CN102344967A - Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof - Google Patents
Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof Download PDFInfo
- Publication number
- CN102344967A CN102344967A CN2011103412692A CN201110341269A CN102344967A CN 102344967 A CN102344967 A CN 102344967A CN 2011103412692 A CN2011103412692 A CN 2011103412692A CN 201110341269 A CN201110341269 A CN 201110341269A CN 102344967 A CN102344967 A CN 102344967A
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna
- sequencing
- enzyme
- template
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to a method for shortening DNA sequencing of a DNA template and application thereof. The method comprises the following steps of: (1) determining a small segment of sequence which is fixed in the DNA template by synthesizing or adopting a connecting sequencing method; (2) stopping the sequencing of sequencing primers, adding four kinds of dNTPs monomer extension sequencing primer strands, and making the DNA template become double strands; (3) shortening the DNA template: processing by using restriction enzyme to preset a connexon with an enzyme recognition sequence; and fracturing a small segment of sequence in the determined DNA template; (4) connecting the sequencing primer and a double stranded oligonucleotide segment with the enzyme recognition sequence on the cut and shortened DNA template; (5) denaturing, removing unfixed DNA strands, and obtaining the DNA template again; (6) hybridizing the sequencing primer, and continuously determining the small segment of sequence fixed in the DNA template; and (7) repeating the step (2) to the step (6) until the sequencing of the undermined DNA template is completed.
Description
Technical field
The invention belongs to gene sequencing technical field in the biotechnology, be specifically related to a kind of dna sequencing method and application thereof of shortening dna profiling, especially be fit to the high-throughput dna sequencing.
Technical background
Carrying out and accomplishing of the Human Genome Project and various model animals genome plans makes the mankind step into back era gene, and the biological study and the medical research in the present age produced tremendous influence, and the molecular biology related discipline has obtained swift and violent development.From the difference of gene level understanding life, disease takes place, development law, and the interaction of medicine and life entity will become possibility.With regard to gene sequencing, the emphasis of back era gene has been measured by whole genome sequence and has been transferred to the comparison of hereditary difference between idiogenetics difference and species in the genome.Aspect fundamental research, the sequential analysis of DNA is the basis of further research and transformation goal gene, the genetic development of study of disease gene, clone's Disease-causing gene; In application facet, directly seek the susceptibility gene mutation site of disease, through mutator gene type in the genome sample of a certain specified disease being identified on a large scale and being detected, can obtain about with the information of this disease related gene type.At present, the sequencing technologies of widespread use is the double deoxidating chain end cessation method of Sanger etc. (1977) invention the most, and traditional Sanger dna sequencing method still is in the status that can not be substituted, but there is the low and problem of ultra-high price of flux in this method.The expense that first human genomic sequence is measured is approximately 1,000,000,000 dollars, and this expense has been reduced to about 2,000 ten thousand dollars at present, and therefore, the progress of functional genome still is subject to the dna sequencing technology.For this reason, U.S. Venter foundation proposed the goal in research of the human genome sequencings of 1000 U.S. dollars in 2003.At the beginning of 2004, the U.S. drops into state-run commune hospital more than 7,000 ten thousand dollars and supports the plan of dna sequencing Research on New, and its target is the sequencing technologies of development 100,000 U.S. dollars, and final the attenuating is 1,000 U.S. dollars.At present, the complete genome DNA sequencing technologies has become research field that competition is very fierce in the world.The 454Life Sciences company of the U.S. is based on the burnt sequencing technologies of the high-flux parallel of emulsion PCR product; Bridge-type amplification-DNA the chip of Illumina (Solexa) company extends sequencing technologies; And all there is sophisticated commercialization instrument listing in AppliedBiosestems (SOLiD) company based on the hybridization of emulsion PCR product-enzyme connection-enzyme cutting high throughput sequencing technologies.In addition, some high-flux sequence appearance based on single-molecule sequencing also begin to emerge.
Yet all these high-flux sequence appearance instruments still adopt the connection method of label probe no matter be the synthesis method that adopts labeling dye Nucleotide, and its characteristics all are continuous prolongations of sequencing primer.Yet no matter synthesize, still connect sequence measurement; Efficient always can not reach 100%; Every pacing preface reaction all will consume certain " correctly " sequencing primer; And produce the sequencing primer of " mistake ", therefore, along with the continuous increase of synthetic (perhaps connecting) number of times; This cumulative mistake is just more and more; And the accuracy of order-checking is to be provided by the marker signal that correctly synthesizes (perhaps connecting), so its order-checking accuracy just worse and worse.
Summary of the invention
The technical problem that solves: the purpose of this invention is to provide a kind of dna sequencing method and application thereof of shortening dna profiling; This method adopts the high throughput sequencing technologies of circulation " sequencing primer "; One section sequence in the dna profiling of soon having measured cuts away (shortening dna profiling); And after connecting the sequencing primer fragment again; Continuation is carried out sequencing to the undetermined dna profiling; For complete genome DNA D sequential analysis provides a kind of novel method; Set up accurately; Increase order-checking length, cheap genome sequence determination techniques.
Technical scheme: a kind of dna sequencing method that shortens dna profiling; (1) introduces one section starting point that comprises the target oligonucleotide sequence of IIS restriction enzyme enzyme recognition site as sequencing, adopt to synthesize perhaps to connect sequence measurement a bit of sequencing in the fixed dna template; (2) stop the order-checking of this sequencing primer, and add four kinds of dNTPs (dATP, dGTP, dCTP, dTTP) monomer extension sequencing primer chain, make dna profiling become two strands; (3) shorten dna profiling: handle preestablishing the connexon that comprises enzyme recognition sequence with restriction enzyme, with a bit of sequence fracture in the dna profiling of having measured; (4), be connected on the shortening dna profiling after the above-mentioned cutting with sequencing primer and comprise the double chain oligonucleotide fragment of enzyme recognition sequence; (5) loose DNA chain is removed in sex change, regains dna profiling; (6) sequencing by hybridization primer continues a bit of sequence in the fixed dna template is measured; (7) repeating step (2) is accomplished up to undetermined dna profiling sequencing to (6); A bit of sequencing in the said dna profiling is to confirm that apart from the Nucleotide number of enzyme recognition site the sequence fragment that is checked order is the position of enzyme recognition site cutting DNA template according to restriction enzyme site; All need introduce enzyme recognition site in each preparation process of dna profiling, restriction enzyme site is confirmed apart from the Nucleotide number of enzyme recognition site.
Said enzyme recognition sequence is meant the restriction enzyme enzyme recognition site, and its broken site is a 2-30 base apart from recognition site.
Said enzyme recognition sequence is meant the restriction enzyme enzyme recognition site,, best broken site is apart from a recognition site 8-25 base.
Shorten the application of dna sequencing method in measuring the people's gene group of dna profiling, step is:
(1) with the people's gene group with Fok I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mly I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order;
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react; The full genome of the people of amplified fragmentsization; And these microballons are fixed on the flat plate substrate, and obtain the full genome single stranded DNA of people sequencing template through sex change;
(3) 3 ' end being contained the sequencing primer that Mly I enzyme can recognition sequence hybridizes with the fixed dna profiling;
(4) under dna profiling instructs, adopt business-like SOLiD to connect sequencing reagent and sequence measurement thereof, measure preceding 9 bases of all dna profilings;
(5) after the 9th base measured completion, the cleaning reaction pond added four kinds of dNTPs (dATP, dGTP, dCTP, dTTP) monomer; Under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain; And become two strands, and cleaning reaction pond with dna profiling;
(6) Mly I enzyme and damping fluid thereof are added in the above-mentioned reaction tank, 37 ℃ the reaction 2 hours, its broken site of cutting double-stranded DNA is recognition sequence 3 ' terminal downstream 9 or 5 ' 11 base places, terminal downstream, and with the T4 kinases with 5 terminal phosphateizations;
(7) with new sequencing primer fragment, and comprise following enzyme Mly I recognition sequence, said upstream primer is answered polishing 2 base breach:
Corresponding sequencing primer sequence: 5 ' ... GGCGGA (N) 2;
Corresponding sequencing primer sequence complementary sequence, p representes phosphate group: 3 ' ... CCGCCT ' p;
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening;
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template.
(9) repeating step (4) obtains the sequence information of 1-9 base on the new template;
(10) repeating step (4) carries out cycle sequencing, every sequencing length that repeats once to increase by 9 base positions to (9);
(11) the base sequence fragment of dna profiling on all positions is accomplished assembling, obtain people's complete genome DNA sequence.
Shorten the application of dna sequencing method in measuring the bacillus coli gene group of dna profiling, step is:
(1) with the bacillus coli gene group with Mme I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mme I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order;
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react; The bacillus coli gene group of amplified fragmentsization; And these microballons are fixed on the flat plate substrate, and obtain bacillus coli gene group single stranded DNA sequencing template through sex change.
(3) 3 ' end being contained the sequencing primer that Mme I enzyme can recognition sequence hybridizes with the fixed dna profiling;
(4) under dna profiling instructs, adopt business-like Solexa to extend sequencing reagent and sequence measurement thereof, measure preceding 18 bases of all dna profilings;
(5) after the 18th base measured completion, the cleaning reaction pond added four kinds of dNTPs (dATP, dGTP, dCTP, dTTP) monomer; Under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain; And become two strands, and cleaning reaction pond with dna profiling;
(6) Mme I enzyme and damping fluid thereof are added in the above-mentioned reaction tank, 37 ℃ the reaction 2 hours, its broken site of cutting double-stranded DNA is recognition sequence 3 ' terminal downstream 18 or 5 ' 20 base places, terminal downstream, and with the T4 kinases with 5 terminal phosphateizations;
(7) with new sequencing primer fragment, and comprise following enzyme Mly I recognition sequence, upstream primer needs polishing 2 base breach:
Corresponding sequencing primer sequence: 5 ' ... TCCRAC (N)
2
Corresponding sequencing primer sequence complementary sequence, p representes phosphate group: 3 ' ... AGGYTGp;
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening;
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template;
(9) repeating step (4) obtains the sequence information of 1-18 base on the new template;
(10) 36 base sequence fragments of dna profiling on all positions are accomplished assembling, obtain bacillus coli gene group complete genome DNA sequence.
Beneficial effect: the IIS restriction enzyme has the ability at recognition site part degradation of dna.The size of these enzymes is about about 400-650 amino acid, and the asymmetric sequence of they identification successive has one to combine the territory of recognition site and the functional domain of a special cutting DNA.Such as the following specific region of Mly I enzyme ability recognition sequence, its broken site is recognition sequence 3 ' terminal downstream 9 or 5 ' 11 base places, terminal downstream:
5′...GGCGGA(N)
11^...3′
3′...CCGCCT(N)
9^...5′
And the following specific region of Mme I enzyme ability recognition sequence, its broken site is recognition sequence 3 ' terminal downstream 18 or 5 ' 20 base places, terminal downstream:
5′...TCCRAC(N)
20^...3′
3′...AGGYTG(N)
18^...5′
According to these characteristics of restriction enzyme; When the present invention prepares in the dna sequencing template; Introduce one section starting point that comprises the oligonucleotide sequence of IIS restriction enzyme enzyme recognition site as sequencing; After synthetic when adopting (perhaps connecting) sequencing is measured several base sequences; At polysaccharase and dNTPs (dATP; DGTP; DCTP; DTTP) under the effect; The remaining strand district of sequencing primer becomes two strands; Under selected restriction enzyme effect (cutting the base number of known number), the restriction endonuclease of restriction endonuclease sites carries out the solid phase cutting makes template to be measured shorten several bases (number of correspondence sequencing last time).Again connect sequencing primer (this primer still contains the restriction enzyme enzyme recognition site) then, after the same method, carry out the next round sequencing reaction.Through the too much such order-checking of wheel, just can reach the purpose that improves the order-checking reading length.
Thereby the present invention is compared with prior art, has following advantage:
1. great advantage of the present invention is the limited length of the template sequence of each sequencing primer mensuration, thereby the accuracy of its order-checking is high.
2. owing to, under the prerequisite that guarantees high order-checking accuracy, can improve the reading length of dna sequence dna through constantly shortening dna profiling.
3. the sophisticated conventional Protocols in Molecular Biology of employing of the present invention, thereby implement not exist technical problem.
Description of drawings
Fig. 1 is a kind of determined dna sequence synoptic diagram that shortens the dna sequencing method of dna profiling of the present invention.Have among the figure: dna profiling carrier 1; Unknown dna profiling sequence 2(wherein is respectively manually-injected connexon 2-1 and 2-2 in two ends; And contain restriction endonuclease recognition sequence fragment among the 2-1); Sequencing primer 3; Prolongation chain 4 by sequencing primer after one section sequence of synthetic (perhaps connecting) order-checking mensuration; The extended chain of sequencing primer with become double-stranded 5 with dna profiling; Its broken site of restriction endonuclease recognition sequence fragment otch 6(is recognition sequence a 3 ' terminal downstream M or a 5 ' terminal downstream N base place); The cutting DNA template connects the double chain oligonucleotide sequence 7 that contains restriction endonuclease recognition sequence fragment; Shorten dna profiling 8; New sequencing primer 9(can be identical with 3, also can be inequality).Treated unknown dna profiling sequence (2) is fixed on the carrier (1) through 5 ' end; After (a) hybridized in sequencing primer (3) and unknown completion; Can adopt labeled nucleotide to extend (Bentley DR; Balasubramanian S; Swerdlow HP; Smith GP; Et a l.Accurate whole human genome sequencingusing reversible terminator chemistry.Nature; 2008; 456; 53-59); Label probe connects (Shendure J; Porreca GJ; Reppas NB; Lin X; Et al.Accurate multiplex polony sequencing of an evolved bacterialgenome.Science; 2005; 309; 1728-1732); And after other sequence measurement (b) carries out a bit of fragment (4) of the unknown dna profiling sequence of sequencing; Add four kinds of dNTPs monomers; Extend below (c) sequencing primer chain in the archaeal dna polymerase effect, making it becomes two strands (5) with dna profiling, handles (d with restriction endonuclease then; E) be double-stranded DNA, dna profiling is ruptured at otch (6).The double chain oligonucleotide fragment (7) that will comprise enzyme recognition sequence connects on (f) template after the above-mentioned cutting; And, regain single stranded DNA template (8) through sex change (g); Again hybridization (h) sequencing primer (8) is measured a bit of sequence of deciding in the dna profiling (8).
Fig. 2 is an electrophorogram of handling the complementary double-stranded sequence of artificial synthetic oligonucleotide with Fok I enzyme.The concrete experiment as follows: synthetic following two artificial oligonucleotide sequences:
5’-Cy3-TTGTCTTTC
ATCTGCTGCAGCTCGGGCGGCGTATAGTGAGTCGTATTAGGATCC
3’-AACAGAAAG
TAGACGACGTCGAGCCCGCCGCATATCACTCAGCATAATCCTAGG
Two sequences is complementary fully, and contains the specific region (square frame black matrix part in the sequence) of Fok I enzyme identification, and mark Cy3 dyestuff wherein is to make things convenient for electrophoresis observation.
Non-marked sequence hybridization 30 minutes (be placed on and be heated to 80 degree in the 200 microlitre PCR pipe, slowly be chilled to room temperature) with flag sequence 0.5nmol and 1nmol is divided into 2 parts then in the PCR pipe.
The a Fok I enzyme that adds 50U was handled 2 hours for 37 ℃ in the PCR pipe; Portion is left intact.
Above-mentioned Fok I enzyme is handled and the product of not doing any processing, and carry out electrophoretic analysis respectively: the result shows that the fluorescence dye band (2) after the processing is than the band of not doing any processing (1) fragment " weak point ".This result and with Fok I enzyme identification particular sequence, and its broken site is that the notional result at recognition sequence 3 ' terminal downstream 9 or 13 base places is consistent.
Embodiment
Embodiment 1: the connection sequencing that shortens dna profiling is measured the people's gene group
(1) with the people's gene group with Fok I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected (supposition is 20 bases) with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mly I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order.
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react the full genome of the people of amplified fragmentsization.And these microballons are fixed on the flat plate substrate, and obtain the full genome single stranded DNA of people sequencing template through sex change.
(3) with sequencing primer (3 ends contain Mly I enzyme ability recognition sequence) and the hybridization of fixed dna profiling.
(4) with reference to accompanying drawing 1; Under dna profiling instructs; Adopt business-like SOLiD to connect sequencing reagent and sequence measurement (Shendure J, Porreca GJ, Reppas NB; Lin X; Et al.Accurate multiplex polony sequencing of anevolved bacterial genome.Science, 2005,309; 1728-1732), measure preceding 9 bases of all dna profilings.
(5) after the 9th base measured completion, the cleaning reaction pond adds dNTPs (dATP, dGTP, dCTP, dTTP) monomer, and under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain, and became two strands with dna profiling, and the cleaning reaction pond.
(6) add Mly I enzyme and damping fluid thereof in above-mentioned reaction tank, 37 ℃ of reactions 2 hours, its broken site of cutting double-stranded DNA was recognition sequence 3 ' terminal downstream 9 or 5 ' 11 base places, terminal downstream.And with the T4 kinases with 5 terminal phosphateizations
(7), and comprise following enzyme Mly I recognition sequence (upstream primer needs polishing 2 base breach) with new sequencing primer fragment:
5 ' ... GGCGGA (N)
2(corresponding sequencing primer sequence)
3 ' ... CCGCCT ' p (corresponding sequencing primer sequence complementary sequence, p representes phosphate group)
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening.
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template.
(9) repeating step (4) obtains the sequence information (sequence information that is equivalent to a former dna profiling 10-18 base position) of 1-9 base on the new template.
(10) repeating step (4) is to (9), and circulate " shortening the dna profiling method " checked order every sequencing length that repeats once to increase by 9 base positions.
(11) the base sequence fragment of dna profiling on all positions is accomplished assembling, obtain people's complete genome DNA sequence.
Embodiment 2: the extension sequencing that shortens dna profiling is measured the bacillus coli gene group
(1) with the bacillus coli gene group with Mme I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected (supposition is 20 bases) with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mme I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order.
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react the bacillus coli gene group of amplified fragmentsization.And these microballons are fixed on the flat plate substrate, and obtain bacillus coli gene group single stranded DNA sequencing template through sex change.
(3) with sequencing primer (3 ends contain Mme I enzyme ability recognition sequence) and the hybridization of fixed dna profiling.
(4) with reference to accompanying drawing 1; Under dna profiling instructs; Adopt business-like Solexa to extend sequencing reagent and sequence measurement (Bentley DR, Balasubramanian S, Swerdlow HP; Smith GP; Et a l.Accurate whole humangenome sequencing using reversible terminator chemistry.Nature, 2008,456; 53-59), measure preceding 18 bases of all dna profilings.
(5) after the 18th base measured completion, the cleaning reaction pond adds the dNTPs monomer, and under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain, and became two strands with dna profiling, and the cleaning reaction pond.
(6) add Mme I enzyme and damping fluid thereof in above-mentioned reaction tank, 37 ℃ of reactions 2 hours, its broken site of cutting double-stranded DNA was recognition sequence 3 ' terminal downstream 18 or 5 ' 20 base places, terminal downstream.And with the T4 kinases with 5 terminal phosphateizations;
(7), and comprise following enzyme Mly I recognition sequence (upstream primer needs polishing 2 base breach) with new sequencing primer fragment:
5 ' ... TCCRAC (N)
2(corresponding sequencing primer sequence)
3 ' ... AGGYTGp (corresponding sequencing primer sequence complementary sequence, p representes phosphate group)
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening.
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template.
(9) repeating step (4) obtains the sequence information (sequence information that is equivalent to a former dna profiling 19-36 base position) of 1-18 base on the new template.
(10) 36 base sequence fragments of dna profiling on all positions are accomplished assembling, obtain bacillus coli gene group complete genome DNA sequence.
Sequence table
< 110>Southeast China University
< 120>a kind of dna sequencing method and application thereof of shortening dna profiling
<130>
<160> 2
<170> PatentIn?version?3.3
<210> 1
<211> 59
<212> DNA
< 213>artificial sequence
<400> 1
ttgtctttcg?gatgatctgc?tgcagctcgg?gcggcgtata?gtgagtcgta?ttaggatcc 59
<210> 2
<211> 59
<212> DNA
< 213>artificial sequence
<400> 2
aacagaaagc?ctactagacg?acgtcgagcc?cgccgcatat?cactcagcat?aatcctagg 59
Claims (5)
1. dna sequencing method that shortens dna profiling; It is characterized in that one section starting point that comprises the target oligonucleotide sequence of IIS restriction enzyme enzyme recognition site as sequencing of (1) introducing, adopt to synthesize perhaps to connect sequence measurement a bit of sequencing in the fixed dna template; (2) stop the order-checking of this sequencing primer, and add four kinds of dNTPs monomers extension sequencing primer chains, make dna profiling become two strands; (3) shorten dna profiling: handle preestablishing the connexon that comprises enzyme recognition sequence with restriction enzyme, with a bit of sequence fracture in the dna profiling of having measured; (4), be connected on the shortening dna profiling after the above-mentioned cutting with sequencing primer and comprise the double chain oligonucleotide fragment of enzyme recognition sequence; (5) loose DNA chain is removed in sex change, regains dna profiling; (6) sequencing by hybridization primer continues a bit of sequence in the fixed dna template is measured; (7) repeating step (2) is accomplished up to undetermined dna profiling sequencing to (6); A bit of sequencing in the said dna profiling is to confirm that apart from the Nucleotide number of enzyme recognition site the sequence fragment that is checked order is the position of enzyme recognition site cutting DNA template according to restriction enzyme site; All need introduce enzyme recognition site in each preparation process of dna profiling, restriction enzyme site is confirmed apart from the Nucleotide number of enzyme recognition site.
2. the dna sequencing method of shortening dna profiling according to claim 1 is characterized in that enzyme recognition sequence is meant the restriction enzyme enzyme recognition site, and its broken site is a 2-30 base apart from recognition site.
3. the dna sequencing method of shortening dna profiling according to claim 1 is characterized in that enzyme recognition sequence is meant the restriction enzyme enzyme recognition site,, best broken site is apart from a recognition site 8-25 base.
4. shorten the application of dna sequencing method in measuring the people's gene group of dna profiling, it is characterized in that step is:
(1) with the people's gene group with Fok I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mly I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order;
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react; The full genome of the people of amplified fragmentsization; And these microballons are fixed on the flat plate substrate, and obtain the full genome single stranded DNA of people sequencing template through sex change;
(3) 3 ' end being contained the sequencing primer that Mly I enzyme can recognition sequence hybridizes with the fixed dna profiling;
(4) under dna profiling instructs, adopt business-like SOLiD to connect sequencing reagent and sequence measurement thereof, measure preceding 9 bases of all dna profilings;
(5) after the 9th base measured completion, the cleaning reaction pond added four kinds of dNTPs monomers, and under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain, and became two strands with dna profiling, and the cleaning reaction pond;
(6) Mly I enzyme and damping fluid thereof are added in the above-mentioned reaction tank, 37 ℃ the reaction 2 hours, its broken site of cutting double-stranded DNA is recognition sequence 3 ' terminal downstream 9 or 5 ' 11 base places, terminal downstream, and with the T4 kinases with 5 terminal phosphateizations;
(7) with new sequencing primer fragment, and comprise following enzyme Mly I recognition sequence, said upstream primer is answered polishing 2 base breach:
Corresponding sequencing primer sequence: 5'...GGCGGA (N)
2Corresponding sequencing primer sequence complementary sequence, p representes phosphate group: 3'... CCGCCT'p;
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening;
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template;
(9) repeating step (4) obtains the sequence information of 1-9 base on the new template;
(10) repeating step (4) carries out cycle sequencing, every sequencing length that repeats once to increase by 9 base positions to (9);
(11) the base sequence fragment of dna profiling on all positions is accomplished assembling, obtain people's complete genome DNA sequence.
5. shorten the application of dna sequencing method in measuring the bacillus coli gene group of dna profiling, it is characterized in that step is:
(1) with the bacillus coli gene group with Mme I enzyme 37 ℃ handle 2 hours after; It is the fragment of 50-1000 base that ultrasonication becomes size; And under the effect of ligase enzyme, these fragmentation nucleotide sequences are connected with a pair of general connexon; The few nucleotide sequence of one of them general connexon and the sequence of amplimer are complementary fully; And the few nucleotide sequence of another connexon comprised Mme I enzyme can recognition sequence, and this specific region is positioned at the template starting position of checking order;
(2) the fragmentation nucleotide sequence that these connecting arms are connected be fixedly connected sub-complementary sequence and carry out emulsion Parallel PC R to microballon and react; The bacillus coli gene group of amplified fragmentsization; And these microballons are fixed on the flat plate substrate, and obtain bacillus coli gene group single stranded DNA sequencing template through sex change;
(3) 3 ' end being contained the sequencing primer that Mme I enzyme can recognition sequence hybridizes with the fixed dna profiling;
(4) under dna profiling instructs, adopt business-like Solexa to extend sequencing reagent and sequence measurement thereof, measure preceding 18 bases of all dna profilings;
(5) after the 18th base measured completion, the cleaning reaction pond added four kinds of dNTPs monomers, and under the effect of archaeal dna polymerase, 37 ℃ were reacted 0.5 hour, extended the sequencing primer chain, and became two strands with dna profiling, and the cleaning reaction pond;
(6) Mme I enzyme and damping fluid thereof are added in the above-mentioned reaction tank, 37 ℃ the reaction 2 hours, its broken site of cutting double-stranded DNA is recognition sequence 3 ' terminal downstream 18 or 5 ' 20 base places, terminal downstream, and with the T4 kinases with 5 terminal phosphateizations;
(7) with new sequencing primer fragment, and comprise following enzyme Mly I recognition sequence, upstream primer needs polishing 2 base breach:
Corresponding sequencing primer sequence: 5'... TCCRAC (N)
2
Corresponding sequencing primer sequence complementary sequence, p representes phosphate group: 3'... AGGYTGp;
With the double chain oligonucleotide fragment, under the effect of T4 ligase enzyme, reacted 0.5 hour with the double-stranded DNA template of above-mentioned cutting, shortening;
(8) handle the double-stranded DNA template 10 minutes after the above-mentioned connection with 0.1M NaOH, sex change obtains new single stranded DNA template;
(9) repeating step (4) obtains the sequence information of 1-18 base on the new template;
(10) 36 base sequence fragments of dna profiling on all positions are accomplished assembling, obtain bacillus coli gene group complete genome DNA sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110341269.2A CN102344967B (en) | 2011-11-02 | 2011-11-02 | Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110341269.2A CN102344967B (en) | 2011-11-02 | 2011-11-02 | Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102344967A true CN102344967A (en) | 2012-02-08 |
| CN102344967B CN102344967B (en) | 2014-10-08 |
Family
ID=45544038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110341269.2A Expired - Fee Related CN102344967B (en) | 2011-11-02 | 2011-11-02 | Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102344967B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106319033A (en) * | 2015-06-25 | 2017-01-11 | 王金 | Method for detecting chromosome abnormality and recombinant site DNA sequence |
| CN111455033A (en) * | 2020-03-31 | 2020-07-28 | 南京亿科人群健康研究院有限公司 | Technology sequencing platform based on Illumina |
| CN114040985A (en) * | 2020-03-09 | 2022-02-11 | 因美纳有限公司 | Method for sequencing polynucleotides |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5508169A (en) * | 1990-04-06 | 1996-04-16 | Queen's University At Kingston | Indexing linkers |
| US6509160B1 (en) * | 1994-09-16 | 2003-01-21 | Affymetric, Inc. | Methods for analyzing nucleic acids using a type IIs restriction endonuclease |
-
2011
- 2011-11-02 CN CN201110341269.2A patent/CN102344967B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5508169A (en) * | 1990-04-06 | 1996-04-16 | Queen's University At Kingston | Indexing linkers |
| US6509160B1 (en) * | 1994-09-16 | 2003-01-21 | Affymetric, Inc. | Methods for analyzing nucleic acids using a type IIs restriction endonuclease |
Non-Patent Citations (1)
| Title |
|---|
| 陆祖宏等: "快速低成本全基因组DNA测序技术", 《中国生物医学工程学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106319033A (en) * | 2015-06-25 | 2017-01-11 | 王金 | Method for detecting chromosome abnormality and recombinant site DNA sequence |
| CN106319033B (en) * | 2015-06-25 | 2021-03-09 | 艾博锐克生物科技(山东)有限公司 | Method for detecting chromosome abnormality and recombination site DNA sequence |
| CN114040985A (en) * | 2020-03-09 | 2022-02-11 | 因美纳有限公司 | Method for sequencing polynucleotides |
| CN111455033A (en) * | 2020-03-31 | 2020-07-28 | 南京亿科人群健康研究院有限公司 | Technology sequencing platform based on Illumina |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102344967B (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107002292B (en) | A kind of construction method and reagent in the twin adapter single stranded circle library of nucleic acid | |
| CN107075513B (en) | Isolated oligonucleotides and their use in nucleic acid sequencing | |
| CN103789435B (en) | A kind of miRNA fluorescence detection reagent kit based on cascade constant-temperature amplification and method | |
| JP2019518434A (en) | Hybridization chain reaction method for in situ molecular detection | |
| JP7332733B2 (en) | High molecular weight DNA sample tracking tags for next generation sequencing | |
| CN102634586B (en) | Decoding and sequencing method by real-time synthesis of two nucleotides into deoxyribonucleic acid (DNA) | |
| CN105087771B (en) | Method for identifying microorganism species in sample and kit thereof | |
| CN105745334A (en) | Methods to profile molecular complexes via proximity dependant barcoding | |
| JP7033602B2 (en) | Barcoded DNA for long range sequencing | |
| US11761037B1 (en) | Probe and method of enriching target region applicable to high-throughput sequencing using the same | |
| CN103764849A (en) | Method for genome complexity reduction and polymorphism detection | |
| JP2017533709A (en) | Sequencing from multiple primers to increase data speed and density | |
| WO2017004083A1 (en) | Methods of producing nucleic acid libraries and compositions and kits for practicing same | |
| US10011866B2 (en) | Nucleic acid ligation systems and methods | |
| CN114729349A (en) | Method for detecting and sequencing barcode nucleic acid | |
| CN106434866B (en) | Real-time sequencing method for synthesizing two nucleotides with reversible closed 3' ends | |
| US20150072344A1 (en) | Barcoded Universal Marker Indicator (BUMI) Tags | |
| CN102344967B (en) | Method for shortening deoxyribonucleic acid (DNA) sequencing of DNA template and application thereof | |
| WO2011146942A1 (en) | Methods and kits to analyze microrna by nucleic acid sequencing | |
| EP3652345A2 (en) | Sequencing method for genomic rearrangement detection | |
| CN101693918B (en) | Method for improving specificity in cutting position of endonuclease V | |
| KR101727598B1 (en) | Method for Analyzing SNP of Mitochondrial DNA Using PNA Probe and Melting curve analysis | |
| KR101351990B1 (en) | Single Nucleotide Polymorphisms for Individual Identification of Hanwoo and Use Thereof | |
| EP2456892B1 (en) | Method for sequencing a polynucleotide template | |
| KR101648252B1 (en) | Method of collecting nucleic acid fragments separated from the sequencing process |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20171102 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |