CN102382801B - Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells - Google Patents
Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells Download PDFInfo
- Publication number
- CN102382801B CN102382801B CN 201110329355 CN201110329355A CN102382801B CN 102382801 B CN102382801 B CN 102382801B CN 201110329355 CN201110329355 CN 201110329355 CN 201110329355 A CN201110329355 A CN 201110329355A CN 102382801 B CN102382801 B CN 102382801B
- Authority
- CN
- China
- Prior art keywords
- sirt1
- msc
- stem cell
- mescenchymal stem
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses an application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1), namely promoting proliferation and delaying senility of mesenchymal stem cells. The experimental result shows that the SIRT1 is needed by the in vitro proliferation of the mescenchymal stem cells, and the condition is verified by MSC (mesenchymal stem cells from marrow) and MSC from fat, and the proliferation and the senility of the MSC can be regulated by regulating the expression level of SIRT1 in the MSC. The invention has very important significances on the determination of the regulation mechanism of the proliferation and the senility of the MSC, the prolonging of the service life of the MSC, and the histocyte substitution and repairing treatment based on the MSC, and is broad in application prospect.
Description
Technical field
The invention belongs to the new purposes of enzyme, particularly relate to the application of silent mating type information regulation 2 homolog 1 in regulation and control mescenchymal stem cell propagation and aging.
Background technology
SIRT1 (silent mating type information regulation 2homolog 1) is a member of Sirtuin family (SIRT1-7), is the albumen deacetylase that a kind of multi-functional NAD from bacterium to human high conservative relies on.It can prolong the life-span of the unicellular lower eukaryotes such as yeast, fruit bat and nematode.In the high animals such as mouse and people, its participates in regulation and control malignant tumour generation and chemotherapy resistance, stress response, cellular metabolism and the multiple vital movement such as aging, thereby causes extensive concern as the potential target of the diseases such as treatment malignant tumour, diabetes, vessel aging and Parkinson.
Marrow or adipose-derived mescenchymal stem cell (MSC) possess following advantage: 1) draw materials conveniently, be easy to the separation and Culture amplification; 2) have immunoregulation capability, but allotransplantation MSCs inducing immune tolerance; 3) genetic background is stable, is fit to do the carrier cell of gene therapy; 4) have multi-lineage potential, can be divided into the various kinds of cell such as bone, cartilage, fat, endothelium, nerve and pancreas islet sample.These advantages make it become tissue and the desirable seed cell of cell engineering.But in the amplification in vitro culturing process, the propagation of MSC is stagnated (growth arrest) very soon, and cell is old and feeble gradually, and this is to affect at present the major obstacle that MSC uses.Thereby clear and definite mescenchymal stem cell propagation and old and feeble regulatory mechanism, in the life-span of prolongation MSC, in and repairing and treating alternative based on the histocyte of mescenchymal stem cell, have potential using value.
Summary of the invention
The new purposes that the purpose of this invention is to provide a kind of silent mating type information regulation 2 homolog 1 is namely promoting mescenchymal stem cell propagation and the application that delays in its aging.
Described mescenchymal stem cell can derive from marrow and fat.
Specifically, the described method of mescenchymal stem cell aging that delays with SIRT1 is for crossing expression SIRT1 in mescenchymal stem cell.
Specifically, describedly promote that with SIRT1 the method for mescenchymal stem cell propagation is one of following:
Method 1) in mescenchymal stem cell, crosses expression SIRT1;
Method 2) processes mescenchymal stem cell with the activator of SIRT1.
The described method of excessively expressing SIRT1 in mescenchymal stem cell is preferably utilizes the recombined lentivirus vector system that the SIRT1 gene is imported mescenchymal stem cell, and SIRT1 must be expression, specifically may further comprise the steps:
A) with in the goal gene transfer vector in the SIRT1 gene importing slow virus carrier system, obtain carrying the recombined lentivirus vector of SIRT1 gene;
After two kinds of packaging plasmids in the recombined lentivirus vector that B) will carry the SIRT1 gene and the slow virus carrier system and coating plasmid mix by the ratio of weight and number of 4.5-5.5: 3.7-4.7: 1.5-2.5: 2.3-3.3, with liposome mediated-method transfection slow virus packing cell, obtain carrying the recombinant slow virus of SIRT1 gene;
C) will carry the recombinant slow virus transfection mescenchymal stem cell of SIRT1 gene, obtain expressing the mescenchymal stem cell of SIRT1.
Described method 2) activator of SIRT1 can be illiterate person reed alcohol (resveratrol) or Isonicotinamide (isonicotinamide) in; The method that described activator with SIRT1 is processed mescenchymal stem cell is: 1 * 105 MSC is inoculated in six orifice plates, uses the illiterate person reed alcohol of 1-20 μ m concentration to join in the middle of the substratum, continue to cultivate 3 days; The concentration of described illiterate person reed alcohol is preferably 5 μ m or 20 μ m, especially is preferably 20 μ m.
Application of the present invention also is included in to cross in the mescenchymal stem cell also to cross to express when expressing SIRT1 nicotinamide phosphoribosyl transferase (Nampt); The described method of crossing expression is preferably utilizes the recombined lentivirus vector system that SIRT1 gene and Nampt gene are imported respectively mescenchymal stem cell, SIRT1 and Nampt coexpression.
The invention provides a kind of new purposes of silent mating type information regulation 2 homolog 1, i.e. application in regulation and control mescenchymal stem cell propagation and aging.Experimental result shows, the expression level of SIRT1 is higher among the MSC of proliferation period, and the expression level of SIRT1 is very low in the MSC of aging, even expresses (seeing Fig. 1), crosses to express the SIRT1 gene and can promote the propagation of MSC and prolong its life-span in MSC; SIRT1 is Knockdown (siRNA of expression inhibiting SIRT1 genetic expression in the MSC) propagation that can significantly slow down the mescenchymal stem cell of derived from bone marrow specifically, the S phase cell of Brdu mark is obviously reduced, prolongation along with incubation time, compare with control cells, the senile cell number also significantly increases (seeing Fig. 5); In addition, in the mescenchymal stem cell of adipose tissue-derived, SIRT1 Knockdown also has same effect (seeing Fig. 5).These results show, SIRT1 is essential by derived mesenchymal stem cells in vitro propagation, all are verified in the MSC of derived from bone marrow and adipose-derived MSC, thereby can regulate and control by the expression level of SIRT1 among the regulation and control MSC propagation and the aging of MSC.The present invention prolongs the life-span of MSC to clear and definite mescenchymal stem cell propagation and old and feeble regulatory mechanism, and tool is of great significance in and repairing and treating alternative based on the histocyte of mescenchymal stem cell, has a extensive future.
Description of drawings
Fig. 1 is expression level and the propagation of MSC and the detected result of the relation of aging of SIRT1
Fig. 2 is the technological line of proof SIRT1 to the regulating and controlling effect of MSC propagation and aging
Fig. 3 uses based on the carrier system of slow virus to cross the negative dominant mutant H363Y that expresses SIRT1 and enzymic activity inactivation thereof in MSC, observe propagation and the old and feeble situation of MSC, the excessively expression of clear and definite SIRT1 and enzymatic activity high can promote MSC propagation and the detected result that prolongs its life-span
Fig. 4 is Brdu dyeing and the PI coloration result of MSC propagation after processing with the activator of SIRT1 and old and feeble situation, clear and definite SIRT1 cross expression and enzymatic activity high can promote the detected result that MSC breeds and prolongs its life-span
Fig. 5 is the siRNA of using based on carrier system expression inhibiting SIRT1 genetic expression in MSC of slow virus, observes propagation and the old and feeble situation of MSC, and the low expression of clear and definite SIRT1 and low enzymic activity can promote the MSC aging and shorten the detected result in its life-span
Fig. 6 is that at present known cell proliferation is stagnated and old and feeble signal transduction mechanism
Fig. 7 be SIRT1 be activated or the MSC that suppresses in the detected result of p21Cip1 and p16INK4a expression level
Embodiment
Embodiment implements under take technical solution of the present invention as prerequisite, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.
Method therefor is ordinary method if no special instructions among the following embodiment.
The part detection method is as follows:
PI (propidine iodine) dyeing: use trypsin digestion and cell, ℃ fixedly spend the night with 70% ethanol-20,37 ℃ of RNase A that add 100 μ L final concentrations after the washing and be 1mg/mL processed 30 minutes, PI staining fluid (prescription: 5mg PI+0.1mL Triton X-100+3.7mg EDTA+10mLPBS, 4 degree keep in Dark Place) the room temperature dyeing that adds at last 300 μ L 50mg/mL after 30 minutes the upflowing cell instrument detect the cell cycle.
Brdu dyeing: the triplicate kind of MSC is entered 24 orifice plates, make its reach 30% converge after, adding final concentration is the Brdu (available from Sigma company) of 10mM, hatched 4 hours for 37 ℃, use subsequently methyl alcohol: acetone (1: 1) stationary liquid is fixed 20 minutes under-20 ℃, 2M HCl room temperature treatment 30 minutes, with anti-Brdu antibody (available from Invitrogen company) the room temperature dyeing of the Alexa-594 mark of dilution in 1: 200 60 minutes, redye nucleus with DAPI at last, microscopically is counted red cell (positive cell, the cell that BrdU mixes also is the cell that is in proliferation period) and the quantity of blue cell (all viable cell).
Senescence associated-β-galactosidase (SA-β-Gal) dyeing: with 1 * 10
4Individual MSC cell kind enters 24 orifice plates, in triplicate, make its reach 50% converge after, fix 5 minutes with 2% formaldehyde-0.2% glutaraldehyde stationary liquid room temperature, add X-Gal staining fluid (1mg/mL X-gal, 40mmol/L citric acid/sodium phosphate (pH 6.0), the 5mmol/L Tripotassium iron hexacyanide, the 5mmol/L yellow prussiate of potash, 150mmol/L NaCl, 2mmol/L MgCl
2) 37 ℃ hatched 12 hours, microscopically is observed counting blue cell ratio.
AnnexinV dyeing: use available from the biological AnnexinV staining kit of triumphant base, concrete dyeing process is: 1. attached cell is collected (annotate: the trysinization time is difficult for long, otherwise easily causes false positive) with the trysinization that does not contain EDTA; 2. collect 1-5 * 10 with PBS washed cell secondary (the centrifugal 5min of 2000rpm)
5Cell; 3. the Binding Buffer suspension cell that adds 500 μ L; 4. after adding 5 μ L Annexin V-FITC mixings, add 5 μ L Propidium Iodide, mixing; 5. room temperature, lucifuge are reacted 5-15min; 6. in 1 hour, carry out observation and the detection of following fluorescent microscope or flow cytometer.
Embodiment 1, SIRT1 are to the regulation and control of mescenchymal stem cell (MSC) propagation with aging
One, detects expression level and the propagation of MSC and the old and feeble relation of SIRT1
Adopt conventional density gradient centrifugation associating stationary culture from people's marrow and fatty tissue, to separate the MSC that increases, external continue to go down to posterity cultivate until old and feeble, collect different donors (donor 1,2,3), different algebraically (4,7,8,12,14,17 generations) cell, detect expression (the expression level Western Blot method detection of SIRT1, primary antibodie is the anti-human SIRT1 antibody of rabbit (available from Epitomics company), two anti-are goat anti-rabbit antibodies (available from company of middle China fir Golden Bridge) and (cell counting of MSC propagation, PI dyeing and Brdu dyeing) and old and feeble (SA-β-Gal dyeing) index, whether relevantly analyze between the two.
Wherein, (A-MSC represents adipose-derived mescenchymal stem cell to Western Blot detected result, and B-MSC represents the mescenchymal stem cell of derived from bone marrow as shown in Figure 1; β-actin albumen is as confidential reference items), the expression level that can find out SIRT1 among the MSC that is in proliferation period is higher, and the expression level of SIRT1 is very low in the MSC of aging, even do not express, thereby the propagation of expression level and the MSC of proof SIRT1 is relevant with aging, and along with the expression level of the old and feeble SIRT1 of cell progressively reduces.
As shown in Figure 2 technological line proof SIRT1 can promote MSC propagation and delay senility, and concrete grammar is shown in following step 2, three, four:
Two, SIRT1 is to the regulation and control of MSC propagation
Prove further that with following experiment SIRT1 promotes the propagation of MSC and delays the effect of MSC aging:
Test 1, use based on the carrier system of slow virus and in the MSC of derived from bone marrow, cross the negative dominant mutant of expressing SIRT1 and enzymic activity inactivation thereof
H363Y (negative control; SIRT1 is the finger protein deacetylase; H363Y is the mutant of silent mating type information regulation 2 homolog 1; hold the 363rd amino acids residue to become Y by H from N SIRT1 exactly specifically; thereby silent mating type information regulation 2 homolog 1 is lost activity; simultaneously owing to deactivated albumen deacetylase H363Y in cell and the activated silent mating type information regulation 2 homolog 1 existence of tool competitiveness; so after cell inner expression H363Y, can weaken the effect of SIRT1); observe the propagation (cell counting of MSC; PI dyeing; AnnexinV dyeing and Brdu dyeing) and old and feeble (SA-β-6al dyeing) situation; the mistake of clear and definite SIRT1 is expressed and whether enzymatic activity high can promote MSC propagation and prolong its life-span, and concrete grammar is as follows:
1.1 Western Blot detects the expression level of crossing of SIRT1
1.1.1 the acquisition of SIRT1 gene and SIRT1-H363Y gene (may further comprise the steps (restriction endonuclease, quick links test kit, fragment fill test kit all available from TaKaRa company, and glue reclaims test kit available from Promega company) referring to the step concrete grammar:
1. enzyme is cut carrier pBable-H363Y and pBable-Sirt1 (Addgene purchase)
The enzyme system of cutting is: plasmid 5ug, and BamH I 1ul, Buffer K 5ul, water postreaction system is to 50ul, and reaction conditions is: 30 ℃ were reacted 2 hours.
2. enzyme is cut carrier pBplv (available from Invitrogen company)
The enzyme system of cutting is: plasmid 5ug, and Sal I 1ul, Buffer H 2ul, water postreaction system is to 20ul, and reaction conditions is: 37 ℃ were reacted 4 hours.
3. the enzyme in the step 1 being cut product uses glue to reclaim test kit recovery endonuclease bamhi
1) BufferDE-A of adding 150ul in 75 ℃ of heating, is interrupted and mixes until gel piece melts fully after mixing.
2) add the BufferDE-B of 75ul, mix, add the color of mixture behind the BufferDE-B for yellow, fully mixing is to guarantee to form the yellow solution of homogeneous.
3) the 2mL centrifuge tube that provides in the test kit is provided the preparation pipe that provides in the test kit, draws step 2) in mixed solution, transfer to DNA preparation pipe, the centrifugal 1min of 12000 * g, suction strainer liquid join DNA and prepare in the pipe, repeated centrifugation is once abandoned filtrate.
4) will prepare pipe and put back the 2mL centrifuge tube, and add 500ul BufferW1, the centrifugal 30s of 12000 * g abandons filtrate.
5) will prepare pipe and put back the 2mL centrifuge tube, and add 700ul BufferW2, the centrifugal 30s of 12000 * g abandons filtrate.With same method again with 700ul BufferW2 washing once, the centrifugal 1min of 12000 * g.
6) will prepare pipe and put back in the 2mL centrifuge tube, the centrifugal 1min of 12000 * g.
7) filtrate is placed clean 1.5mL centrifuge tube (test kit provides), add in advance in water-bath with the deionized water 43ul of 65 ℃ of preheatings in preparation periosteum central authorities, room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000 * g.Then filtrate is joined preparation periosteum central authorities once centrifugal again.
4. the recovery product in the step 3 is filled
Reaction system: the recovery product 43ul in the step 3,10 * buffer 5ul, dNTP (2.5um) 1ul, reaction conditions is: 37 ℃ were reacted 20 minutes.
5. the product in the step 4 being carried out purifying with the method for step 3 reclaims
6. the product of step 5 being carried out enzyme cuts
The enzyme system of cutting is: the product 17ul of step 5, and Buffer H 2ul, Sal I 1ul, reaction conditions is: 37 ℃ were reacted 2 hours.
7. the enzyme of step 6 is cut product and carry out 1% agarose gel electrophoresis, reclaim the fragment of 2.2Kb size, recovery method is with step 3.
8. the product in the step 2 being carried out purifying with the method for step 3 reclaims.
9. the product in the step 8 being carried out enzyme cuts
The enzyme system of cutting is: the product 15ul of step 8, and Buffer T 2ul, BSA 2ul, Sma I 1ul, reaction conditions is: 37 ℃ were reacted 2 hours.
10. the enzyme of step 9 is cut product and carry out 1% agarose gel electrophoresis, reclaim the fragment of 8Kb size, recovery method is with step 3.
11. the product of step 7 and step 10 is mixed according to the ratio of 7ul: 3ul, and adds 16 ℃ of connections of 10ul solusion I 2 hours, carried respectively the carrier of H363Y gene and SIRT1 gene, called after pBplv-H363Y and pBplv-SIRT1.
The recombined lentivirus vector that obtains is carried out enzyme with restriction enzyme EcoR V and Sal I cut evaluation, enzyme is cut product carry out the detection of 1% agarose gel electrophoresis, the result cuts through enzyme and has obtained the approximately dna fragmentation of 2000bp, conform to expected results, show the recombined lentivirus vector that has obtained to carry the SIRT1 gene, with its called after pBPLV-SIRT1.Make up the recombined lentivirus vector that obtains carrying the H363Y gene with method same as described above equally, with its called after pBplv-H363Y.
1.1.2 slow virus packing
Cultivate 293-FT (available from Invitrogen company) slow virus packing cell, substratum is for adding 10%FBS, 0.1mmol/L NEAA, the 2mmol/L L-glutaminate, 1% green grass or young crops-Streptomycin sulphate, and the DMEM in high glucose substratum of 500 μ g/mL G418 (Sigma company product, Cat#D5648).The recombined lentivirus vector pBPLV-SIRT1 that carries the SIRT1 gene with step 1.1.1 structure, carry the recombined lentivirus vector pBplv-H363Y (negative control) of SIRT1-H363Y gene and empty carrier pBPLV (blank) respectively with packaging plasmid pLP1 (available from Invitrogen company), pLP2 (available from Invitrogen company) and envelope protein plasmid pLP/VSVG (available from Invitrogen company) add the 1.5mL serum-free after mixing in the ratio of 5ug: 4.2ug: 2ug: 2.8ug
In the I substratum (available from Invitrogen company), mixing gently is diluted in 42ul lipofectamine 2000 (available from Invitrogen company) serum-free of 1.5mL in another aseptic 5mL pipe
In the I substratum, room temperature left standstill 5 minutes, mixed above two kinds of liquid, and incubated at room 20 minutes is to form DNA-lipofectamine 2000 mixtures.(Gibco company product, Cat#25200-056) 293-FT cell that collect to cultivate of digestion count approximately 6 * 10 with 0.25% pancreatin
6Individual cell, it is resuspended to 5mL does not contain antibiotic growth medium (at DMEM in high glucose substratum (Sigma company product, Cat#D5648) add 10% foetal calf serum (FBS) (Biochrom company product on the basis, cat#S0115), 0.1mmol/L non-essential amino acid (Non-Essential Amino Acids, NEAA) (available from HyClone company) and 2mmol/L L-glutaminate) in, again 293-FT packing cell suspension and 3mL are contained to join behind the substratum mixing of DNA-lipofectamine 2000 mixtures and contain in the 10cm Tissue Culture Dish that 5mL do not contain antibiotic growth medium, mixing is put in 37 ℃, 5%CO
2Cultivate in the incubator, the inferior daily perfect medium of 1mmol/L Sodium.alpha.-ketopropionate that contains is (at the basis of DMEM in high glucose substratum interpolation 10% foetal calf serum, 0.1mmol/L non-essential amino acid, the 2mmol/L L-glutaminate, 1% green grass or young crops-Streptomycin sulphate and 1mmol/L Sodium.alpha.-ketopropionate) change the substratum contain DNA-lipofectamine 2000 mixtures and pack, and respectively in packing 24, sampling after 72 hours, to observing under fluorescent microscope through the 293-FT cell of packing, the result packs can see after 24 hours has green fluorescent protein eGFP to express (the eGFP gene is that lentiviral vectors pBPLV carries) in the 293-FT cell, the cell of expressing green fluorescent protein eGFP surpasses 95%, show that packaging efficiency is very high, and be accompanied by the expression of VSVG gene among the coating plasmid pLP/VSVG, engender the many cells synplasm of 293-FT cell, pack that culture supernatant is faint yellow after 72 hours, collect the virus liquid supernatant this moment in the aseptic centrifuge tube of 15mL, 4 ℃, the centrifugal 15min of 3000rpm removes cell debris, for get rid of cell conditioned medium collect in the liquid other not principal component on stem cells hyperplasia and old and feeble impact, with 10%PEG8000 slow virus is concentrated, viral supernatant is frozen for subsequent use in-70 ℃.
1.1.3 the flow cytometry sorting of MSC after slow virus infection MSC and the infection
Virus infection is inoculated MSC the day before yesterday in six orifice plates, to cell density be 3 * 10
5Cells/well, during infection, cleer and peaceful final concentration is the polybrene (polybrene of 8 μ g/mL on the virus that every hole adding 1mL step 1.1.2 obtains, available from Sigma company) the viral transfection efficiency of promotion, rocking culturing bottle makes virus liquid can touch all cells, (DMEM-hangs down sugar culture-medium to add 3mL MSC cell culture medium after 3 hours, available from Sigma company) to add concentration expressed in percentage by volume after mixing by 1: 1 volume ratio be 10% foetal calf serum (Biochrom company product, cat#S0115), after 3h, the substratum that more renews.The fluorescent microscope observed result shows that slow virus can high efficiency transfection MSC, cell after the transfection carries out sorting by flow cytometry, and infection is had the recombined lentivirus vector pBPLV-SIRT1 that carries the SIRT1 gene, infects MSC respectively called after MSC-SIRT1, MSC-H363Y and MSC-pBPLV that the recombined lentivirus vector pBplv-H363Y that carries the H363Y gene and empty carrier pBPLV are arranged.
1.1.4 Western blot method detects the expression level of transfectional cell SIRT1
Get respectively among the step 1.1.3 through 1 * 10 of sorting acquisition
6Individual MSC-SIRT1, MSC-H363Y (negative control) and MSC-pBPLV (blank, Mock), with radioimmunoassay precipitation lysis buffer RIPA (50mmol/LTrisHCl (pH8.0), 150mmol/L NaCl, 1mmol/L DTT, 0.5mmol/L EDTA, 1.0%NP40,0.5% sodium deoxycholate, 0.1%SDS, 100 μ g/mL PMSF, 1 μ g/mL tryptic peptide, the bright inhibiting peptide of 2 μ g/mL, 100 μ mol/L sodium vanadates) lysing cell, then lysing cell is carried out discontinuous SDS-polyacrylamide gel electrophoresis (SDS-PAGE), the method that turns with the half dry type electricity again moves to pvdf membrane with protein transduction, then with 5% skim-milk sealing 2h, again with corresponding primary antibodie (the anti-human SIRT1 antibody of rabbit, available from Epitomics company) and after two anti-goat anti-rabbit antibodies (available from company of middle China fir Golden Bridge) hatch, with chemical illuminating reagent (available from Santa Cruz company, Cat#:SC-2048) in the darkroom autography, use equally β-actin albumen as confidential reference items (primary antibodie is the polyclonal antibody of mouse anti human β-actin, available from Chemicon company).Detected result is shown in the figure A among Fig. 3, and the SIRT1 among the MSC-SIRT1 and the H363Y in the negative control obtain to express (expression level does not have difference) at protein level, and blank pBPLV only has the expression of trace.
1.2Brdu dyeing, SA-β-Gal dyeing and accumulation cell colony doubly rise in value, and crossing of detection SIRT1 expressed and whether enzymatic activity high can promote MSC propagation and prolong its life-span
Observe the propagation (cell counting of above-mentioned MSC/SIRT1, MSC/H363Y and MSC/pBPLV, PI dyeing, AnnexinV dyeing and Brdu dyeing) and old and feeble (SA-β-Gal dyeing) situation, the crossing of clear and definite SIRT1 expressed and whether enzymatic activity high can promote MSC to breed and prolong its life-span.(X-coordinate represents the time to the Brdu coloration result of the 10th day, the 38th day MSC shown in figure B among Fig. 3 after the slow virus infection, ordinate zou represents the cell proportion that BrdU mixes, * expression and control group relatively have statistical significance), be in as seen from the figure the MSC cell showed increased of proliferation period after the high expression level of SIRT1, the high expression level that shows SIRT1 can promote the propagation of cell; (X-coordinate represents the time to the SA-β of the 10th day, the 38th day MSC-Gal coloration result shown in figure C among Fig. 2 after the slow virus infection, ordinate zou represents the ratio of SA-β-Gal stained positive cell, it is the ratio of senile cell, * expression and control group relatively have statistical significance), old and feeble cell is less than control group after the high expression level of SIRT1 as seen from the figure, shows that the high expression level of SIRT1 can delaying cell aging; (X-coordinate represents the time to the 0th, 35,70,105 day MSC cell growth curve shown in the figure D among Fig. 3 after the slow virus infection, ordinate zou represents to accumulate cell colony PDs=lg (the front cell counting of cell counting after cultivating/cultivations)/lg2 that doubly rises in value, with each for the cumulative accumulation cell colony that namely gets finally of PDs value (the cumulative population doublings that doubly rises in value, CPDs), the expression of SIRT1 can make the MSC cell keep preferably vegetative state as seen from the figure, and the expression that shows SIRT1 has promoted the propagation of MSC cell.Above-mentioned detected result has proved that crossing of SIRT1 expressed and enzymatic activity high can promote MSC propagation and prolong its life-span.
Need to prove: Nampt is a kind of rate-limiting enzyme that the nicotinamide that will suppress the SIRT1 enzymic activity is converted to the essential NAD of enzymic activity, if in the situation of the DeGrain of SIRT1, can change Nampt over to, improve the activity of SIRT1 with this, but above experiment has confirmed that the effect of SIRT1 independent role is just very obvious, therefore generally no longer needs jointly to change over to Nampt.If wish to improve expression efficiency in the application, can be with SIRT1 and Nampt coexpression.Therefore, SIRT1 and Nampt coexpression also belong to one of embodiments of the present invention.
3.1 process the MSC of derived from bone marrow with the activator resveratrol (illiterate person reed alcohol) of SIRT1, take unprocessed MSC as contrast, treatment process is: with 1 * 10
5Individual MSC is inoculated in six orifice plates, uses the illiterate person reed alcohol of 1 μ m, 5 μ m, 20 μ m concentration to join respectively in the middle of the substratum, continues to cultivate 3 days.
3.2 whether excessively expression and the enzymatic activity high of Brdu dyeing, PI staining examine SIRT1 can promote MSC propagation
Observe the above-mentioned MSC that processes through activator and propagation (PI dyeing and the Brdu dyeing) situation of contrast MSC, the crossing of clear and definite SIRT1 expressed and whether enzymatic activity high can promote MSC to breed and prolong its life-span.Brdu coloration result (cell proportion that BrdU mixes shown in figure A among Fig. 4 through MSC after activator 5um, 20um process, * expression and control group relatively have statistical significance), be in as seen from the figure the cell showed increased of proliferation period after the high expression level of SIRT1, the activation that shows SIRT1 can promote the propagation of MSC cell.The PI coloration result of MSC is shown in the figure B among Fig. 4 after activator 5um, 20um process, and the MSC after activator is processed is in the cell count showed increased of S phase, and the activation that further proves SIRT1 can promote the propagation of MSC cell.
In derived from bone marrow and adipose-derived MSC, suppress SIRT1 with the siRNA that suppresses SIRT1 genetic expression with based on the carrier system of slow virus, observe the propagation (cell counting of MSC, PI dyeing, AnnexinV dyeing and Brdu dyeing) and old and feeble (SA-β-Gal dyeing) situation, whether the low expression of clear and definite SIRT1 and low enzymic activity can promote that MSC is old and feeble and shorten its life-span, and concrete grammar is as follows:
1.1 Western Blot detects the expression level of expressing SIRT1 among the MSC that the siRNA that suppresses SIRT1 genetic expression is arranged
1.1.1 suppress the acquisition of the siRNA of SIRT1 genetic expression
At first find the open reading frame total length of people SIRT1 gene at GenBank, for the lentiviral vectors pSicor that selects, RNAi principle of design (Elbashir SM according to Elbashir, Harborth J, Lendecke lW, et al.Duplexes of 21-nucleotide RNAs mediate RNA interference In culturedMammalian cells.Nature.2001; 411:494-498.), design online by http://www.ambion.com/techlib/misc/siRNA_finder.htmL simultaneously, 2 target position of final selection, lay respectively at 2 sections sequences in SIRT1 gene mRNA sequence transcription initiation site aug downstream, the siRNA difference called after siRNA-1 and the siRNA-2 that 2 couple who obtains are suppressed SIRT1 genetic expression, siRNA-1 act on the sequence 5 of SIRT1mRNA '-GAAGTGCCTCAGATATTAA-3 ', siRNA-2 acts on the sequence 5 ' of SIRT1 mRNA-GTTGACCTCCTCATTGTTA-3 '.
1.1.2, suppress the structure of the RNAi slow virus interference carrier of SIRT1 genetic expression
According to the service requirements of target sequence and the carrier pBPLV of siRNA-1 and siRNA-2 effect, design can produce the siDNA sequence of siRNA-1 and siRNA-2, respectively called after shsirt11 and shsirt12, and concrete sequence is as follows:
The shsirt11 positive-sense strand:
5 '-TGAAGTGCCTCAGATATTAATTCAAGAGATTAATATCTGAGGCACTTCTTTTTTC-3 ' (sequence 1 in the sequence table)
The shsirt11 antisense strand:
5 '-TCGAGAAAAAAGAAGTGCCTCAGATATTAATCTCTTGAATTAATATCTGAGGCACT TCA-3 ' (sequence 2 in the sequence table);
The shsirt12 positive-sense strand:
5 '-TGTTGACCTCCTCATTGTTATTCAAGAGATAACAATGAGGAGGTCAACTTTTTTC-3 ' (sequence 3 in the sequence table)
The shsirt12 antisense strand:
TCGAGAAAAAAGTTGACCTCCTCATTGTTATCTCTTGAATAACAATGAGGAGGTCA ACA-3 ' (sequence 4 in the sequence table).
After the positive-sense strand of shsirt11 and shsirt12 and antisense strand annealed in twos, again under the effect of T4DNA ligase enzyme respectively with goal gene transfer vector pBPLV in the slow virus carrier system of restriction enzyme Hpa I and Xho I double digestion in, the recombined lentivirus vector that obtains is carried out enzyme with restriction enzyme Xho I and Xbal I cut evaluation, enzyme is cut product carry out the detection of 1% agarose gel electrophoresis, the result has not obtained the big or small dna fragmentation that differs 50bp through the enzyme cutting, conform to expected results, show the recombined lentivirus vector that has obtained to carry respectively shsirt11 and shsirt12, called after pSicor-shsirt11, pSicor-shsirt12.
1.1.3 slow virus packing
Identical in method and the step 2.
1.1.4 the flow cytometry sorting of MSC after slow virus infection MSC and the infection
Slow virus with the recombined lentivirus vector pSicor-shsirt11, the pSicor-shsirt12 that carry shsirt1, shsirt12 and unloaded pSicor infects respectively MSC, and method is identical with step 2.The fluorescent microscope observed result shows that slow virus can high efficiency transfection MSC, cell after the transfection carries out sorting by flow cytometry, and infection is had the recombined lentivirus vector pSicor-shsirt11 that carries the SIRT1 gene, MSC difference called after ShSIRT1-1, ShSIRT1-2 and the Mock that infection has recombined lentivirus vector pSicor-shsirt12 and empty carrier pSicor.
1.1.6 Western blot method detects the expression level of transfectional cell SIRT1
Get respectively among the step 1.1.4 through 1 * 10 of sorting acquisition
6Individual MSC/shSIRT11, MSC/shSIRT2 and blank Mock use the method identical with step 2 to detect the protein expression level of SIRT1 gene.(A-MSC represents adipose-derived MSC to detected result shown in the A width of cloth among Fig. 5, B-MSC represents the MSC of derived from bone marrow), SIRT1 gene among the blank Mock and β-actin gene all can obtain high level expression at protein level, and ShSIRT1-1 and ShSIRT1-2 only β-actin gene to express at protein level, show that the expression of SIRT1 gene in ShSIRT1-1 and ShSIRT1-2 is suppressed.
2.1 whether the low expression of Brdu dyeing, SA-β-Gal dyeing and PI staining examine SIRT1 and low enzymic activity can promote that MSC is old and feeble and shorten its life-span
Observe above-mentioned through interfere processing MSC and propagation (cell counting, PI dyeing and Brdu dyeing) and old and feeble (SA-β-Gal dyeing) situation of contrast MSC, the crossing of clear and definite SIRT1 expressed and whether enzymatic activity high can promote MSC to breed and prolong its life-span.(A-MSC represents adipose-derived MSC to the cell count statistics of 0-15 days MSC shown in the figure B among Fig. 5 behind the infection slow virus, B-MSC represents the MSC of derived from bone marrow), as seen from the figure (cell counting shows that SIRT1 genetic expression suppressed (knockdown) is slowed down cell proliferation), show that the increment that can suppress cell is expressed in the downward modulation of SIRT1; (A-MSC represents adipose-derived MSC to 5 days Brdu coloration result result shown in the figure C among Fig. 5, figure D behind the infection slow virus, B-MSC represents the MSC of derived from bone marrow), the suppressed BrdU of making of SIRT1 genetic expression mixes remarkable reduction as seen from the figure, shows that the increment that can suppress cell is expressed in the downward modulation of SIRT1; (X-coordinate represents the MSC that different methods is processed to the cell proportion statistics of the 5th day G0-G1 phase cell, S phase cell and G2-M phase cell shown in the figure E among Fig. 5 behind the infection slow virus, ordinate zou represents the cell proportion, * represent variant), SIRT1 genetic expression is in the cell of S phase after suppressed and obviously reduces as seen from the figure, shows that the increment that can suppress cell is expressed in the downward modulation of SIRT1.Thereby the inhibition of SIRT1 is expressed the propagation that can well suppress cell and is promoted cell aging.
On the contrary, in the middle of MSC, raise the expression of SIRT1, find after the SIRT1 up-regulated expression, the Brdu coloration result is shown in the figure B among Fig. 3, after the SIRT1 gene up-regulated expression, the BrdU mixed ratio is significantly improved as seen from the figure, the up-regulated expression that shows SIRT1 can promote the increment of cell; Growth curve is as described in the figure D among Fig. 3, and as seen from the figure, after the SIRT1 gene up-regulated expression, the increment of cell is accelerated; SA-β-Gal coloration result is shown in the figure C among Fig. 3, and senile cell obviously reduces after the SIRT1 gene up-regulated expression, shows that the up-regulated expression of SIRT1 can delay the aging of cell.
Fig. 6 has summarized the mechanism of cell aging known today: approach one: telomere shortening, oncogene activation and active oxygen radical cause dna damage, and damage signal activates p53, and p53 activates p21Cip1, and p21 Cip1 suppresses CDK2 and causes the pRb dephosphorylation; In another approach some old and feeble signal activation p15INK4b or p16INK4a, p15INK4b or p16INK4a suppress CDK4/6 and cause the pRb dephosphorylation.Know; dephosphorylized pRb and acetylizad pRb suppress propagation in conjunction with transcription factor E2F on the one hand and promote transcribing of gene; on the other hand impact propagation promotes the chromatin Structure of gene that its expression is closed; and the binding ability of the pRb of the pRb of high phosphorylation and deacetylation and E2F reduces, and promotes propagation to promote transcribing of gene thereby E2F is released.Therefore, dephosphorylized pRb and acetylizad pRb cause cell inhibitory effect and old and feeble activity form.At present, the regulatory mechanism of people's marrow MSC cell proliferation stagnation and aging is very unclear, and clearer and more definite is that the p16INK4a approach has played vital role in this process.In view of (1) SIRT1 can reduce the expression of p16INK4a in the human embryonic lung fibroblast and the phosphorylation of enhancing pRb; (2) SIRT1 can directly make the pRb deacetylation and inactivation pRb36; (3) SIRT1 can directly make the p53 deacetylation and inactivation p532, infers that SIRT1 may bring into play very important regulating and controlling effect by the activity of one or several molecule among p21Cip1, p16INK4a, pRb and the p53 in the comprehensive regulation people MSC cell in people MSC cell proliferation and aging.
One, among the outer old and feeble MSC of detection bodies and SIRT1 is activated or the MSC that suppresses in the expression of p21Cip1 and p16INK4a, clear and definite which bar path has participated in MSC propagation and old and feeble regulation and control
With among the outer old and feeble MSC of Western blot method detection bodies and SIRT1 is activated or the MSC (MSC-SIRT1, MSC-H363Y, MSC-pBPLV, ShSIRT1-1, ShSIRT1-2 and blank) that suppresses in the expression of p21Cip1 (p21) and p16INK4a (p16), primary antibodie is respectively p21 antibody and p16 antibody, and (p21 antibody is available from Snata Cruz company, p16 antibody is available from BD company), two anti-goat anti-rabbit antibodies and the goat anti-mouse antibodies (available from middle mountain gold bridge company) of being respectively.The result as shown in Figure 7, as seen from the figure, after the expression by the special inhibition SIRT1 of interference vector, the up-regulated of p16, the expression of p21 is substantially constant, crosses after the expression SIRT1, can suppress the expression of p16, the expression level of p21 is substantially constant, illustrates that SIRT1 raises delaying cell aging and the SIRT1 downward modulation promotes that cell aging is by this path of p16, rather than this path of p21.
Claims (5)
1. silent mating type information regulation 2 homolog 1 promotes mescenchymal stem cell propagation and delays its old and feeble method for cross expression SIRT1 in described mescenchymal stem cell with SIRT1 promoting marrow or adipose-derived mescenchymal stem cell propagation and/or delaying the application of non-therapeutic in its aging.
2. application according to claim 1 is characterized in that: the described expression SIRT1 that crosses in mescenchymal stem cell may further comprise the steps:
A) with in the goal gene transfer vector in the SIRT1 gene importing slow virus carrier system, obtain carrying the recombined lentivirus vector of SIRT1 gene;
After two kinds of packaging plasmids in the recombined lentivirus vector that B) will carry the SIRT1 gene and the slow virus carrier system and coating plasmid mix by the ratio of weight and number of 4.5-5.5:3.7-4.7:1.5-2.5:2.3-3.3, with liposome mediated-method transfection slow virus packing cell, obtain carrying the recombinant slow virus of SIRT1 gene; Described two kinds of packaging plasmids sequentially are pLP1 and the pLP2 available from Invitrogen company;
C) will carry the recombinant slow virus transfection mescenchymal stem cell of SIRT1 gene, obtain expressing the mescenchymal stem cell of SIRT1.
3. application according to claim 1 and 2 is characterized in that: described in mescenchymal stem cell, cross to express also to cross to express in the SIRT1 nicotinamide phosphoribosyl transferase Nampt is arranged.
4. application according to claim 3 is characterized in that: the described method of cross expressing is for utilizing the recombined lentivirus vector system that SIRT1 gene and Nampt gene are imported respectively mescenchymal stem cell, SIRT1 and Nampt coexpression.
5. the application of silent mating type information regulation 2 homolog 1 in promoting marrow or adipose-derived mescenchymal stem cell propagation; promote that with SIRT1 the method for mescenchymal stem cell propagation is to process described mescenchymal stem cell with the activator illiterate person reed alcohol of SIRT1, its method is: with 1 * 10
5Individual MSC is inoculated in six orifice plates, uses the illiterate person reed alcohol of 5 μ M or 20 μ M concentration to join in the middle of the substratum, continues to cultivate 3 days.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110329355 CN102382801B (en) | 2011-10-26 | 2011-10-26 | Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110329355 CN102382801B (en) | 2011-10-26 | 2011-10-26 | Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102382801A CN102382801A (en) | 2012-03-21 |
| CN102382801B true CN102382801B (en) | 2013-09-18 |
Family
ID=45822635
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110329355 Active CN102382801B (en) | 2011-10-26 | 2011-10-26 | Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102382801B (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103751806B (en) * | 2014-01-23 | 2015-10-14 | 中国人民解放军第三军医大学第一附属医院 | Interference SIRT1 expresses the application of reagent in the reagent of preparation suppression liver-cancer stem cell dryness transcription factor expression |
| TWI525193B (en) * | 2014-10-20 | 2016-03-11 | 國璽幹細胞應用技術股份有限公司 | Uses of trans-cinnamaldehyde |
| CN105802907B (en) * | 2016-04-20 | 2019-02-12 | 浙江大学 | A kind of cultural method of mesenchymal stem cell |
| CN106011074B (en) * | 2016-06-12 | 2020-12-22 | 广州赛隽生物科技有限公司 | Mesenchymal stem cell with high expression of CXCR5 and preparation and application thereof |
| CN106591372B (en) * | 2016-11-30 | 2021-04-16 | 上海交通大学 | Method for delaying aging caused by in vitro culture of human-derived mesenchymal stem cells |
| CN107502595A (en) * | 2017-09-15 | 2017-12-22 | 浙江大学 | Improve the method for senile rat mesenchymal stem cells MSCs aging state |
| CN108192925A (en) * | 2018-01-23 | 2018-06-22 | 中国人民解放军总医院第附属医院 | Applications of the SIRT3 in old human adipose mesenchymal stem cells rejuvenation is promoted |
| CN108295249A (en) * | 2018-03-09 | 2018-07-20 | 南方医科大学南方医院 | Applications of the Sirt1 in the drug for preparing treatment treating myocardial ischemia damage |
| CN110292629B (en) * | 2019-07-11 | 2020-10-27 | 吉林大学 | Application of hexokinase 1 in delaying senescence |
| CN112522394B (en) * | 2019-09-17 | 2022-12-09 | 中国科学院上海营养与健康研究所 | Novel exosome release related target and application thereof in tumor monitoring and inhibition |
| CN110964751A (en) * | 2019-12-03 | 2020-04-07 | 广州益养生物科技有限公司 | NAMPT (Namptothecine) lentiviral vector, biological agent and application thereof |
| CN113633775A (en) * | 2021-09-01 | 2021-11-12 | 吉林大学 | Application of agent for over-expressing phosphofructokinase in preparation of drugs for delaying cell senescence |
| CN114517177A (en) * | 2022-01-17 | 2022-05-20 | 苏州大学 | Composition for enhancing mesenchymal stem cell efficiency and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009161494A (en) * | 2008-01-09 | 2009-07-23 | Noevir Co Ltd | Sirt1 activator |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7838503B2 (en) * | 2005-06-15 | 2010-11-23 | Children's Medical Center Corporation | Methods for extending the replicative lifespan of cells |
-
2011
- 2011-10-26 CN CN 201110329355 patent/CN102382801B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009161494A (en) * | 2008-01-09 | 2009-07-23 | Noevir Co Ltd | Sirt1 activator |
Non-Patent Citations (5)
| Title |
|---|
| Chung-Lan Kao et al.8. Resveratrol protects human endothelium from H2O2-induced oxidative stress and senescence via SirT1 activation.《Journal of Atherosclerosis and Thrombosis》.2010,第17卷(第9期),970-979. * |
| Hong-Feng Yuan.SIRT1 is required for long-term growth of human mesenchymal stem cells.《J Mol Med》.2011,389-400. |
| Krzysztof Ksiazek.1. A Comprehensive Review on Mesenchymal Stem Cell Growth and Senescence.《Rejuvenation Research》.2009,第12卷(第2期),105-116. * |
| SIRT1 is required for long-term growth of human mesenchymal stem cells;Hong-Feng Yuan;《J Mol Med》;20111027;389-400 * |
| Wagner W. et al.4. Different Facets of Aging in Human Mesenchymal Stem Cells.《Tissue Engineering: Part B》.2010,第16卷(第4期),445-454. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102382801A (en) | 2012-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102382801B (en) | Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells | |
| Li et al. | MiRNA-10b reciprocally stimulates osteogenesis and inhibits adipogenesis partly through the TGF-β/SMAD2 signaling pathway | |
| Kumar et al. | Nuclear import of cytoplasmic poly (A) binding protein restricts gene expression via hyperadenylation and nuclear retention of mRNA | |
| Paranjape et al. | Y box-binding protein-1 binds to the dengue virus 3′-untranslated region and mediates antiviral effects | |
| Nakata et al. | c-Myb, Menin, GATA-3, and MLL form a dynamic transcription complex that plays a pivotal role in human T helper type 2 cell development | |
| Liang et al. | Inhibition of HIV‐1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered into macrophages through hematopoietic progenitor cell transduction | |
| Kwon et al. | The ribonuclease L-dependent antiviral roles of human 2′, 5′-oligoadenylate synthetase family members against hepatitis C virus | |
| CN101117625B (en) | Method for evoking differentiation of mesenchyma stem cell and fat stem cell into neurons and special culture medium thereof | |
| CN101591653A (en) | The liver cell of low-expression CYP 7 A 1 and construction process thereof | |
| Luzi et al. | The regulatory network menin-microRNA 26a as a possible target for RNA-based therapy of bone diseases | |
| Liu et al. | The critical role of myostatin in differentiation of sheep myoblasts | |
| Zhan et al. | A novel long noncoding RNA, lncR-125b, promotes the differentiation of goat skeletal muscle satellite cells by sponging miR-125b | |
| CN107523569A (en) | The purposes and its related drugs of PDCD1 genes | |
| CN115779084A (en) | Application of preparation for activating pig TUSC1 gene expression in preparation of pig pseudorabies virus infection resisting medicine | |
| Wang et al. | Coronavirus transmissible gastroenteritis virus antagonizes the antiviral effect of the microRNA miR-27b via the IRE1 pathway | |
| Malik et al. | Mechanisms ensuring robust repression of the Drosophila female germline stem cell maintenance factor Nanos via posttranscriptional regulation | |
| Huang et al. | MiR-23b targets GATA6 to down-regulate IGF-1 and promote the development of congenital heart disease | |
| CN113637633A (en) | Method for promoting differentiation of mesenchymal stem cells into osteoblasts | |
| CN114426953A (en) | Pluripotent stem cell derivative for expressing IL-12 and application thereof | |
| CN114645021A (en) | Pluripotent stem cell expressing targeted CD47 inhibitory factor, derivative and application thereof | |
| CN114657133A (en) | Pluripotent stem cell for expressing shRNA and/or shRNA-miR of targeted IL-4R alpha | |
| CN101638652B (en) | RNA interfering target of osteoclast V-ATP enzyme proton pump sub-unit ATP6vlcl and application thereof | |
| Liu et al. | Inhibition of EV71 replication by an interferon-stimulated gene product L3HYPDH | |
| Wu et al. | CRISPR-Cas13-Mediated Knockdown of Regulator of G-Protein Signaling 8 (RGS8) Does Not Affect Purkinje Cell Dendritic Development | |
| Liu et al. | Inhibition of EV71 replication by L3HYPDH, a newly identified interferon-stimulated gene product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120321 Assignee: SOUTH CHINA CENTER FOR STEM CELL BIOLOGY AND REGENERATIVE MEDICINE OF ACADEMY OF MILITARY MEDICAL SCIENCES Assignor: Inst. of Field Blood Transfusion, Academy of Military Medical Sciences, PLA Contract record no.: 2015990000123 Denomination of invention: Application of protein acetylation enzyme SIRT1 (Silent Mating type Information Regulation 2Homolog1) in promoting proliferation and delaying senility of mesenchymal stem cells Granted publication date: 20130918 License type: Exclusive License Record date: 20150324 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model |