CN102329870B

CN102329870B - Application method of low-methylation gene LMO3 (LIM domain only 3)

Info

Publication number: CN102329870B
Application number: CN 201110293237
Authority: CN
Inventors: 武明花; 刘晓萍; 李桂源; 唐海林; 王泽友; 余志斌; 卞艳慧
Original assignee: Central South University
Current assignee: Central South University
Priority date: 2011-09-29
Filing date: 2011-09-29
Publication date: 2013-02-13
Anticipated expiration: 2031-09-29
Also published as: CN102329870A

Abstract

The invention relates to an application of low-methylation gene LMO3 (LIM domain only 3), which is used for preparing a preparation for diagnosis, predication, detection or screening of cerebral gliomas, and is especially used for preparing a preparation for predicting cerebral gliomas prognosis by a direct sequencing method of hydrosulfite. Studies prove that high expression is generated on the LMO3 in cerebral gliomas tissues due to low methylation of promoters, the detection for low methylation of the LMO3 genes is applied in prediction of the cerebral gliomas prognosis, and powerful basis of molecular biology is provided for predicting the prognosis of patients with cerebral gliomas. The application method has profound clinic significance and popularization.

Description

The application method of hypomethylation gene LMO3

Technical field

The present invention relates to the application of hypomethylation gene LMO3 in preparation Puncture in Brain Glioma Patients prognosis prediction reagent.

Background technology

Cerebral glioma is the modal malignant tumour of human central nervous system, and the treatment means that adopts at present comprises operative treatment combined chemotherapy and radiotherapy, but the gliomatosis the survival of human beings phase is still without significant prolongation.It is reported that 5 years survival rates of glioma patient are lower than 25%, and the total survival time average out to of the blastomatous patient of glioma 12.3 months.At present, the prognosis of cerebral glioma is judged there is not reference standard, also do not have specific index, can not adapt to far away human glioma is carried out the demand that prognosis is judged.Therefore, human glioma is carried out prognosis judge, in order to select therapeutic regimen, significantly improve survival, become the important topic that scientific research needs to be resolved hurrily.

Epigenetics can be by heredity but not dna sequence dna changes the genetic expression that causes changes.Epigenetic mechanism, comprise high/lowly methylate, histone modification or non-coding RNA express.Large quantity research finds that epigenetic mechanism plays an important role, and comprises glioma in the forming process of tumour.The change of dna methylation state comprises hyper-methylation and hypomethylation, and the DNA hypomethylation can cause genetic expression to increase, thereby promotes generation and the development of tumour, plays very important effect in tumour.Hypomethylation all may occur in tumor-necrosis factor glycoproteins and single copy site.In recent years, the tumour epigenetics take dna methylation as representative and in the using value of the aspects such as clinical diagnosis, chemosensitivity and prognostic evaluation has arrived investigator's attention gradually.There are some researches show that the IGF2 hypomethylation can be used as the alternative biomolecules of diagnosing colon cancer.Hypomethylation occurs in Cancer-testis antigen gene M AGEA1 in glioma, suppress the function of P53 and produce resistance.Hypomethylated MAL gene can be used as the prediction ovarian cancer to the mark of cisplatin sensitivity.The extensive hypomethylation of No. 1 karyomit(e) tumor-necrosis factor glycoproteins Sat2 can be used as the molecular marker of ovarian cancer prognosis prediction.This shows that the gene hypomethylation has great potential aspect the tumour molecular marker seeking.

The tumour-specific methylation state that utilizes bisulfite sequencing PCR method (BSP) analysis to obtain is the gold standard of methylation analysis, and it can clearly survey the methylation state in each CG site, zone.

LMO3 gene (LIM domain only 3) is positioned karyomit(e) 12p12.3, GeneBank accession number: NM_001001395.Confirm that LMO3 brings into play the function of oncogene in neuroblastoma, it can interact with neuronal transcription factor HEN2, also can suppress the transcriptional activity of P53, and neuroblastoma patient's prognosis of high expression level LMO3 is relatively poor.The applicant detects the expression of LMO3 albumen in normal cerebral tissue and glioma cells in tissue with immunohistochemical method, the result shows that LMO3 expresses increase (p＜0.05 in glioma, Fig. 1), the expression of LMO3 increases than low level (I level, II level) in the High Grade Gliomas tissue (III level, IV level), and difference has statistical significance (p=0.023).Bisulfite sequencing PCR (BSP) confirms, hypomethylation occurs in LMO3 in glioma, and the frequency that methylates in High Grade Gliomas (III level, IV level) reduces than low level (I level, II level) patient, and difference has statistical significance (p=0.047).Then with SPSS 13.0 softwares LMO3 protein expression and LMO3 gene hypomethylation are carried out correlation analysis, the result shows and has dependency (p＜0.05) between the two, illustrates that epigenetics may participate in the expression regulation of LMO3 gene.

Summary of the invention

The purpose of this invention is to provide the application method of a kind of hypomethylation gene LMO3, significant for the prognosis prediction of cerebral glioma.

Hypomethylation gene LMO3 is for the preparation of Diagnosing Gliomas, prediction, detection or examination preparation; Test kit especially for preparation Diagnosing Gliomas, prediction, detection or examination.

As: for the preparation of the preparation of hydrosulphite direct sequencing prediction cerebral glioma; Comprise in the described preparation: according to LMO3 gene promoter area CpG island design, adopt the primer sequence of hydrosulphite direct sequencing to be:

F：5′TAGTATATGTATGTGGTTGTGTTGA 3′，

R：5′ATATCCTCCTTTTAAACAACTACAA 3′。

A kind of LMO3 gene promoter zone methylation detection kit for the human glioma prognosis prediction comprises following primer:

F：5′TAGTATATGTATGTGGTTGTGTTGA 3′，

R：5′ATATCCTCCTTTTAAACAACTACAA 3′。

The applicant finds LMO3 gene up-regulated (Fig. 1) in glioma cells in tissue.LMO3 transcription initiation site upstream-401bp to-219bp is a typical CpG island (Fig. 2), the CG site all is being in the hyper-methylation state in this CpG island in normal cerebral tissue, and in the glioma cells in tissue of LMO3 up-regulated its decrease of methylation (partial results is seen Fig. 3).The hypomethylated glioma patient's overall survival of LMO3 is starkly lower than the patient (Fig. 4) of hyper-methylation, and prompting LMO3 gene is the hypomethylation gene in the glioma, is the molecular marker of prediction glioma prognosis.The present invention has far-reaching clinical meaning and generalization for the cerebral glioma prognosis prediction provides strong molecular biology mechanism.

Description of drawings

The expression of Fig. 1 LMO3 albumen in normal cerebral tissue and different pathological classification glioma;

A: normal cerebral tissue; B: glioma WHO I level; C: glioma WHO II level; D: glioma WHO III level; E: glioma WHO IV level;

Active region-the 401bp of Fig. 2 LMO3 gene promoter to-219bp is a typical CpG island;

Light blue zone is the CpG island

Fig. 3 BSP detects LMO3 gene promoter zone methylation state in normal cerebral tissue and the samples of human glioma;

Be partial results shown in the figure, N3: the 3rd routine normal cerebral tissue; N8: the 8th routine normal cerebral tissue; T5: the 5th routine samples of human glioma; T8: the 8th routine samples of human glioma.The non-site that methylates of zero expression, ● represent to methylate the site, the methylation state in all CG sites among clone of each line display, the ratio that methylates that calculates among 5 clones compares.The result shows that LMO3 gene promoter area CpG island is the hyper-methylation state in the normal cerebral tissue, and hypomethylation occurs on this CpG island in the samples of human glioma;

The relation of Fig. 4 LMO3 promotor hypomethylation and glioma patient prognosis.

Green curve represents gliomatosis the survival of human beings situation and the time of LMO3 gene promoter methylation, and blue curve represents that hypomethylated gliomatosis the survival of human beings situation and time occur the LMO3 gene promoter.Carry out the Kaplan-Meier check with SPSS 13.0 softwares, difference has statistical significance (p=0.047), illustrates that the hypomethylated patient's prognosis of LMO3 is poor than the patient of hyper-methylation.

Embodiment

Be intended to further specify the present invention below in conjunction with embodiment, and unrestricted the present invention.

Embodiment 1:

Adopt Promoterscan, the bioinformatics softwares such as Genomatix Promoter Inspector and CpGplot carry out bioinformatic analysis to LMO3 gene 5 ' terminal sequence, the result show the promoter region of LMO3 gene may be arranged in-581bp to 0bp locates (take initiator codon ATG A as+1).Methl primer express software and online software Methprimer analyze LMO3 promoter prediction zone-401bp to-219bp, the result is shown as a CpG island, design and synthesize the primer that methylates of LMO3 promoter region, 5 ' TAGTATATGTATGTGGTTGTGTTGA3 ' (F), 5 ' ATATCCTCCTTTTAAACAACTACAA3 ' is (R).10 routine normal cerebral tissues are carried out gene order-checking (BSP) behind sulfiting, find that the CpG site all is in methylation state at normal cerebral tissue in the LMO3 Gene Promoter CpG Island.Simultaneously to different stage glioma cells in tissue sample (I level 6 examples, II level 20 examples, III level 12 examples, IV level 12 examples) 50 examples, carried out the detection of LMO3 promoter zone methylation state, the promoter region generation hypomethylation of LMO3 in the glioma cells in tissue of discovery 88% compares with normal cerebral tissue, difference has statistical significance (p＜0.05), and the LMO3 promoter zone methylation level of gliomas at different levels does not have obvious difference (p＞0.05).The hypomethylated patient's prognosis of LMO3 promoter region the poor of patient that methylate, difference has statistical significance (p=0.047).The prompting of above result of study, LMO3 gene are the newfound cerebral glioma genes that methylates, and are glioma prognosis prediction signs.

Operation steps:

(1) bisulphite modified sample gDNA preparation

Select commercial bisulphite modified test kit.

(2) use of hydrosulphite direct Sequencing PCR (BSP) test kit

Content: this test kit comprises:

PCR primer for detection of the LMO3 gene promoter zone methylation:

5′TAGTATATGTATGTGGTTGTGTTGA 3′(F)；

5′ATATCCTCCTTTTAAACAACTACAA 3′(R)；

Pcr amplification system (20 ℃ of preservations).

Principle: utilize the primer that methylates to carry out pcr amplification LMO3 promoter region CpG island.

Step:

The 1 sample gDNA4 μ l (the about 100ng of total amount) that learns from else's experience after bisulphite modified adds the pcr amplification system (50 μ l) that contains the primer 2 μ l that methylates, and uses the EmeraldAmp of Takara company ^TMPCR Master Mix (containing archaeal dna polymerase, damping fluid and dNTP mixture) increases.

The pcr amplification system is:

Behind 2 application of samples, put the PCR instrument and carry out pcr amplification, reaction conditions is as follows:

95℃ 5min

72℃ 10min

4 ℃ of preservations

(3) agarose electrophoresis, glue reclaims the PCR product

The PCR product is carried out 1% agarose gel electrophoresis 45min, and through Ethidium Bromide dyeing, UV-light incision glue, product are 472bp, and glue reclaims test kit and reclaims the PCR product

(4) connect glue and reclaim product to the pGEM-T carrier

Use the pGEM-T easy carrier system (article No.: A1360) of Pu Luomaige (Beijing) Bioisystech Co., Ltd

Except step (threes') product, other reagent all are included in the pGEM-T easy carrier system

(5) transformed competence colibacillus

The 1 mixture 3-5 μ l with step 3 adds e. coli jm109 50 μ l, puts 15-30min on ice;

242 ℃ of 1min (can not surpass 90s);

3 put 3-5min on ice;

4 add 1ml without the LB liquid training base of ammonia benzyl in mixture, 180rpm, and 37 ℃ are shaken bacterium 1h (but proper extension);

53500rpm，3min；

6 are applied to an amount of X-gal and IPTG on the LB solid training base, for subsequent use after liquid dried;

7 abandon 700 μ l supernatants, with the remaining resuspended bacterium of liquid, are applied on the LB solid training base that is added with the ammonia benzyl, cultivate 12-16h for 37 ℃.

(6) choose the mono-clonal order-checking

1 will grow germy LB solid training base places 4 ℃ of colour developing 4-6h;

The positive bacteria mono-clonal (white) that 5 steps of 2 pickings (five) are cultivated is added to the LB that is added with the ammonia benzyl of 3ml

In the liquid training base;

3230rpm, 37 ℃ are shaken bacterium 12-16h;

4 receive bacterium send order-checking;

5 analyze sequencing results, calculate the sample frequency that methylates, and compare with the frequency that methylates in the normal cerebral tissue, really

The methylation state on LMO3 gene promoter area CpG island in the random sample basis;

The hydrosulphite direct Sequencing PCR sequencing result of 10 routine normal cerebral tissues and 50 routine samples of human glioma is analyzed, calculate every routine patient LMO3 promoter region CpG island frequency (seeing Table 1) that methylates, the frequency that methylates in the normal cerebral tissue is (77.3 ± 6.6) %, the frequency that methylates in the samples of human glioma is (10.7 ± 13.6) %, through the independent sample T check analysis of SPSS 13.0 softwares, difference has statistical significance, p＜0.05.

(7) prognosis is judged

Compare with healthy tissues, think that the frequency that methylates is lower than and equals 24.3% for the LMO3 hypomethylation, the LMO3 gene promoter generation hypomethylation that 43 people are arranged in 50 routine glioma patients, this group patient's lifetime is than LMO3 gene promoter methylation patient's weak point (p=0.047).Therefore, the contriver to think that the LMO3 gene promoter area CpG hypomethylated glioma patient in island can be judged to be prognosis relatively poor.

Methylation state and the clinical parameter of table 1LMO3 gene promoter area CpG island in normal cerebral tissue and samples of human glioma

N represents normal cerebral tissue, and T represents samples of human glioma, p＜0.05

Claims

1. a LMO3 gene promoter zone methylation detection kit that is used for the human glioma prognosis prediction is characterized in that, comprises following primer:

F：5′TAGTATATGTATGTGGTTGTGTTGA 3′，

R：5′ATATCCTCCTTTTAAACAACTACAA 3′。