CN102373231A - Recombinant plasmid containing OATP1B1 promoter and reporter gene and method for screening OATP1B1 inducer - Google Patents

Abstract

The invention belongs to the field of molecular pharmacology, and relates to a method for screening an inducer capable of regulating expression of a downstream target gene organic anion transporter 1B1 through activation on a pregnane X receptor (PXR). The method for screening OATP1B1 inducer comprises cloning organic anion transporter 1B1 (OATP1B1) gene promoter specific sequences (of -128 to -111 and -9957 to -9940), recombining the cloned organic anion transporter 1B1 (OATP1B1) gene promoter specific sequences and firefly luciferase reporter gene vectors, simultaneously, constructing a human PXR expression plasmid, then co-transfecting the constructed OATP1B1-luciferase reporter gene recombinant plasmid, the human PXR expression plasmid and renilla luciferase into a human liver cancer cell HepG2, and simultaneously, and detecting transcription activity of active reaction OATP1B1 gene promoters of firefly luciferase and renilla luciferase so that the method for targetedly screening an OATP1B1 inducer is established. The method for targetedly screening an OATP1B1 inducer can provide a mass of scientific basises for disease treatment, drug interaction, safe and reasonable utilization of drugs, and preclinical study of novel drugs.

Description

A kind of method that contains the recombinant plasmid and the screening OATP1B1 inductor of OATP1B1 promotor and reporter gene

Technical field

The present invention relates to a kind of inductor screening method of regulating its downstream target gene organic anion transporter 1 B1 expression through activation search for pregnane X receptor (PXR).

The invention still further relates to the plasmid that contains the fluorescence report gene.

Background technology

Liver is a bio-transformation toxicide major organs, in liver, has polytype transport of drug body, play an important role for absorption, distribution and the drainage of medicine, and like MRP, mammary cancer drug-resistant protein, organic anion transhipment peptide family etc.OATP1B1 is of paramount importance member in the organic anion transhipment peptide family, and the encoding sox SLCO1B1 of OATP1B1 not only has the height polymorphum, and has found a plurality of mutants with functional meaning.Studied confirmation at present; OATP1B1 transports the multiple endogenous material such as non-binding type UCB, bile acide, Triiodothyronine except that target; Also mediate multiple liver transmembrane transport, like anti-malignant-tumor agent (irinotecan, Rheumatrex), lipid regulating agent (pravastatin, atorvastatin, pitavastatin, superstatin, simvastatin), antihypertensive drug (valsartan, OLM-Mod, bosentan), antihyperglycemic (repaglinide, Starsis) with important clinical significance medicine.The OATP1B1 increased functionality is when (as being induced), and the ability of transhipment substrate improves, and getting into hepatocellular substrate quantity increases; Otherwise when the OATP1B1 function reduced (like the transgenation in some site), the substrate that gets in the liver cell reduced.Therefore the OATP1B1 changing function not only has close ties with hyperbilirubinemia, and is closely related with the curative effect and the toxic side effect of medicine.Full genome association study (Genome-wide Association Study; GWAS) show the * 5/*5 transgenation person of OATP1B1 functional defect; The transhipment SV gets into hepatocellular function to be reduced; Cause SV to transport that into hepatocellular quantity reduces, plasma drug level is too high, cause its lipopenicillinase curative effect to weaken and cause untoward reaction such as myopathy to increase.Therefore, the research medicine has great significance for hyperbilirubinemia treatment and safety of medicine rational Application to the inducing action of OATP1B1, sees the following form.

Relevant informations such as the toxic side effects of OATP1B1 transhipment medicine and solution

Former human liver cell model of being commissioned to train foster is that classical vitro enzyme, transporter induced research model.Yet the human liver cell model receives ethics, tissue-derived, culture condition, can't accomplish numerous restrictions such as high-throughput, in practical study, seldom adopts.Therefore, invent in the development research that a kind of starting material be prone to obtain, novel method easy and simple to handle, with low cost, that can realize high flux screening is applied in the OATP1B1 inductor and seem particularly important.

Summary of the invention

The method that the purpose of this invention is to provide a kind of high flux screening OATP1B1 inductor.

Another object of the present invention provide a kind of OATP1B1 of containing gene promoter (128to-111 with-9957to-9940) with the recombinant plasmid of reporter gene.

The present invention at first provides the recombinant plasmid of a kind of OATP1B1 of containing promotor and reporter gene, and the promoter region of said OATP1B1 is-128to-111 and-9957to-9940.

Reporter gene can be firefly luciferase gene, E.C. 2.3.1.28, alkaline phosphatase enzyme, beta-galactosidase enzymes, green fluorescent protein, β-Nei Xiananmei etc. described in the recombinant plasmid that contains OATP1B1 gene promoter and reporter gene wherein of the present invention.Every kind of luciferase can obtain through commercial sources, also all each has its characteristics.Because the Photinus pyralis LUC detection sensitivity is high, detecting characteristics such as easy is the present the most frequently used reporter gene as promotor research but generally speaking.

The method for preparing recombinant plasmid is known, has for example been discussed the preparation method of recombinant plasmid in detail by " the molecular cloning experiment guide " of Cold Spring Harbor Laboratory press.

The recombinant plasmid that obtains above the present invention utilizes, the SCREENED COMPOUND that realizes through following method, comprise the steps:

The first step: with the recombinant plasmid that contains OATP1B1 promotor and reporter gene, PXR expression plasmid and the confidential reference items plasmid renilla luciferase cotransfection of aforementioned acquisition to human hepatoma cell strain HepG2 cell;

Second step: add to be screened possibly having and activate the compound that PXR regulates OATP1B1 genetic expression;

The 3rd step: adopt the expression and the renilla luciferase fluorescence of chemiluminescence detection reporter gene, reflect the different influences of SCREENED COMPOUND of treating to OATP1B1 genetic expression with the two ratio.

Discover that nuclear receptor has important regulation to the expression of OATP1B1, wherein pregnane X acceptor (PXR) is the topmost transcriptional regulator of OATP1B1.Research shows, when PXR is activated, act on the OATP1B1 promoter region (128to-111 with-9957to-9940), the OATP1B1 expression level is obviously raised.All can be like 16 alpha-cyano Vitarrines (PCN), lithocholic acid, Rifampin etc. through activating expression enhancing, the function rise that PXR induces OATP1B1.The inductive effect that is found to be research OATP1B1 of PXR provides new thinking.Based on this thinking; OATP1B1 promotor fluorescence report gene plasmid, the PXR expression plasmid of structure is (open in the prior art; Hu Dongli etc. for example, the foundation of drug-induced dose of in-vitro screening system of CYP3A4 and CYP2B6, Chinese medicine engineering; Article numbering: 1672-2019 (2007) 08-0646-04) and renilla luciferase together transient cotransfection to human hepatoma cell strain HepG2 cell; Be built into two fluorescence report gene test platforms, can on chemiluminescence detector, detect uciferase activity, with the different possible active compound of ratio reaction of sea pansy fluorescence the OATP1B1 transporter is influenced with Lampyridea fluorescence.The high flux screening OATP1B1 inductor that is established as of this method provides possibility.Thereby for disease treatment, drug interaction, safety of medicine rationally uses and the new drug preclinical study provides more scientific basis.

Principle: as the renilla luciferase plasmid of internal reference and the fluorescence report gene series plasmid to be measured two kinds of different protein of renilla luciferase and Photinus pyralis LUC of encoding respectively.In forming the oxyluciferin process, through the mediation transfer transport chemical energy is converted into luminous energy, thereby luminous.Two reporter genes all do not have endogenous activity in the experiment host cell, promptly 1, not this two reporter genes in the host cell; 2, two reporter genes itself are not participated in the cells physiological activity.Can continuously measured in single sample.

In measuring process, at first add luciferase detection reagent II and produce the Lampyridea fluorescent signal, signal continues 1min at least, measures the Photinus pyralis LUC reporter gene so earlier.Quantitatively after the Lampyridea fluorescence intensity; In same sample, add Stop& reagent again; With above-mentioned reaction quencher; And start the renilla luciferase reaction simultaneously, carry out the second time simultaneously and measure.

Recombinant plasmid of the present invention two luciferase reporter genes wherein detect genetic expression and have following advantage:

1) highly sensitive, high specificity, detection speed is fast, expense is low, material is prone to obtain;

2) have the characteristics of target property simultaneously, thereby can specific detection activate the active compound that PXR influences the OATP1B1 expression;

3) overcome the influence of transfection efficiency.

Description of drawings

Fig. 1 is the electrophorogram behind OATP1B1 promotor fluorescence report gene recombination plasmid provided by the invention and the double digestion;

Fig. 2 is a recombinant plasmid pGL-4.17-OATP1B1 sequencer map of the present invention;

Fig. 3 is the operational flowchart of this experiment;

Fig. 4 is that Rifampin activates the influence result of PXR to the OATP1B1 expression;

Fig. 5 is that the traditional Chinese medicine monomer baicalin activates the influence result of PXR to the OATP1B1 expression.

Concrete embodiment

Embodiment 1

Make up OATP1B1 promotor fluorescence report gene plasmid, transient transfection makes up two fluorescence report gene engineering platforms to the HepG2 cell.

One, material

1. plasmid, cell strain

PGL-4.17 fluorescence report genophore, pPEM-T carrier, pcDNA3.1-myc/hisB (-) carrier for expression of eukaryon: U.S. promega company.

HepG2 cell strain: Chinese Academy of Medical Sciences tumour cell storehouse.

2. main agents

Foetal calf serum (Hangzhou SIJIQING); MEM substratum (U.S. Gibco company); The 50ml Tissue Culture Flask, 24 porocyte culture plates (U.S. Corning company); RevertAid ^TMFirst Strand cDNA rt test kit (Fermentas company); Lipofectamine ^TM2000 liposomes (American I nvitrogen company); DNA extraction test kit (promega); Trizol (American I nvitrogen company).

3. key instrument

PCR appearance (U.S. Thermo); Electrophoresis equipment (Beijing 6 1); CO ₂Cell culture incubator (U.S. ThermoForm, SeriesII); Bechtop (U.S. thermal); Sirius C single hose chemiluminescence detector (Berthold company); GIS-2009 gel imaging analysis system (Tanon company); Low-temperature trace whizzer (Eppendorf company).

Two, experimental technique

1.OATP1B1 the structure of promotor fluorescence report gene plasmid

1.1 blood specimen collection and DNA extracting

Gather healthy volunteer's peripheric venous blood 5mL, the glass test tube as for the EDTA anti-freezing, it is subsequent use to be stored in-40 ℃ of refrigerators.According to standard benzene phenol-chloroform method extracting genomic dna, place 4 ℃ of refrigerators subsequent use.

1.2OATP1B1PCR

1.2.1 design of primers

OATP1B1 promoter sequence and PXR and its startup bonded zone design primer according to the people:

(128to-111): primers F is the upper reaches 5 ' end primer, wherein comprises 19 OATP1B1 gene promoter complementary bases, a KpnI recognition site, 2 protection bases in land 1;

Primer R is the upper reaches 3 ' end primer, wherein comprises 19 OATP1B1 gene promoter complementary bases, a Nhel recognition site, 2 protection bases;

Primers F: TC GGTACCCCAGTGATGATTAACCACC

Primer R:CC CGATCGCCAGGTGGTATCTCCAGTC

(9957to-9940): primers F is the upper reaches 5 ' end primer, wherein comprises 19 OATP1B1 gene promoter complementary bases, a Hind III recognition site, 2 protection bases in land 2;

Primer R is the upper reaches 3 ' end primer, wherein comprises 19 OATP1B1 gene promoter complementary bases, an Xhol recognition site, 2 protection bases;

Primers F: TC AAGCTTCAAGCAGGGGCAATCTGTC

Primer R:CC CTCGAGGAGGGAGTAGGCAATGCTC

1.2.2 amplified fragments: (128to-111); (-9957to-9940)

1.2.3 amplification system:

Preceding primer (10 μ M) 0.5 μ l

Back primer (10 μ M) 0.5 μ l

dNTP(2.5mM) 1.5μl

RTaq enzyme (5u/ μ l) 0.20 μ l

10×PCR?buffer 2.5μl

MgCl2 0.5μl

ddH2O 17.30μl

cDNA 2μl

End reaction system 25 μ l

1.2.4 amplification condition

Land 1 amplification condition

95 ℃ 5 minutes

95 ℃ 30 seconds

56 ℃ of 40 circulations in 30 seconds

72 ℃ 1 minute

72 ℃ 5 minutes

Land 2 amplification conditions

95 ℃ 5 minutes

95 ℃ 30 seconds

60 ℃ of 40 circulations in 30 seconds

72 ℃ 1 minute

72 ℃ 5 minutes

1.3 amplified production reclaims

Amplified production is in 1.0% agarose gel electrophoresis 60min, and ethidium bromide staining downcuts purpose band blob of viscose down in uv lamp.Gel with QIAGEN company reclaims test kit recovery purpose segment, and step is following:

1. the blob of viscose that cuts is weighed and is placed in the 1.5EP pipe, adds 3 times of QX1buffer to gel weight, adds 10ulQIAEX II (glass powder); Put upside down mixing, abundant resuspended QIAEX II.

2. 50 ℃ of water-bath 10min, every 2min put upside down mixing EP pipe, resuspended glass powder.

3. the centrifugal 1min of 13000r/min abandons supernatant.

4. add 500ul QX1buffer, resuspended glass powder.

5. the centrifugal 1min of 13000r/min abandons supernatant.

6. add 500ul buffer PE, resuspended glass powder.

7. the centrifugal 1min of 13000r/min abandons supernatant.

8. at 50 oven dried 3-5min, bleach up to deposition.

9. add 20ul ddH2O, incubated at room 5min fully dissolves.

1.4 be connected the PCR product of OATP1B1 on the pPEM-T carrier, extract plasmid, enzyme is cut and is checked order.

Amplified production all uses the rTaq enzyme in 70 ℃, and 10min adds " A ".Carry out ligation, reaction system with the pGEM-T carrier: 2 * ligation buffer 5.0ul adds the pcr product 3.5ul of " A ", T vector 0.5ul, T4ligase 1.0ul; 16 ℃ of water-baths are spent the night.

Connect product and transform the JM109 intestinal bacteria, step is following:

1. connect product 20ul and add in the homemade JM109 competence of the 200ul bacterium, rotation several mixing is placed 30min on ice gently.

2. 42 ℃ of water-bath heat-shocked 80s.

3. put cooled on ice 2-3min fast.

4. add the LB liquid that does not contain Amp and train basic 800ul.

5. 37 ℃, 150r/min, jolting 1h.

6. the centrifugal 10s of 13000r/min removes supernatant 800ul.

7. resuspended deposition is evenly coated on the Amp male LB solid medium.

8. be inverted culture plate and cultivate 16h in 37 ℃.

Choose bacterium colony and cultivate, from intestinal bacteria, extract the T plasmid that links to each other with the purpose segment, alkaline lysis is the extracting DNA in a small amount, carries out enzyme and cuts evaluation.Recombinant clone uses SPIN post extracting and purifying plasmid, is used for order-checking.

It is following that OMEGA D6942-01 test kit extracts the plasmid step:

The centrifugal collection of I 1.5-5ul bacterium liquid precipitate.

II adds the solution I (the resuspended liquid of bacterium) that 250ul comprises the RNA enzyme, abundant resuspended deposition.

III adds 250ul solution II (bacterial lysate), puts upside down mixing 4-6 time gently, the abundant cracking bacterium of incubated at room 2min.

IV adds 350ul solution III (albumen precipitation liquid), slightly puts upside down mixing 6-8 time, and protein is fully precipitated.

The centrifugal 10min of V 13000g room temperature.

VI shifts supernatant in the HiBind post, the centrifugal 1min of 13000r/min.

VII adds 500ul Buffer HB, the centrifugal 1min of 13000r/min.

VIII adds 700ul Wash Buffer, the centrifugal 1min of 13000r/min.

IX repeating step VIII.

The X 13000r/min 2min that dallies.

The aseptic 1.5EP pipe that XI renews adds 60ul ddH2O in the HiBind post, incubated at room 2min.

The centrifugal 1min of 13000r/min collects plasmid.

Confirm to insert fragment 1.5 will check order and do not have DNA and the PGL4.10 carrier of PCR mispairing and use enzymes double zyme cutting, reclaim insertion fragment and carrier respectively with agarose electrophoresis, use gel piece fast link.Transform the JM109 intestinal bacteria, picking mono-clonal extracting plasmid, enzyme is cut evaluation, and step is the same.

1.6 recombinant clone is further cultivated amplification.

The amount plasmid extraction kit prepares DNA among the use PROMEGA.DNA is kept in 70% ethanol and keeps sterile state, and-20 ℃ frozen for use.Step is following:

I 50ul bacterium liquid adds in the 50ml LB liquid training base, 220rpm/min jolting 12-16h.

The centrifugal 5min of II 5000g collects bacterium, abandons supernatant, on filter paper, stays surplus to the greatest extent liquid.

III adds the resuspended liquid of 3ml cell (cell resuspension solution) and fully beats even with rifle.

IV adds 3ml cell pyrolysis liquid (cell lysis solution), puts upside down 3-5 time gently, leaves standstill 3min.

V adds 5ml balance liquid (neutralization solution), puts upside down 5-6 time gently, and upright 2-3min occurs to white precipitate.

The VI centrifugal post that blueness is clean is placed on the new 50ml centrifuge tube.

VII imports clean centrifugal post with supernatant, leaves standstill 2min.

The centrifugal 5min of VIII 3000g.

IX will be filtrated and imported column (binding column), and will be clear under collecting with useless 50ml centrifuge tube, and the centrifugal 3min of 3000g abandons down clear.

Add the 20ml elutriant in the X column, the centrifugal 5min of 1500g abandons down clearly 3000g repeated centrifugation 5-10min.

XI idle running back filter paper exhausts ethanol.

XII adds 800ul ddH2O, and the centrifugal 5min of 3000g, clean 50ml centrifuge tube collect clear down, and it is for use to move in the 1.5EP pipe packing-40 ℃ preservation at last.

2.PXR the structure of cDNA expression plasmid

2.1RNA extracting and rt

From the former foster liver cell of being commissioned to train, extract total RNA with Trzol, use RevertAid ^TMFirst Strand cDNA rt test kit synthesizes cDNA, is that template is carried out pcr amplification with cDNA.

2.2PXRPCR

2.2.1 primer

2.2.2 amplification coding section length

2.2.3 amplification system

2.2.4 amplification condition

2.3 be connected in the PCR product of PXR on the pPEM-T carrier and order-checking

Confirm to insert DNA and pcDNA3.1-myc/hisB (-) the carrier double digestion that fragment does not have the PCR mispairing 2.4 will check order, reclaim respectively with agarose electrophoresis and insert fragment and carrier, use the gel piece fast link.Transform the JM109 intestinal bacteria, picking mono-clonal extracting plasmid, enzyme is cut evaluation.Recombinant clone is further cultivated amplification, the extracting DNA.DNA is kept in 70% ethanol and keeps sterile state, and-20 ℃ frozen for use.

3. two fluorescence report gene tests

Step is following:

3.1. cultivate the HepG2 cell;

When treating that the HepG2 cell grows to logarithmic phase, digestion is with every hole 2 * 10 ⁵The density of individual cell is seeded to 24 orifice plates, treats that cell grows to 80%.

3.2. cotransfection

3.2.1 every hole need change 600ng PXR plasmid respectively over to, 300ng OATP1B1 promotor fluorescence report gene plasmid and 50ng sea cucumber luciferase.Behind nutrient solution difference dilution DNA that does not contain microbiotic and foetal calf serum in right amount and Lipofectamine2000 liposome, with the two mixing, room temperature is placed 20min.

3.2.2 clean cell three times with PBS, every then hole adds and does not contain foetal calf serum MEM substratum 1ml.

3.2.3 said mixture (DNA/ liposome) is joined in 24 orifice plates by every hole 200ul, rocks culture plate gently and make its mixing.

3.3. adding the positive drug Rifampin handles

Behind the 6h, renew the MEM that aquatic foods contain 10% foetal calf serum, add medicine simultaneously.If control group, positive drug Rifampin group (10umol), 4 every group multiple holes.

3.4. Rifampin is to the activity influence of reporter gene

3.4.1 after hatching 24h, with substratum from cell sucking-off to be checked.

3.4.2 with 1 * PBS gently the rinsing cell wash 3 times.

3.4.3 in the cell cultures hole, add an amount of 1 * passive lysis buffer (PLB).

3.4.4 detection uciferase activity.A) in the 1.5ml centrifuge tube, add the 20ul cell pyrolysis liquid, add the LARII solution of 100ul then, put into the luminous detection appearance after the mixing and detect luminous value (Lampyridea fluorescent value) for the first time; B) add Stop&Glo then and detect liquid, stop for the first time luminously, begin for the second time luminously simultaneously, put into the luminous detection appearance after the mixing and detect luminous value (sea pansy fluorescent value) for the second time.

4. the result judges

Reflect respectively that with the Lampyridea fluorescence and the ratio of sea pansy fluorescence different compounds to be detected activate the influence of PXR to the OATP1B1 promoter activity.Starting activity is exactly the ratio of seeing two luciferases, and the big activity of ratio is strong, a little less than the little activity of ratio.Judgement criteria is exactly to see the difference of ratio with the ratio of not dosing group of dosing group so.Variantly just think that medicine has activity.As the groups of cells fluorescence ratio that is added with Rifampin is 5.013 ± 0.894, do not add the groups of cells that Rifampin is handled, and fluorescent value is 2.305 ± 0.630, (p＜0.05) (see figure 4).

Embodiment 2

Adopt the Research on experimental methods traditional Chinese medicine monomer compound baicalin of above-mentioned foundation whether can induce OATP1B1 to express through activating PXR.

Operation steps:

1. cultivate the HepG2 cell;

When treating that the HepG2 cell grows to logarithmic phase, digestion is with every hole 2 * 10 ⁵The density of individual cell is seeded to 24 orifice plates, treats that cell grows to 80%.

2. cotransfection

2.1 every hole need change 600ng PXR plasmid respectively over to, 300ng OATP1B1 promotor fluorescence report gene plasmid and 50ng sea cucumber luciferase.Behind nutrient solution difference dilution DNA that does not contain microbiotic and foetal calf serum in right amount and Lipofectamine2000 liposome, with the two mixing, room temperature is placed 20min.

2.2 clean cell three times with PBS, every then hole adds and does not contain foetal calf serum MEM substratum 1ml.

2.3 said mixture (DNA/ liposome) is joined in 24 orifice plates by every hole 200ul, rocks culture plate gently and make its mixing.

3. add the traditional Chinese medicine monomer compound treatment

Behind the 6h, renew the MEM that aquatic foods contain 10% foetal calf serum, add medicine simultaneously.If control group, positive drug Rifampin group (10umol), traditional Chinese medicine monomer compound baicalin group to be detected (1,10, three concentration group of 100umol), 4 every group multiple holes.

4. traditional Chinese medicine monomer compound baicalin is to the activity influence of reporter gene

4.1 after hatching 24h, the substratum that will contain medicine traditional Chinese medicine monomer compound baicalin is from cell sucking-off to be checked.

4.2 with 1 * PBS gently the rinsing cell wash 3 times.

4.3 in the cell cultures hole, add an amount of 1 * passive lysis buffer (PLB).

4.4 detection uciferase activity.A) in the 1.5ml centrifuge tube, add the 20ul cell pyrolysis liquid, add the LARII solution of 100ul then, put into the luminous detection appearance after the mixing and detect luminous value (Lampyridea fluorescent value) for the first time; B) add Stop&Glo then and detect liquid, stop for the first time luminously, begin for the second time luminously simultaneously, put into the luminous detection appearance after the mixing and detect luminous value (sea pansy fluorescent value) for the second time.Fluorescence ratio with Lampyridea fluorescent value and sea pansy fluorescent value reflects that respectively traditional Chinese medicine monomer compound baicalin activates the influence of PXR to the OATP1B1 promoter activity.

5. the result judges

Reflect respectively that with the Lampyridea fluorescence and the ratio of sea pansy fluorescence different possibility active compounds activate the influence of PXR to the OATP1B1 promoter activity.Discover that baicalin can make the OATP1B1 transcriptional activity strengthen (see figure 5) through activating PXR.Baicalin is 1,10, during three concentration of 100umol, and its fluorescence ratio that records is respectively: 4.527 ± 0.291,4.810 ± 0.846,5.102 ± 0.586, with control group 2.348 ± 0.404 relatively the P values less than 0.05.

Claims (3)

1. recombinant plasmid that contains OATP1B1 promotor and reporter gene, the promoter region of said OATP1B1 is-128 to-111 and-9957 to-9940.

2. recombinant plasmid according to claim 1 is characterized in that said reporter gene is a Photinus pyralis LUC.

3. the method for a high flux screening OATP1B1 inductor comprises the steps:

The first step: recombinant plasmid, PXR expression plasmid and confidential reference items plasmid renilla luciferase cotransfection that claim 1 or 2 is obtained are to human hepatoma cell strain HepG2 cell;

Second step: add to be screened possibly having and activate the compound that PXR regulates OATP1B1 genetic expression;

The 3rd step: adopt the expression and the renilla luciferase fluorescence of chemiluminescence detection reporter gene, reflect the different influences of SCREENED COMPOUND of treating to OATP1B1 genetic expression with the two ratio.

Images