CN102372779A

CN102372779A - Camel single domain antibody with allinase activity as well as preparation method and application thereof

Info

Publication number: CN102372779A
Application number: CN2011103274194A
Authority: CN
Inventors: 李江伟
Original assignee: Individual
Current assignee: Individual
Priority date: 2011-10-25
Filing date: 2011-10-25
Publication date: 2012-03-14

Abstract

The invention specifically relates to a general method for preparing a catalytic antibody or abzyme, an obtained camel resource single domain antibody with allinase activity and an application of the antibody. In the method, the characteristics that a reorganized camel heavy chain antibody (short for VHH(variable part of the heavy chain of heavy-chain antibodies)) is used for preferentially identifying the center of enzymatic activity, and an antiidiotypic antibody with the allinase activity is obtained by screening from an allinase immune VHH phage display library. According to the general method, the defects of low preparation efficiency, big preparation difficulty, low enzymatic activity and the like in the traditional abzyme preparation process can be overcome, and an efficient and simple preparation method is provided for obtaining the catalytic antibody capable of simulating natural enzymatic activity. The abzyme obtained with the method can be applied to treating tumors, infectious diseases, hyperlipidemia, atherosclerosis, diabetes mellitus, allergy and the like.

Description

Have the active camel single domain antibody of allinase and preparation method and application

Technical field

The invention belongs to biological technical field, be specifically related to a kind of single domain antibody for preparing the universal method of catalytic antibody or abzyme and obtained with the active camel of allinase source, and the application of these antibody.

Technical background

Abzyme (abzyme) is also claimed catalytic antibody, has the single-minded katalysis of enzyme and the targeting of antibody concurrently, has important value in research with in using.Yet, because abzyme prepares the process complicacy, the preparation difficulty is big, though the abzyme that just obtained first synthetic in 1986, up to the present, the abzyme report and few [1] of actual application value is arranged.

Current, the method for preparing abzyme mainly contains two kinds: a kind of is that analogue is as antigen [2] in the middle of adopting the enzyme substrates transition state, and screening can combine the antibody of the middle analogue of transition state behind the immune animal, and this antibody possibly have the activity of enzyme.This method need be synthesized analogue in the middle of a large amount of transition states on the one hand, and need carry out immune animal after the coupling with carrier proteins, and process is complicated, and the result is wayward; On the other hand, immune animal maybe not easy excitated antibody to analogue in the middle of the transition state.So, adopt the successful probability of this method screening abzyme not high.Second method is to adopt the antiidiotypic antibody analogue antigen as image in the antigen [3-5].This theory think can with complementary land (the complementarity-determining regions of antigen in the antibody (being called Ab1); CDR) bonded antibody (is called Ab2; Also be antiidiotypic antibody; Anti-idiotypic antibody), character that can analogue antigen, promptly be equivalent to antigenic in image (its principle is seen synoptic diagram 1).Therefore, can obtain abzyme through the antiidiotypic antibody of Ab1 among the screening combination figure.But the key that this method is successful be at first need obtain can with as antigenic enzyme active center bonded antibody (Ab1) [6].This is for (heavy chain, H) (light chain, the conventional antibody of L) forming are the comparison difficulties with two light chains by two heavy chains.Because the complementary land of the antigen of conventional antibody (CDRs) is by variable region of heavy chain (variabledomains of the heavychain; VH) and variable region of light chain (variable domains of the light chain; VL) the common composition, on space structure, be engagement groove [7-8] flat or depression.This structure is unfavorable for combining to be arranged in the epitope in albumen crack, the epi-position that comes to this as the active site of enzyme.In fact, the conventional antibody with enzyme inhibition that obtains at present seldom.So the antiidiotypic antibody that screening obtains having enzymic activity from the conventional antibody storehouse is difficulty relatively also.Therefore,, tempting application prospect is arranged,, limited its widespread use owing to there is not reliable and feasible preparation means in fields such as fundamental research, drug developments although abzyme has unique advantage.

In recent years; In to the research of camellid, find [9], have a kind of natural light chain that lacks in two-humped camel, dromedary, alpaca and the llama, only form but have the antibody of complete function by heavy chain; Be called heavy chain antibody (heavy chain antibody; HCAb) (its structure is seen synoptic diagram 2), its variable region still has good antigen recognition and binding ability, and is suitable with antigen bonded avidity and conventional antibody.The variable region of heavy chain antibody (variable domains of the HCAb; Abbreviate VHH as); Molecular weight is 15kDa, is merely 1/10 of conventional antibody, is present available smallest molecule fragment with complete antibody function; Be called single domain antibody (single domain antibody, sdAb).More unique is that the antigen binding domain of camel single domain antibody only is made up of three hypervariable regions (H1-H3) of VHH, has spatially formed with conventional antibody typical structure different antigens to combine territory [8,10].Wherein the mean length of H3 is longer than conventional antibody, spatially can be outstanding dactylitic texture [8,10].Therefore single domain antibody can combine the epitope that some conventional antibodies can't be approaching.As be arranged in the active site structure in zymoprotein crack.Nearest multinomial research all shows [11-17], from having obtained very a high proportion of enzyme inhibition single domain antibody through screening the immunoenzymatic camel VHH antibody library.In addition, owing to four sites are arranged in framework region FR2 by hydrophilic amino acid replacement (V37 → F or Y; G44 → E; L45 → R or C; W47 → G) [19]; The VHH of reorganization can obtain high expression level (5-10mg/L) in intestinal bacteria; And have good water solubility, stability is strong, a little less than the immunogenicity; Advantages such as tissue penetration property is strong make this antibody as a kind of genetic engineering antibody of miniaturized have broad application prospects in fields such as fundamental research, drug developments [18-19].

Single domain antibody is preferentially discerned the characteristic of enzyme active center, makes them be suitable as very much the molecular simulation of enzyme and as the antiidiotypic antibody vaccine.Zarebski LM [20] is from the llama VHH antibody library of the monoclonal antibody ED84 immunity of specific combination DNA oligonucleotide; Screening has obtained two antiidiotypic antibodys; Can both compete and suppress combining of ED84 and double-stranded DNA oligonucleotide, show the simulation on this DNA function.But do not see the report that adopts the camel antiidiotypic antibody to obtain abzyme so far.The present invention is according to the antibody idiotype network theory, and the single domain antibody of employing and enzyme active center specific combination is from the antiidiotypic antibody that obtains having enzymic activity through screening the immunoenzymatic camel VHH antibody library.

1.Tramontano?A，Janda?KD，Lerner?RA.Catalytic?antibodies.Science.1986；234(4783)：1566-70.

2.Xu?Y，Yamamoto?N，Janda?KD.Catalytic?antibodies：hapten?design?strategies?and?screeningmethods.Bioorg?Med?Chem.2004；12(20)：5247-68.

3.Kolesnikov?A，kozyr?AV，Alexandrova?ES.et.al.Enzyme?mimicry?by?the?antiidiotypic?antibodyapproach.Proc?Natl?Acad?Sci?USA.2000；25(97)：13526-13531

4.Glynis?Johnson，Samuel?W.Moore.Idiotypic?mimicry?of?a?catalytic?antibody?active?site.MolImmunol.2002；39：273-288

5.Pillet?D，Paona?M，Vorobiev?II.et.al.Idiotypic?network?mimicry?and?antibody?catalysis：lessons?for?the?elicitation?of?efficient?anti-idiotypic?protease?antibodies.J?Immunol?Methods.2002，269：5-12

6.Avalle?B，Friboulet?A，Thomas?D.Screening?of?inhibitory?monoclonal?antibodies.A?criticalstep?for?producing?anti-idiotypic?catalytic?antibodies.Ann?N?Y?Acad?Sci.1998；864：118-30.

7.Webster，D.M..Antibody-antigen?interactions.Curr.Opin.Struct.Biol.1994；4：123-129

8.Muyldermans?S，Cambillau?C，Wyns?L.Recognition?of?antigens?by?single?domain?antibodyfragments：the?superfluous?luxury?of?paired?domains.Trends?Biochem?Sci.2001；26(4)：230-235

9.Hamers-Casterman?C，Atarhouch?T，Muyldermans?S，et.al.Naturally?occurring?antibodies?devoidof?light?chains.Nature.1993；363(6428)：446-448.

10.De?Genst?E，Silence?K，Decanniere?K，et.al.Molecular?basis?for?the?preferential?cleftrecognition?by?dromedary?heavy-chain?antibodies.Proc?Natl?Acad?Sci?USA.2006；103(12)：4586-4591.

11.Lauwereys?M，Ghahroudi?MA，Desmyter?A，et.al.Potent?enzyme?inhibitors?derived?from?dromedaryheavy-chain?antibodies.EMBO?J.1998；17(13)：3512-3520

12.Dumoulin?M，Last?AM，Desmyter?A，et.al.A?camelid?antibody?fragment?inhibits?the?formationof?amyloid?fibrils?by?human?lysozyme.Nature.2003；424(6950)：783-788

13.Chan?PH，Pardon?E，Menzer?L，et.al.Engineering?a?camelid?antibody?fragment?that?binds?tothe?active?site?of?human?lysozyme?and?inhibits?its?conversion?into?amyloid?fibrils.Biochemistry.2008；47(42)：11041-11054.

14.Koch-Nolte?F，Reyelt?J， B，et.al.S?ingle?domain?antibodies?from?llama?effectivelyand?specifically?block?T?cell?ecto-ADP-ribosyltransferase?ART2.2?in?vivo.FASEB?J.2007；21(13)：3490-3498.

15.Conrath?KE，Lauwereys?M，Galleni?M，et.al.Beta-lactamase?inhibitors?derived?fromsingle-domain?antibody?fragments?elicited?in?the?camelidae.Antimicrob?Agents?Chemother.2001；45(10)：2807-2812

16.Desmyter?A，Spinelli?S，Payan?F.et.al.Three?camelid?VHH?domains?in?complex?with?porcinepancreatic?a-amylase.J?Biol?Chem.2002；277(26)：23645-23650

17.Ratier?L，Urrutia?M，Paris?G，et.al.Relevance?of?the?diversity?among?members?of?thetrypanosoma?cruzi?trans-sialidase?family?analyzed?with?camelids?single-domain?antibodies.PLoSOne.2008；3(10)：e3524

18.Wesolowski?J，Alzogaray?V，Reyelt?J.et.al.Single?domain?antibodies：promising?experimentaland?therapeutic?tools?in?infection?and?immunity.Med?Microbiol?Immunol?2009；198：157-174

19.Muyldermans?S.Single?domain?camel?antibodies：current?status.J?Biotechnol?2001；74(4)：277-302

20.Zarebski?LM，Urrutia?M，Goldbaum?FA.Llama?single?domain?antibodies?as?a?tool?for?molecularmimicry.J?Mol?Biol.2005；349(4)：814-824

Summary of the invention

The present invention utilizes camel antibody heavy chain variable region (the variable part of the heavy chain of heavy-chain antibodies of reorganization; Be called for short VHH) preferentially discern enzyme active center and have the characteristics of the finger-like CDR3 structure of protrusion; Theory is regulated and control at networking according to the antiidiotypic antibody analogue antigen, screens acquisition in the VHH phage display library that adopts the immune camel of the allinase that derives from the garlic to make up and has the active antiidiotypic antibody of allinase.The present invention has overcome that the preparation process that exists among the existing abzyme preparation method is complicated, the preparation difficulty is big, obtains youngster and leads and shortcomings such as enzymic activity is on the low side, and a kind of preparation method of high-efficient simple is provided for the abzyme that extensively obtains the simulation natural enzyme.

First technical problem that the present invention will solve is the single domain antibody phage display library that makes up based on camel VHH gene order.The allinase immunity Xinjiang two-humped camel of employing purifying in garlic adopts RT-PCR method clone to obtain the VHH gene order from lymphocyte through the special primer of VHH, is connected in the pCANTAB 5E carrier and has set up the VHH phage display library.

Second technical problem that the present invention will solve is the abzyme screening method of setting up based on antiidiotype camel single domain antibody.According to Antibody Network regulation and control theory, the present invention has designed a kind of easy abzyme screening method.Be specially employing the Ab1 antibody that first round screening obtains from the library and directly same library carried out second and take turns screening, can obtain the antiidiotype single domain antibody fast, again according to the mensuration select target catalytic antibody of enzymic activity with enzyme inhibition activity.

The 3rd technical problem that the present invention will solve provided the gene of the above-mentioned recombinant antibodies of encoding.Wherein, the aminoacid sequence of encoding antibody is shown in SEQ ID NO.1～NO.5.

The 4th technical problem that the present invention will solve provided the using value in oncotherapy of above-mentioned recombinant antibodies.

The present invention can realize through following steps:

1. purifying enzyme antigen, immune Xinjiang two-humped camel

2. design the suitable primer VHH gene fragment that is used to increase

3. separating immune animal lymph cell increases and builds the VHH specific fragment, is connected to pCANTAB 5E carrier structure phage display library

4. affine screening and allinase antigen-specific bonded VHH clone (Ab1)

5.VHH positive colony expression of recombinant proteins, purifying and evaluation

6. the allinase activity suppresses experimental selection inhibition VHH antibody (Ab1)

7. the VHH clone (Ab2) of affine screening and inhibition VHH antibody (Ab1) specific combination

8.VHH positive colony (Ab2) expression of recombinant proteins, purifying and evaluation

9. the allinase activity experiment is selected VHH antibody (Ab2) with catalytic activity

10. the enzymic activity of catalytic antibody VHH and dynamic metabolism analysis

11. catalytic antibody VHH vitro conversion substrate alliin is to the lethal effect of B16 tumour cell

Description of drawings

Fig. 1 .pCANTAB 5E phagemid carrier figure

Fig. 2. the primer sequence of the Xinjiang two-humped camel antibody heavy chain variable region VHH that is used to increase

Fig. 3. the SDS-PAGE electrophorogram of the allinase that purifying obtains in the garlic

Fig. 4. the ELISA of the Xinjiang two-humped camel serum antibody titer after the allinase immunity measures

Fig. 5. original position PCR identifies the segmental positive rate of insertion of VHH phage display library

Fig. 6. expression plasmid pET30a-VHH physical map

Fig. 7. the SDS-PAGE electrophorogram of the inducing of single domain antibody VHHA4, expression, purifying and evaluation

Fig. 8. single domain antibody VHHA4 is to the active curve that suppresses of allinase, with the percentage ratio of residual enzyme activity as inhibiting rate.IC ₅₀Be 0.2umol/L

Fig. 9. single domain antibody VHHA4 combines the competitive ELISA experiment in allinase active site.

Figure 10. the SDS-PAGE electrophorogram of the expression of single domain antibody VHHC10, purifying and evaluation

Figure 11. substrate alliin concentration is to the Michaelis-Menten curve of catalytic antibody VHHC10 allinase activity influence

Figure 12. the Lineweaver-Burk curve of single domain antibody VHHC10 enzymic activity kinetic determination

Figure 13. single domain antibody VHHC10 transforms alliin in external restraining effect to the B16 mouse melanin tumor cell

Figure 14. abzyme preparation flow synoptic diagram

Embodiment

Specify below in conjunction with embodiment but do not limit the present invention

Instance

One, antigenic separation and purification of allinase and enzyme assay in the garlic

From the fresh garlic garlic clove, adopt ammonium sulfate precipitation (60% saturation ratio) method to extract the thick enzyme of allinase, after the desalination of VISOSE G-20 gel, adopt the ConA-Sepharose affinitive layer purification. obtain the allinase of purity about 90%.Be kept at not obviously reduction of enzymic activity in 20 ℃ of 1-3 months.Acetone acid system and 4-pyridine mercaptans are adopted in enzyme assay, and (4-mer-captopyridine 4-MP) measures the growing amount of pyruvic acid and garlicin respectively.The pyruvic acid measuring method is following: reaction mixture comprises: 0.1M NaH2PO4, and the VHH C4 of 1ml or allinase solution (1mg/mL), 1mL alliin (2mg/mL) is hatched 5min at 35 ℃.Add 2mL trichoroacetic acid(TCA) termination reaction.Add the 1mL 2,4 dinitrophenyl hydrazine then, and continue to hatch 5min, add 5mL 2.5M NaOH subsequently and hatch 10min, on spectrophotometer, measure the absorption value of 520nm.。4-MP assay method step is following: in the 1ml reaction solution, mix following composition: 1mM 4-MP, 50mM Na-phosphate (pH 7.2), 2mM EDTA, 0.02mM Vitazechs, 10mM garlic ammonia.Enzyme activity determination originates in the adding catalyzer, and vitality test calculates according to the reduction of 324nm place absorption value.1 unit of activity is defined as, and PM catalysis generates the required enzyme amount of 1 μ M pyruvic acid under reaction conditions.In order to get rid of the influence of garlicin remaining in the sample, before measuring earlier with Alliinase or VHH C4 and 10mM 4-MP at preincubate 30min on ice.

Two, the structure of immunity of Xinjiang two-humped camel and VHH gene phage display library

With the allinase of purifying earlier with Fo Shi Freund's complete adjuvant equal-volume fully emulsified after; The Xinjiang two-humped camel is carried out the subcutaneous multi-point injection of neck (injecting 0.2ml altogether); Immunizing dose is 500 μ g/ time; Per 2 weeks are strengthened once, carry out 5 immunity altogether. and adopt the Fo Shi Freund's complete adjuvant except that immunity for the first time, booster immunization all adopts incomplete freund adjuvant.Before each immunity and after exempting from 14 days eventually, the jugular vein blood sampling, separation of serum, ELISA measures serum antibody titer.Two-humped camel is after the allinase immunity; Body endoantigen specific antibody titre increases gradually, and especially (immunity 56 days) antibody horizontal increases significantly after the 4th immunity, and noticeable change no longer takes place (immunity 70 days) two-humped camel internal antibody titre after the 5th immunity; Maintain 1: 12,800 levels.

Adopt lymphocyte separation medium from 200mL two-humped camel peripheral blood, collect altogether and obtain about 1.9 * 10 ⁸Individual lymphocyte, packing also takes out 10 ⁷Individual cell carries out single stage method with TRIzol Reagent reagent and extract total RNA, and reverse transcription becomes eDNA.With two-humped camel peripheral blood lymphocyte eDNA is template; Adopt leading peptide conserved sequence VHH-P1 and the HCAb hinge area distinguished sequence VHH-P2-IgG (2a of camel VHH; 3) be the upstream and downstream primer; Amplification obtains the VHH fragment of two-humped camel two kinds of hypotype heavy chain antibodies IgG2a and IgG3, and size is about between the 400bp-600bp, and wherein the VHH fragment from the IgG2a hypotype is slightly larger than the VHH fragment from IgG3.Primer is following:

VHH-P1-Sfi?I：CATGCCATGACTCGCGGCCCAGCCGGCCGTCCTGGCTGCTCTTCTACAAGG；

VHH-P2-IgG2-Sfi?I：CATGCCATGACTCGCGGCCTCGGGGGCCCGTGCATTCTGGTTCAGGTTTTGGTTGTGG；

VHH-P2-IgG3-Sfi?I：CATGCCATGACTCGCGGCCTCGGGGGCCCTTGCATACTTCATTCGTTCC

The VHH antibody fragment that amplification is obtained is connected to phagemid pCANTAB 5E carrier; Transformed into escherichia coli TG1; And take out 1 μ L conversion fluid coating; Positive colony of next day counting growth is 620 clones, and all positive colony that can calculate thus on 20cm * 20cm culture plate are approximately 3.1 * 105.Therefrom 50 clones of picking carry out bacterium liquid and expand numerous at random; The result has 4 to be cloned in the substratum that adds penbritin and can not to grow; All the other 46 clones carry out bacterium liquid PCR and identify; The result has 42 clones to be shown as the positive, can judge that VHH recombinant fragment insertion rate is about 84%, so VHH antibody library storage capacity is about 3.1 * 10 ⁵* 84%=2.6 * 10 ⁵Cfu.In addition; 10 positive colony sequencing results choosing show that the hinge area of 3 clone VHH sequences is the distinguished sequence of IgG2a hypotype antibody; The hinge area of all the other 7 clones' VHH sequence is the distinguished sequence of IgG3 hypotype antibody, and therefore 10 clone VHH are all from heavy chain antibody; And 10 clones are except that VHH12, and the hydrophilic characteristics amino acid of heavy chain antibody VHH is all contained in 37,44,45,47 sites in its sequence FR2 district; 10 clones' sequence is all different, explains that this antibody library variety is better.Expanding numerous M13KO7 helper phage titer determination result is 10 ¹⁴Pfu/mL, antibody library separate obtaining the recombinant phage expression library after helper phage infects.Get isolating phage library 10 ¹⁰Times diluent 100 μ L behind the infection host bacterium TG1, get and infect liquid 100 μ L and on 2 * YTAG culture plate, be coated with overnight cultures and count, and have 33 resistive clone's colonies, calculate the phage antibody library titre and are about 3.3 * 10 ¹³Pfu/mL.Only containing does not simultaneously all have the positive colony colony on the negative control plate of phage and TG1 host bacterium and grows

Three, have screening and the preparation that allinase suppresses active Ab1 antibody

1. allinase bonded antibody in the affine elutriation technology screening VHH antibody library

(1) with 5 μ g/mL allinase coated elisa plates, 4 ℃ are spent the night, 0.05%PBST detersive enzyme target 5 times; (2) 3%BSA sealing is hatched 2h for 37 ℃, and PBST washes plate 5 times;

(3) add phage VHH antibody library 1010pfu/ hole, hatch 2h for 37 ℃, PBST washes plate 15 times;

(4) with wash-out behind elution buffer (0.1mol/L glycocoll, pH 2.0) the incubated at room 10min, elutriant is neutralized to pH 7.0 with neutralization buffer (1mol/L Tris-HCl, pH 9.0) immediately;

(5) elutriant infects the TG1 bacterium liquid 30min of logarithmic phase; Get 10 μ L respectively, 1 μ L, 0.1 μ L infect liquid and coat on the LB solid culture plate that contains 50 μ g/mL penbritins and 2% glucose; 30 ℃ of incubated overnight, the recombinant phage titre of mensuration wash-out;

(6) residue infection liquid is used for amplification; Repeat above-mentioned absorption-elutriation-elution process; Carry out three-wheel enrichment screening altogether; Second takes turns the antigen coated concentration of allinase of screening with third round is decremented to 2 μ g/mL and 1 μ g/mL respectively, calculates each enrichment index of taking turns (Output phages/Input phages);

(7) after the last screening, choose 40 mono-clonals, after bacterium colony PCR preliminary evaluation, send order-checking, carry out sequential analysis.

After the affine elutriation screening of three-wheel, the positive colony enrichment index of antibody library raises gradually, and the carrying out of taking turns screening along with every is described, the positive colony of antigen-specific has obtained effective enrichment in the antibody library.Enrichment index result sees table 1

Table 1 is through the enrichment index of the affine screening of three-wheel back allinase bonded phage clone

The end being taken turns the sequencing result of 40 positive colonies of screening analyzes; Find only A2, A7, A13; Aminoacid sequence 3 ' end of 4 clones such as A25 carries the hinge sequence of IgG2a hypotype; All the other clones' aminoacid sequence 3 ' end all carries the hinge sequence of IgG3 hypotype, shows that only these 4 VHH sequences are from IgG2a hypotype heavy chain antibody, and all the other VHH are all from the IgG3 hypotype.In addition, except A7, two clones' of A11 the VHH sequence C DR3 head of district is outside 7 amino acid, and all the other VHH clones' CDR3 section length is in 10～28 amino acid scopes, and mean length is 16.9 amino acid.A4 wherein, A5, A6, A10, A15, A18, A21; A27, A30, A36, clone's such as A40 sequence is in full accord, is repeated cloning, long 16 amino acid of its CDR3, and A8; A19, A20, A23, A24, A26, A35, clone's such as A39 sequence is consistent; Long 17 amino acid of CDR3, A14, A16, A31, the several clones' of A32 sequence is also consistent, long 21 amino acid of CDR3, residue clone is no repeated cloning.In view of clone such as the A4 frequency of occurrences the highest, so select it to analyze, and as candidate's inhibiting antibody in order to express and active detection.Sequential analysis is as shown in Figure 1, and its FR2 district, skeleton district contains VHH hydrophilic amino acid characteristic site F37, E44, and R45, G47, and 3 ' terminal amino acid sequence GTNEVCK is the distinguished sequence of IgG3 hypotype hinge, shows that this VHH is from IgG3 hypotype antibody.In addition, VHHA4 in the comparison of ncbi database login carrying out Blast homologous sequence, is found that the homology of VHH A4 and dromedary and alpaca source VHH sequence is 61%-67%.

2.VHH the amalgamation and expression of A4 antibody and purifying

VHH A4 gene is inserted expression vector pGEX4T-1; And in e. coli bl21 (DE3), carry out abduction delivering; Expression product with GST Binding Resin affinitive layer purification after, respectively with 12%SDS-PAGE electrophoresis detection Expression of Fusion Protein and purifying situation.Result such as Fig. 3 A show; Compare with the reorganization of inductive not bacterium through the recombinant expressed bacterium of inductive; One protein band that conforms to fusion rotein GST-VHH A4 theoretical molecular is arranged at about 45kD place, and express bacterium after ultrasonication, lysate deposition and supernatant all have the purpose fusion rotein; Behind the treated purifying, obtain the comparatively single GST-VHH A4 of band fusion rotein.

Four, the antigen binding characteristic of VHHA4 and to the active restraining effect of allinase

1.VHHA4 the antigen binding characteristic

Western blot detects the allinase binding specificity of VHH A4 single domain antibody, and the VHH A4 antibody of amalgamation and expression can be 53kD place and allinase generation specific combination in size as a result, and does not have association reaction with N,O-Diacetylmuramidase.The ELISA experiment also draws equifinality.Show that VHH A4 combines with allinase to have specificity.

2.VHHA4 to the active restraining effect of allinase

With different concns VHH A4 antibody with allinase in 37 ℃ hatch 1h altogether after; Measuring the allinase residual enzyme lives; The IC50 value of calculating VHH A4 is about 20nmol/L; Point out this antibody to have stronger enzyme retarding effect, and the conventional antibody IgG1 in irrelevant antibody VHH23 and the camel immune serum does not detect allinase is had the obvious suppression effect.In order to confirm whether VHHA4 combines with the active site of enzyme; Employing is combined in the allinase micromolecular inhibitor Trolovol (penicillamine) of enzyme active center as competitive inhibitor; Adopt competitive ELISA to detect under there is situation in Trolovol the binding ability of VHHA4 and allinase.The result shows 10 ^-5The Trolovol of mol/L can be competed combining of 50% VHHA4 antibody (10umol/L) and allinase.Prompting VHHA4 binding site is the active site of enzyme.

Five, the screening and the preparation that have the active Ab2 antibody of allinase

Adopt VHHA4 that the VHH phage display library that makes up is carried out once more affine screening.Method is the same.VHHA4 albumen is coated on the 96 hole elisa plates, imports 10 altogether ¹³Individual VHH phage, take turns screening through one after, obtain 16 with VHHA4 bonded zygote.These clone's called afters VHHCx.These sequences are measured show that these 16 clones all represent different gene.According to the aminoacid sequence of releasing, these VHH genes, its CDR3 length does not wait from 9-25 amino acid, 18 amino acid of average out to.According to the length of CDR3 with whether express easily, therefrom selected 7 genes, their subclones were carried out expression in pET30a prokaryotic expression carrier (being with the 6xHis label).These 7 VHH genes all can be expressed in E.coli, obtain purity near 90% recombinant protein through the Ni-sephorase affinitive layer purification.Adopt 4-MP side that the allinase activity of the VHH-His fusion rotein of these purifying is measured.See table 2:

The determination of activity of table 2.VHH fusion rotein allinase

In the VHH single domain antibody of measuring, it is active that VHH C10, VHH C17, VHH C1 and VHH C16 have tangible allinase, wherein VH _{H C10}Active and natural allinase specific activity is more approaching, is about it than 1/3 of vigor.These results show, adopt the abzyme preparation method based on camel single domain VHH among the present invention can obtain very a high proportion of abzyme, are about 57% (4/7).And the abzyme preparation method who adopts conventional antiidiotypic antibody can only obtain the catalytic antibody of very low ratio; Like Glynis Johnson (Johnson G, Moore SW.Catalytic antibodies with acetylcholinesterase activity.J Immunol Methods.2002 Nov1; 269 (1-2): 13-28; Johnson G, Moore SW.Cholinesterase-like catalytic antibodies:reactionwith substrates and inhibitors.Mol Immunol.2000 Aug-Sep; 37 (12-13): 707-19.) adopt, can only obtain the purpose catalytic antibody of 6.9%-11.1% based on the MONOCLONAL ANTIBODIES SPECIFIC FOR method.This shows that the abzyme preparation method based on camel single domain VHH that the present invention proposes is a kind of efficient, easy abzyme preparation strategy.

Six, the enzymatic property analysis of Ab2 VHH catalytic antibody

For understanding the catalysis characteristics of Ab2 VHH catalytic antibody and natural allinase, we adopt alliin to measure the enzyme kinetics of VHHC10 and allinase respectively as catalytic substrate.The result finds that VHHC10 is the same with allinase, also follows the Michaelis-Menten equation, through the Lineweaver-Burk double reciprocal curve, calculates its Km and Vmax value and is respectively 1.326mM and 0.515 μ Mmin ^-1, and allinase is 1.418mM and 0.737 μ Mmin ^-1Other kinetic parameters of VHHC10 are seen table 3

The enzyme kinetics parameter of table 3. catalytic antibody VHHC10 and allinase catalytic substrate alliin relatively

VHHC10 is as Ab2 antibody; According to antiidiotypic antibody network regulation theory; The Ab1 antibody that its enzymic activity should receive as VHHA4 suppresses; In order to verify this point, we adopt the VHHA4 of different concns and the micromolecular inhibitor Trolovol of allinase, measure its retarding effect to the VHHC10 enzymic activity.The result

Seven, abzyme body catalysis prodrug alliin is to the restraining effect of B16 mouse melanin tumor cell

Whether tumour cell is had lethal effect for the abzyme VHHC10 catalysis alliin of estimating the present invention's development forms garlicin, adopt the MTT method to measure the B16 MC (5 * 10 of vitro culture ⁴Cell/every hole) under the situation that alliin (20 μ g/ml) exists, cell proliferation and apoptosis situation.The MTT experimental implementation is following: in 96 porocyte culture plates, press 5 * 10 ⁴Cell/every hole kind is gone into the B16 MC, organizes with A respectively: VHHC10 (10 μ g/ml)+alliin (20 μ g/ml)+PLP (25 μ M); B group: allinase (10 μ g/ml)+alliin (20 μ g/ml)+PLP (25 μ M); C group: garlicin (1 μ g/ml); And VHHC10, allinase and alliin add control group separately and hatch, and behind the 24hr, the MTT reagent (25 μ g/ml) that adds 10 μ/hole is measured cell viability.The result shows that the VHHC10 abzyme can effectively transform alliin formation garlicin and growth produces the obvious suppression effect to the B10 cell, and the tumour inhibiting rate to B16 under 10 μ g/ml concentration is 55%, compares with control group to have significant difference (p＞0.01).The inhibiting rate of allinase (10 μ g/ml) and garlicin group (1 μ g/ml) is 70%, and VHHC10, allinase, alliin and PLP handle does not separately have obvious inhibiting rate (p＜0.01) to the B16 cell.These results show that abzyme VHHC10 has the potential application prospect in antineoplaston.

Claims

1. one kind prepares the universal method of catalytic antibody or abzyme and the application of these antibody; This method is based on camel antibody heavy chain variable region (the variable part of the heavy chain of heavy-chain antibodies of reorganization; Be called for short VHH) preferentially discern enzyme active center and have the characteristics of the finger-like CDR3 structure of protrusion, theoretical according to the networking regulation and control of antiidiotypic antibody analogue antigen, adopt that screening obtains to have the active antiidiotypic antibody of allinase in the VHH phage display library that the allinase immunity camel that derives from the garlic makes up; This method for preparing abzyme is except that adopting the phage display library technology; Can also adopt following method but be not limited to these methods to obtain the VHH phage display library of non-immunity, ribosomal display technology; The yeast display technique, mouse hybridoma technology etc.

2. according to the method under the claim 1, adopt the abzyme of other natural enzyme as the antigen acquisition.

3. according to the method under the claim 1, the allinase that has of acquisition suppresses active antibody, it is characterized in that aminoacid sequence and the nucleotide sequence shown in the SEQ ID NO.1.

4. according to the method under the claim 1, acquisition have the active antibody of allinase, it is characterized in that aminoacid sequence and the nucleotide sequence shown in the SEQ ID NO.2.

5. according to the method under the claim 1, acquisition have the active antibody of allinase, it is characterized in that aminoacid sequence and the nucleotide sequence shown in the SEQ ID NO.3.

6. according to the method under the claim 1, acquisition have the active antibody of allinase, it is characterized in that aminoacid sequence and the nucleotide sequence shown in the SEQ ID NO.4.

7. according to the method under the claim 1, acquisition have the active antibody of allinase, it is characterized in that aminoacid sequence and the nucleotide sequence shown in the SEQ ID NO.5.

8. according to the method under the claim 1, acquisition have the active antibody of allinase, carry out the antibody of deriving that chemical coupling or gene fusion prepare with target cell or tissue surface molecule or part.

9. according to the method under the claim 1, acquisition have the active antibody of allinase, carry out mutant antibody humanization modified or that rite-directed mutagenesis obtains.

10. claim 4; 5,6,7; 8; Antibody or compsn or modifier under in the of 9, include but not limited to the application in the following disease in treatment: various tumours comprise solid tumor, lymphoma, osteosarcoma and central nerve neuroma, infection, hyperlipidemia, atherosclerosis, mellitus and anaphylactic disease.