CN102337276A - Non-fertilization endosperm autonomous initiation gene for rice and application of gene - Google Patents

Abstract

The invention discloses a non-fertilization endosperm autonomous initiation gene OsFIE2 for rice. The gene has the nucleotide sequence shown as SEQIDNo.1. The gene is generally expressed in reproductive organs and nutritive organs, such as flowers, roots and leaves of the rice. The gene codes protein of 376 amino acids, and the protein contains 6 WD40 functional domains and is one member of Polycomb group proteins. The gene participates in inhibiting the autonomous initiation of endosperm of the rice, has an important effect of regulating seed formation and also participates in controlling a leaf trait in rice and constructing a root system. The cloned gene can improve the development and growth conditions of roots, leaves, flowers and seeds of plants through a gene engineering technology. Aims of creating a new gene engineering yield improved line and promoting the breeding of a male sterile line of rice are fulfilled finally.

Description

Paddy rice does not rely on the autonomous producer of endosperm and the application thereof of fertilization

Technical field

The invention belongs to plant genetic engineering field, be specifically related to the autonomous producer of endosperm that a kind of paddy rice does not rely on fertilization OsFIE2Clone and application.Through the clone; RNA interferes and transgenic technology; Be applied to study function and effect in the morphogenesis of gene endosperm development and root leaf in the regulation and control seed, reach the purpose of creating genetically engineered yield improvement new lines and promoting the male sterible series of rice seed selection.

Background technology

Paddy rice is the model plant of current research, also is one of most important in the world two generalized grain crops.Rice nutrition is worth high, and there is the population more than 60% in China, and it is staple food with rice that there is the population more than 4/5 in the Asia.Along with the continuous increase of China's population, meanwhile, the per capita cultivated land but constantly reduces, and how to guarantee that the grain security of China has become the focus difficult point problem in the current Rice Production.Utilize hybrid vigour and the modern molecular biology technique of paddy rice, cultivation high yield, disease-resistant improved variety rice are the main paties that addresses this problem.

The rice yield height directly depends on the situation of growing of seed, and the gene that the relevant regulation and control of research seed growth is grown helps to solve the rice yield problem.Endosperm is the main moity in the rice paddy seed, possibly be the key factor that influences seed development to the grown gene of regulating effect function of endosperm.In paddy rice, we but know little about it to these genes.1999, the gene of relevant regulation and control endosperm development came to light in Arabidopis thaliana first, and it suppresses the autonomous development of endosperm.This gene belongs to a member of Polycomb extended familys; Polycomb family (PcG) is one type of epigenetic suppressor gene that extensively is present in the plant and animal; They many growths such as keep to the state that checks, cell proliferation regulation and control and the cell characteristics of keeping development related gene; Except Arabidopis thaliana; At little table, all found the homologous gene of this family in corn and the paddy rice at present, but do not reported out that these genes have function and the application prospect of in Arabidopis thaliana, similarly regulating and control the endosperm development effect.Because it has special regulating and controlling effect to endosperm development in Arabidopis thaliana; So the investigator is the autonomous producer of endosperm (AtFIE) that Arabidopis thaliana does not rely on fertilization with this unnamed gene; It has only a member in Arabidopis thaliana, but two members are arranged in corn and paddy rice, is respectively ZmFIE1; ZmFIE2 and OsFIE1, OsFIE2.

The present invention's separation has also been identified an autonomous producer of endosperm that paddy rice does not rely on fertilization OsFIE2This gene is in paddy rice, reproductions such as root and leaf, and vegetative organ is generally expressed, and also in endosperm, expresses simultaneously.Interfere and transgenic technology through RNA, discover that this gene is participated in the control leaf attitude of paddy rice and root system builds up, also participate in suppressing the autonomous generation of paddy endosperm simultaneously. OsFIE2The important regulation that is formed with to seed can be applied to the exploitation of yield improvement strain.In addition, OsFIE2Influence the pollen vigor, also can be applied to the breeding rice sterile line.

Summary of the invention

The object of the present invention is to provide a kind of autonomous producer of endosperm and function thereof that does not rely on fertilization to use.

The present invention separates from paddy rice and obtains OsFIE2Gene, the nucleotide sequence of this gene shown in SEQ ID No.1, sequence total length 1601bp.Gene contains 13 exons, and coding contains 376 amino acid whose albumen, and its aminoacid sequence is shown in SEQ ID No.2, and this albumen contains 6 conservative WD40 domains.

Those skilled in the art can combine gene of the present invention the RANi carrier of this gene of RNAi technique construction, further can this carrier be imported plant expression vector, obtain target OsFIE2(specificity suppresses the RANi recombinant expression vector of gene OsFIE2Expression), and then obtain the transfer-gen plant that contains this carrier.Therefore, the present invention also comprises the RANi recombinant expression vector (Fig. 2) that is made up by said gene, and contains above-mentioned recombinant vectors transfer-gen plant.

Experimental verification contains in the RANi recombinant vectors transfer-gen plant OsFIE2Really (Fig. 3 a b), has reached inhibition by downward modulation in genetic expression OsFIE2The purpose of gene, and the expression measurer dependency of transfer-gen plant phenotype and goal gene (Fig. 3 c, d).Through observing T0 and T1 for RANi recombinant vectors transfer-gen plant phenotype, the result shows OsFIE2(Fig. 4) normally takes place in effect gene flowering time and floral organ; Participate in control leaf attitude of paddy rice and root system and build up (Fig. 5,6), especially in seed endosperm, play an important role; But the RNAi strain is seed autonomous development, and develops into the seed bigger than normal seed (Fig. 4 G).We also find simultaneously OsFIE2Effect gene the activity (the pollen abortion rate normally is no more than 5% up to 25%) of pollen.In a word, OsFIE2Gene Handling the g and D of rice nutrition and reproduction two aspects, and especially the regulating and controlling effect of (pollen fertility and seed development) has bigger application prospect and practical value aspect reproductive growth.

Advantage of the present invention and effect:

Gene of the present invention is generally expressed in each tissue; Can be used for gene at seed growth; Flower builds up research and yield improvement in the regulation and control with organ morphology such as root leaf, and especially the expression of this gene in pollen and endosperm influence seed selection and big or small improvement of the paddy rice grain of rice and the rice yield lifting that paddy pollen fertility and seed development can be applied to rice sterile line.

Description of drawings

Fig. 1 does OsFIE2Gene structure and sxemiquantitative PCR detect OsFIE2At the expression amount of paddy rice different sites, E representes the gene extron subarea among Fig. 1 a, and all the other are the gene intron district; 1-7 is respectively paddy rice different tissues and organ among Fig. 1 b, and 1 is mature seed, and 2 for sprouting back four days leaf, and 3 for sprouting back four days root, and 4 are the spike of rice before blooming, and 5 are the spike of rice after blooming, and 6 is flower pesticide, and 7 are the ovary of pollination after three days, GADPHBe internal control gene glyceraldehyde-3-phosphate dehydrogenase C gene.

Fig. 2 is a RANi recombinant expression vector building process, and wherein Fig. 2 A oppositely repeats to make up sketch on the pKANNIBAL, and the RNAi fragment is inserted the pKANNIBAL carrier through XbaI, HindIII and XhoI, EcoRI respectively; Fig. 2 B, Fig. 2 C are respectively pAHC17 and pCAMBIA1301 carrier collection of illustrative plates; Fig. 2 D is that paddy rice crosses the expression conversion and the RNAi conversion carrier makes up sketch.

Fig. 3 does OsFIE2 The dependency statistics of molecular biology identification that genetic expression is suppressed and expression amount and phenotype.A is in contrast (1) and the different RNA i strain system (RNAi-8 (2), 2-1 (3) and 1-9 (4)) OsFIE2 The differential expression situation of gene on transcriptional level, b is in contrast (1) and the different RNA i strain system (RNAi-8 (2), 2-1 (3) and 1-9 (4)) OsFIE2 The differential expression situation of gene on protein level, c and d for respectively not homophyletic be the statistical of transcriptional level differential expression and the statistical of corresponding strain owner root length.

Fig. 4 is the phenotype of transgenic paddy rice in the reproductive growth process behind the conversion RNAi carrier.A, contemporaneously contrast strain system (left side) with OsFIE2The comparison of RNAi transgenic line (right side) plant height; B-D, from contrast strain system (B) with OsFIE2The comparison (D) of RNAi transgenic line POLLEN MORPHOLOGY, C is the DAPI colored graph of B; E, F, G be respectively from contrast strain system (left side) with OsFIE2The flower of RNAi transgenic line (right side), unfertilized ovary and fertilization ovary shape ratio are.Scale length is 5 μ m among the B, and scale length is 3mm among the E.

Transgenic paddy rice built up the phenotype in the process in the leaf ON state after Fig. 5 transformed the RNAi carrier.A is the adjoining tree blade; B-D is OsFIE2RNAi transgenic line blade; E, for the contrast strain is the cross-sectional view F of blade, for OsFIE2The cross-sectional view of the blade of RNAi transgenic line.Scale length is 1cm among the A-D, and scale length is 50 μ m among the E – F.

Fig. 6 transforms the phenotype of transgenic paddy rice in the root system development process behind the RNAi carrier.A, contrast strain system with OsFIE2RNAi transgenic line seed germination situation; C, D for contrast strain system with OsFIE2The root system contrast of RNAi transgenic line; E, F for contrast strain system with OsFIE2RNAi transgenic line seed germination is main root tip of a root transparent observing situation after three days; G, for wild-type with OsFIE2The statistical of RNAi transgenic line main root length; H, for wild-type with OsFIE2The statistical of RNAi transgenic line lateral root length.Scale length is 2 cm among the A, and scale length is 1 cm among the B, and scale length is 50 μ m among the C – D, E, and scale length is 100 μ m among the F.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Under the situation that does not deviate from the present invention's spirit and essence, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

Embodiment 1: gene OsFIE2Separation and evaluation

The contriver utilizes Arabidopis thaliana not rely on the autonomous producer of endosperm of fertilization AtFIEThe conserved regions design primer, with RACE its gene order is carried out segmentation amplification again, 3 ' RACE and 5 ' RACE amplified fragments are spliced into cDNA, obtained the full length gene sequence of 1601bp at last.

Utilize 3'-RACE CDS Primer A respectively: ( 5' – AAGCAGTGGTATCAACGCAGAGTAC (T) 30V N – 3') (SEQ ID No. 4) and 5'-RACE CDS Primer ( 5' – (T) 25V N – 3') (SEQ ID No. 5) and undertaken by the BD SMART RACE cDNA Amplification test kit of U.S. Clontech company OsFIE2Gene order amplification (concrete operations are carried out according to the test kit explanation) has been isolated respectively OsFIE25 ' end hold nucleotide sequence with 3 '.Behind RACE, utilize the PCR product to reclaim test kit the RACE product is reclaimed, further utilize the pGEM of Promega company-T test kit to carry out the clone of PCR product, through transforming, plasmid enzyme restriction identifies that the back order-checking obtains at last OsFIE2Sequence content.

The cDNA sequence total length that each fragments sequence is stitched together and has obtained this gene.On NCBI megablast database, carry out nucleotide sequence relatively; Utilize mRNA and rice genome sequence ratio; The result shows that this full length gene contains 1601 bp; Its transcript mRNA is made up of 13 exons, at upstream from start codon two successive terminator codon TAG is arranged, and one the 376 amino acid whose protein of encoding.OsFIE1 albumen contains 6 WD40 domains.

Embodiment 2: OsFIE2The expression of gene in paddy rice

Fine with rice varieties Japan is material, gets its seed, root, leaf, leaf sheath and flower pesticide.TRIzol with Invitrogen extracts total RNA, uses the RevertAid of Fermentas again ^TMSynthetic cDNA first chain of first strand cDNA synthesis kit counter-rotating.To differing materials OsFIE2Carrying out PCR detects.The PCR reaction conditions is: 94 ℃ of 2min; 94 ℃ of 5sec, 58 ℃ of 10sec, 72 ℃ of 10 sec, 40 circulations.With GADPHAnd UbiquitinBe internal control gene, relative quantification result demonstration, OsFIE2Nourish and grow and the reproductive growth process in wide expression (Fig. 1 b).Each gene PCR primer is following in testing process:

Embodiment 3: OsFIE2Functional analysis

Embodiment of the present invention make up exactly OsFIE2Gene RNAi recombinant expression vector and to be transformed into rice varieties Japan fine is to reach the purpose that in the plant body, reduces this genetic expression, the final announcement OsFIE2Function in paddy rice.Concrete operations are following:

At first; Carrier pAHC17 (the Christensen and Quail that will contain ubiquitin (Ubi1) promotor; 1996, Ubiquitin promoter-based vectors for high level expression of selectable and or screenable marker genes in monocotyledonous plants. Transgenic Res 5:213 – 218) carry out partially digested with HindIII and EcoRI.Promoter region and Nos terminator are inserted pCAMBIA 1301 carriers (Cambia sees Fig. 2 B) through above two restriction enzyme sites, make pAHC17-pCAMBIA 1301 carriers.Fine with rice varieties Japan is material, gets its seed, root, leaf, leaf sheath and flower pesticide.TRIzol with Invitrogen extracts total RNA, synthesizes cDNA first chain with the RevertAidTM first strand cDNA synthesis kit counter-rotating of Fermentas again.Respectively with primer to 5 '-CTCGAG GAGTACAAGGCGTGCAAC-3 ' and 5 '-GAATTC GGCCAGAATTCCTTCATT-3 ' and primer to 5 '-TCTAGA GAGTACAAGGCGTGCAAC-3 ' and 5 '-AAGCTT GGCCAGAATTCCTTCATT-3 ', the sequence shown in the SEQ ID No.3 promptly increases.Then, the reverse respectively two ends (seeing Fig. 2 A) of inserting pKANNIBAL (Australian CSIRO plant research mechanism) intermediate carrier intron of dsRNAi fragment that amplification is good.Use and added the whole reverse repeating structure of primer amplification in BamHI site, and insert pAHC17-pCAMBIA 1301 carriers and make final RNAi recombinant vectors.The sketch that makes up is seen Fig. 2 C, cut the checking positive colony through enzyme after electricity change Agrobacterium EHA105.The genetic transforming method of employing Agrobacterium EHA105 mediation (Hiei etc., 1994, Efficient transformation of rice ( Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) will OsFIE2RNAi recombinant vectors carrier importing paddy rice japonica rice ( Japonica) kind Japan fine ( Oryza sativa cv. Nipponbare).As contrast, the 35S-eGFP fragment is inserted in pCAMBIA 1301 carriers under the effect of cutting of the enzyme of HindIII-EcoRI, and these carriers are carried out the paddy rice transgenic.

The transgenic positive plant that obtains is expressed evaluation, confirming that goal gene is suppressed the phenotype paired observation of expression back (Fig. 3) to each growth period situation of transfer-gen plant.

Observations shows that (Fig. 4) normally takes place this effect gene flowering time and floral organ, participates in the control leaf attitude of paddy rice and builds up (Fig. 5,6) with root system, also participates in the autonomous generation of inhibition paddy endosperm simultaneously. OsFIE2Formation to seed also has important regulation, in the RNAi strain system because OsFIE2Genetic expression is suppressed, and endosperm can autonomous development, and its seed development contrast wants fast, finally forms the seed bigger than normal seed.Therefore combine OsFIE2Gene and RNAi technology can obtain the rice paddy seed (Fig. 4 G) of the big grain of rice, in rice yield raising method big application prospect are arranged.In addition, in RNAi strain system, the higher situation of pollen abortion rate occurs and can be applicable to the rice sterile line seed selection.

Sequence table

< 110>Wuhan University

< 120>do not rely on the autonomous producer of endosperm and the application thereof of fertilization

<130>

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1131

<212> DNA

< 213>paddy rice (Oryza sativa)

<220>

<221> CDS

<222> (1)..(1131)

<400> 1

atg gcg aag ctg ggg ccg ggg cag ggg ctg ggg tgc gag gcg gcg gtg 48

Met Ala Lys Leu Gly Pro Gly Gln Gly Leu Gly Cys Glu Ala Ala Val

1 5 10 15

ggg ttg ctg gcg cca agc agg aag agg gag tac aag gcg tgc aac aag 96

Gly Leu Leu Ala Pro Ser Arg Lys Arg Glu Tyr Lys Ala Cys Asn Lys

20 25 30

ctc acc gag ggg aag cgg ccg ctc tac gcc atc gga ttc aac ttc ctc 144

Leu Thr Glu Gly Lys Arg Pro Leu Tyr Ala Ile Gly Phe Asn Phe Leu

35 40 45

gac ttc cac tac tac gag gtc ttc gcc acc gtc ggc ggc aac cgc gtg 192

Asp Phe His Tyr Tyr Glu Val Phe Ala Thr Val Gly Gly Asn Arg Val

50 55 60

aca acc tac agc tgc ctc aag gat ggt aat ttt gct atc ctg caa gca 240

Thr Thr Tyr Ser Cys Leu Lys Asp Gly Asn Phe Ala Ile Leu Gln Ala

65 70 75 80

tat att gat gag gat aag gat gaa tcg ttc tac aca ctg agt tgg gct 288

Tyr Ile Asp Glu Asp Lys Asp Glu Ser Phe Tyr Thr Leu Ser Trp Ala

85 90 95

tgt gat ctt gat ggc aca ccg ctg tta gtg gct gca gga agc aat ggg 336

Cys Asp Leu Asp Gly Thr Pro Leu Leu Val Ala Ala Gly Ser Asn Gly

100 105 110

atc att cgg gtc atc aac tgt gcc act gag aag tta ctc aag act ttt 384

Ile Ile Arg Val Ile Asn Cys Ala Thr Glu Lys Leu Leu Lys Thr Phe

115 120 125

gtt ggc cat ggc gat tca ata aac gag ata aga act caa gca tta aag 432

Val Gly His Gly Asp Ser Ile Asn Glu Ile Arg Thr Gln Ala Leu Lys

130 135 140

cct tcg ctc atc att tct gca agc aag gat gaa tct gtt agg ctg tgg 480

Pro Ser Leu Ile Ile Ser Ala Ser Lys Asp Glu Ser Val Arg Leu Trp

145 150 155 160

aat gtt cac aca ggg atc tgc att ttg att ttt gct gga gca gga ggt 528

Asn Val His Thr Gly Ile Cys Ile Leu Ile Phe Ala Gly Ala Gly Gly

165 170 175

cac cgg aat gaa gta ttg agt gtt gac ttc cac cca tct gat atc tac 576

His Arg Asn Glu Val Leu Ser Val Asp Phe His Pro Ser Asp Ile Tyr

180 185 190

cgc ata gca agt tgt ggc atg gat aac act gtt aaa ata tgg tca atg 624

Arg Ile Ala Ser Cys Gly Met Asp Asn Thr Val Lys Ile Trp Ser Met

195 200 205

aag gaa ttc tgg cca tat gtt gag caa tcc ttt aca tgg act gac ctt 672

Lys Glu Phe Trp Pro Tyr Val Glu Gln Ser Phe Thr Trp Thr Asp Leu

210 215 220

cca tca aaa ttt cca aca aaa tat gtg caa ttt ccg gtc ttg gtt gct 720

Pro Ser Lys Phe Pro Thr Lys Tyr Val Gln Phe Pro Val Leu Val Ala

225 230 235 240

gta gta cat tct aac tat gtt gat tgt act aga tgg ctt ggt gac ttc 768

Val Val His Ser Asn Tyr Val Asp Cys Thr Arg Trp Leu Gly Asp Phe

245 250 255

att ctg tca aag agt gtt gac aat gaa att gtg ctg tgg gag cca aaa 816

Ile Leu Ser Lys Ser Val Asp Asn Glu Ile Val Leu Trp Glu Pro Lys

260 265 270

aca aaa gaa caa agt ccc ggg gag ggt agc att gat att ctt cag aag 864

Thr Lys Glu Gln Ser Pro Gly Glu Gly Ser Ile Asp Ile Leu Gln Lys

275 280 285

tat cct gtg cca gaa tgt gat atc tgg ttt atc aaa ttc tca tgc gat 912

Tyr Pro Val Pro Glu Cys Asp Ile Trp Phe Ile Lys Phe Ser Cys Asp

290 295 300

ttt cac ttc aat caa ttg gca ata ggc aac cgt gaa gga aaa gtc ttt 960

Phe His Phe Asn Gln Leu Ala Ile Gly Asn Arg Glu Gly Lys Val Phe

305 310 315 320

gtc tgg gaa gta cag tcc agt cct cct gtt tta act gct cgg ctg act 1008

Val Trp Glu Val Gln Ser Ser Pro Pro Val Leu Thr Ala Arg Leu Thr

325 330 335

aat ccg caa tgc aaa tct gcg ata agg cag act gcc gtg tca ttt gat 1056

Asn Pro Gln Cys Lys Ser Ala Ile Arg Gln Thr Ala Val Ser Phe Asp

340 345 350

gga agc aca atc ctt gcc tgc agc gag gat ggc agc ata tgg cga tgg 1104

Gly Ser Thr Ile Leu Ala Cys Ser Glu Asp Gly Ser Ile Trp Arg Trp

355 360 365

gat gaa gtg gac cat cca aaa gca tga 1131

Asp Glu Val Asp His Pro Lys Ala

370 375

<210> 2

<211> 376

<212> PRT

< 213>paddy rice (Oryza sativa)

<400> 2

Met Ala Lys Leu Gly Pro Gly Gln Gly Leu Gly Cys Glu Ala Ala Val

1 5 10 15

Gly Leu Leu Ala Pro Ser Arg Lys Arg Glu Tyr Lys Ala Cys Asn Lys

20 25 30

Leu Thr Glu Gly Lys Arg Pro Leu Tyr Ala Ile Gly Phe Asn Phe Leu

35 40 45

Asp Phe His Tyr Tyr Glu Val Phe Ala Thr Val Gly Gly Asn Arg Val

50 55 60

Thr Thr Tyr Ser Cys Leu Lys Asp Gly Asn Phe Ala Ile Leu Gln Ala

65 70 75 80

Tyr Ile Asp Glu Asp Lys Asp Glu Ser Phe Tyr Thr Leu Ser Trp Ala

85 90 95

Cys Asp Leu Asp Gly Thr Pro Leu Leu Val Ala Ala Gly Ser Asn Gly

100 105 110

Ile Ile Arg Val Ile Asn Cys Ala Thr Glu Lys Leu Leu Lys Thr Phe

115 120 125

Val Gly His Gly Asp Ser Ile Asn Glu Ile Arg Thr Gln Ala Leu Lys

130 135 140

Pro Ser Leu Ile Ile Ser Ala Ser Lys Asp Glu Ser Val Arg Leu Trp

145 150 155 160

Asn Val His Thr Gly Ile Cys Ile Leu Ile Phe Ala Gly Ala Gly Gly

165 170 175

His Arg Asn Glu Val Leu Ser Val Asp Phe His Pro Ser Asp Ile Tyr

180 185 190

Arg Ile Ala Ser Cys Gly Met Asp Asn Thr Val Lys Ile Trp Ser Met

195 200 205

Lys Glu Phe Trp Pro Tyr Val Glu Gln Ser Phe Thr Trp Thr Asp Leu

210 215 220

Pro Ser Lys Phe Pro Thr Lys Tyr Val Gln Phe Pro Val Leu Val Ala

225 230 235 240

Val Val His Ser Asn Tyr Val Asp Cys Thr Arg Trp Leu Gly Asp Phe

245 250 255

Ile Leu Ser Lys Ser Val Asp Asn Glu Ile Val Leu Trp Glu Pro Lys

260 265 270

Thr Lys Glu Gln Ser Pro Gly Glu Gly Ser Ile Asp Ile Leu Gln Lys

275 280 285

Tyr Pro Val Pro Glu Cys Asp Ile Trp Phe Ile Lys Phe Ser Cys Asp

290 295 300

Phe His Phe Asn Gln Leu Ala Ile Gly Asn Arg Glu Gly Lys Val Phe

305 310 315 320

Val Trp Glu Val Gln Ser Ser Pro Pro Val Leu Thr Ala Arg Leu Thr

325 330 335

Asn Pro Gln Cys Lys Ser Ala Ile Arg Gln Thr Ala Val Ser Phe Asp

340 345 350

Gly Ser Thr Ile Leu Ala Cys Ser Glu Asp Gly Ser Ile Trp Arg Trp

355 360 365

Asp Glu Val Asp His Pro Lys Ala

370 375

<210> 3

<211> 563

<212> DNA

< 213>paddy rice (Oryza sativa)

<400> 3

gagtacaagg cgtgcaacaa gctcaccgag gggaagcggc cgctctacgc catcggattc 60

aacttcctcg acttccacta ctacgaggtc ttcgccaccg tcggcggcaa ccgcgtgaca 120

acctacagct gcctcaagga tggtaatttt gctatcctgc aagcatatat tgatgaggat 180

aaggatgaat cgttctacac actgagttgg gcttgtgatc ttgatggcac accgctgtta 240

gtggctgcag gaagcaatgg gatcattcgg gtcatcaact gtgccactga gaagttactc 300

aagacttttg ttggccatgg cgattcaata aacgagataa gaactcaagc attaaagcct 360

tcgctcatca tttctgcaag caaggatgaa tctgttaggc tgtggaatgt tcacacaggg 420

atctgcattt tgatttttgc tggagcagga ggtcaccgga atgaagtatt gagtgttgac 480

ttccacccat ctgatatcta ccgcatagca agttgtggca tggataacac tgttaaaata 540

tggtcaatga aggaattctg gcc 563

<210> 4

<211> 57

<212> DNA

< 213>artificial sequence

<220>

<221> misc_feature

<222> (56)..(56)

<223> v is A, G, or C

<222> (57)..(57)

<223> n is a, c, g, or t

<400> 4

aagcagtggt atcaacgcag agtacttttt tttttttttt tttttttttt tttttvn 57

<210> 5

<211> 27

<212> DNA

< 213>artificial sequence

<220>

<221> misc_feature

<222> (27)..(27)

<223> v is A, G, or C

<222> (27)..(27)

<223> n is a, c, g, or t

<400> 5

tttttttttt tttttttttt tttttvn 27

Claims (9)

1. autonomous producer of endosperm that paddy rice does not rely on fertilization OsFIE2, its following protein of encoding:

1) protein of the composition of the aminoacid sequence shown in the SEQ ID No.2.

2. gene according to claim 1 is characterized in that, its nucleotides sequence is classified as:

1) sequence shown in the SEQ ID No.1;

2) the cDNA sequence that produces by sequence shown in the SEQ ID No.1.

3. the albumen of claim 1 or 2 said genes encodings.

4. the plant RNA i recombinant expression vector of target claim 1 or 2 said genes.

5. claim 1 or 2 described genes OsFIE2Application in the preparation transgenic plant.

6. application as claimed in claim 7 is characterized in that, said plant is a paddy rice.

7. claim 1 or 2 described genes OsFIE2Application in the crop yield improvement.

8. application as claimed in claim 9 is characterized in that, said crop is a paddy rice.

9. claim 1 or 2 application of said gene in the rice sterile line seed selection.

Images