mutant cellobiohydrolase | |
| CN103842515A (en) | Method for reducing viscosity in saccharification process | |
| CN103502444A (en) | Glycosyl hydrolase enzymes and uses thereof for biomass hydrolysis | |
| Li et al. | Expression of a recombinant Lentinula edodes cellobiohydrolase by Pichia pastoris and its effects on in vitro ruminal fermentation of agricultural straws | |
| CN104109660A (en) | Enzyme activity enhanced xylanase | |
| WO2013029170A1 (en) | A process for producing cellulase mixtures from myceliophthora and related organisms | |
| CN108048473A (en) | A kind of feruloyl esterase gene, engineering strain and preparation method and purposes | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| Dadwal et al. | Diversity in cellulose-degrading microbes and their cellulases: role in ecosystem sustainability and potential applications | |
| MX2011000552A (en) | Modified family 6 glycosidases with altered substrate specificity. | |
| CN103343112B (en) | High-temperature alkaline xylanase XYN11A as well as gene and application thereof | |
| Turaeva et al. | Isolation and identification of bacteria with cellulolytic activity from the microflora of animal juice | |
| Sakka et al. | Molecular breeding of cellulolytic microbes, plants, and animals for biomass utilization | |
| CN102399767B (en) | Cellulose Cel5A with wide pH range as well as gene and application | |
| CN102732492A (en) | Heat-resistant neutral cellulase Ce145 and its gene and use | |
| CN114317500A (en) | Xylanase Scxyn5, and coding gene and application thereof | |
| CN111100853B (en) | Xylanase xyn11A, and coding gene and application thereof | |
| CN102363772B (en) | Acidic cellulase EGI, gene thereof and application thereof | |
| CN1313609C (en) | Cellulase and its coding gene and application | |
| CN102154244B (en) | High-temperature acid cellulase EgG5 and gene and application thereof | |
| CN103756919A (en) | Xylanase recombination strain and application thereof | |
| CN102978184B (en) | High-specific-activity and wide-pH-range beta-glucanase R-BgluA, and gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200831 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100086 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |