CN102329386A - Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof - Google Patents
Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof Download PDFInfo
- Publication number
- CN102329386A CN102329386A CN201110247554A CN201110247554A CN102329386A CN 102329386 A CN102329386 A CN 102329386A CN 201110247554 A CN201110247554 A CN 201110247554A CN 201110247554 A CN201110247554 A CN 201110247554A CN 102329386 A CN102329386 A CN 102329386A
- Authority
- CN
- China
- Prior art keywords
- schistosoma japonicum
- gene
- ago
- seq
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the technical field of genetic engineering and particularly relates to an achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof. The invention discloses the achistosoma japonica Ago protein for the first time, and the achistosoma japonica Ago protein is characterized by being the protein in the following (a) or (b): (a) a protein with an amino acid sequences shown as SEQ ID No.1-3; and (b) a protein which have an antiapoptosis activity and is obtained by modifying the amino acid sequences in (a) or by substituting, deleting or adding one or several amino acids in the amino acid sequences in (a).
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to Schistosoma japonicum Ago albumen, gene and little RNA thereof and uses thereof.
Background information
Schistosomicide is caused by schistosomicide; Comprise Schistosoma japonicum (Schistosoma japonicum); Schistosoma mansoni (Schistosoma mansoni) and Schistosoma haematobium (Schistosoma haematobium); Have 76 countries and regions to be endangered in the world, the sufferer about 1.5 hundred million.At China's popular is Schistosoma japonicum.The popular of schistosomicide caused tremendous loss for people's health and Economic development.Therefore, prevention and cure of schistosomiasis, development treatment schistosomicide and antischistosomal medicine have huge social and economic benefit.
Develop new treatment schistosomicide and antischistosomal medicine, at first must find suitable drug effect target position.In year surplus in the of nearly ten, research shows lower Item RNA, comprises siRNA (small interfering RNA), miRNA (microRNA) and piRNA (piwi interacting RNA), in the biology growing growth course, plays important regulation.Deepen continuously along with what lower Item RNA was studied, more and more interactional with it albumen also begin to cause people's attention.Argonaute (Ago) albumen is wherein important a member, it through with lower Item RNA selective binding, in the biology growing growth course, bringing into play important effect.Ago albumen is the basic protein family of about 100kD, and its member contains PAZ (PIWI-Argonaute-Zwillle) and two structural domains of PIWI usually, therefore, usually Ago albumen is divided into PAZ and two subfamilies of PIWI.Most of biologies all have multiple Ago family protein, and different Ago has different functions usually.At present, do not see the proteic research report of relevant Schistosoma japonicum Ago, fall but utilize external synthetic siRNA molecule successfully schistosomicide polypide vivo gene to be struck; And express a series of non-coding small RNA moleculars at the schistosomicide different development stage; { can quote following reference: In vitro and in vivo evaluation of small interference RNA-mediated gynaecophoral canal protein silencing in Schistosoma japonicum.Cheng G, Fu Z, Lin J; Shi Y; Zhou Y, Jin Y, Cai Y.J Gene Med.2009May; 11 (5): 412-21}. prompting Ago albumen possibly brought into play important effect in bilharzial growing.
Summary of the invention
Technical problem to be solved by this invention provides a Schistosoma japonicum-like Ago gene, albumen and little RNA and uses thereof.
For this reason, on the one hand, the invention discloses a Schistosoma japonicum-like Ago albumen, be (a) or protein (b) as follows:
(a) one of in the protein of its aminoacid sequence shown in SEQ ID NO.1～3;
(b) aminoacid sequence in (a) is through replacing, lack or adding one or several amino acid or modification and have an anti-apoptotic active by one of in (a) deutero-protein.
On the other hand, the invention also discloses the proteic gene of a kind of coding Schistosoma japonicum Ago according to the invention.
In an embodiment, said gene is shown in SEQ ID NO.4～6 one of in the nucleotide sequence.
On the other hand, the invention also discloses a kind of recombinant expression vector that comprises said gene.
In some embodiments, said recombinant expression vector can be prokaryotic expression carrier or carrier for expression of eukaryon, wherein preferred carrier for expression of eukaryon.
On the other hand, the invention also discloses a kind of transformant that comprises recombinant expression vector according to the invention.
On the other hand, the invention discloses a kind of Schistosoma japonicum small RNA molecular, have following characteristic respectively:
(a) one of have shown in the SEQ ID NO.7-15 in the nucleotide sequence; Or
(b) the small RNA molecular that forms by one or several replacement nucleic acid of small RNA molecular generation, disappearance or the insertion of (a) with (a) identical kind of subsequence.
Said kind of subsequence is generally 2-6 Nucleotide very conservative between species, generally is positioned at the 2-8 position of little RNA.
Preferably, the nucleotide sequence of said small RNA molecular is shown in SEQ ID NO.7～15 one of in the nucleotide sequence.
On the other hand, the invention discloses a kind of gene of the above-mentioned small RNA molecular of encoding, for one of in the nucleotide sequence shown in the SEQ IDNO.16-25; Or with the nucleotide sequence shown in the SEQ ID NO.16-25 in one of in the complementary sequence of every sequence; Or with the nucleotide sequence shown in the SEQ ID NO.16-25 in every sequence at least 70% homology is arranged and the identical small RNA molecular sequence of encoding in one of;
Preferably, said gene is to have the nucleotide sequence shown in the SEQ ID NO.16-25.
On the other hand, the present invention also provides a kind of specific recognition Schistosoma japonicum Ago proteic antibody, it is characterized in that the immunogen of said antibody is the above-mentioned albumen of the present invention.
On the other hand, the present invention also provides the purposes of Schistosoma japonicum Ago albumen in preparation control and/or treatment Schistosoma japonicum medicine.
In addition, the present invention also provides the Schistosoma japonicum small RNA molecular in preparation schistosomiasis diagnosis reagent or the purposes in preparation control and/or the treatment Schistosoma japonicum medicine.
The present invention discloses Schistosoma japonicum Ago albumen and Schistosoma japonicum small RNA molecular first.Schistosoma japonicum Ago albumen provided by the present invention and Schistosoma japonicum small RNA molecular can be used as the action target spot of antischistosomal drug, thereby in the process of the medicine of developing prevention or treatment schistosomicide, play a significant role.In addition, the schistosomicide small RNA molecular in this discovery can be used as the marker molecule of schistosomiasis diagnosis.
Description of drawings
The proteic expression of Fig. 1 Schistosoma japonicum Ago;
Fig. 2 specific antibody identification Schistosoma japonicum Ago albumen;
The detection of Fig. 3 Schistosoma japonicum small RNA molecular in schistosomicide.
Embodiment
Hereinafter will further go through many aspects of the present invention.
In the present invention, term " Schistosoma japonicum Ago albumen " refers to have the protein of aminoacid sequence shown in the SEQ ID 1-3 of Schistosoma japonicum tool Ago family protein characteristic.This term also comprises the variant form that has with the SEQ ID 1-3 sequence of Schistosoma japonicum Ago albumen identical function.These variant forms comprise (but being not limited to): several (are generally 1-50; Preferably 1-30; 1-20 more preferably, 1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20; Preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several similar or close amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.
In the present invention, refer to encode has the nucleotide sequence of Schistosoma japonicum Ago protein family to term " the proteic gene of coding Schistosoma japonicum Ago ", nucleotide sequence and degenerate sequence thereof shown in SEQ ID 4-6.This degenerate sequence is meant, is arranged in SEQ ID 4-6 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, so be low to moderate about 70% the degenerate sequence aminoacid sequence shown in the SEQ ID 1-3 of also encoding out with homology of nucleotide sequence shown in the SEQ ID 4-6.
In the present invention, term " one group of small RNA molecular of Schistosoma japonicum " refers to have the small molecules of nucleotide sequence shown in the Schistosoma japonicum tool SEQ ID 7-15.This term also comprises the variant form that has with the SEQ ID 7-15 sequence of Schistosoma japonicum small RNA molecular identical function.These variant forms comprise disappearance, insertion and/or the replacement of nucleic acid, and at 3 terminal and/or 5 terminal interpolations one or several (being generally in 20, preferably is in 10, more preferably is in 5) nucleic acid.For example, in the art, when replacing, can not change the function of molecule usually with the close or similar nucleic acid of performance.Again such as, terminal and/or 5 terminally add the functions that or several similar or close nucleic acid can not change molecule usually yet 3.
In the present invention, term " the little rna gene of coding Schistosoma japonicum " refers to that coding has the nucleotide sequence of the little RNA sequence of Schistosoma japonicum (SEQ ID 7-15) gene, nucleotide sequence and degenerate sequence thereof shown in SEQ ID 16-25.This degenerate sequence is meant, is arranged in SEQ ID 16-25 sequence, has one or more sequences that are positioned at little RNA non-coding region to change, the little RNA sequence shown in the SEQ ID 7-15 of also encoding out.
The carrier, the transformant that the present invention includes coding proteic DNA according to the invention and contain these DNA.
Among the present invention, transformant (transformant) promptly has the recipient cell of allogeneic dna sequence DNA molecule.
The present invention also comprises through synthetic and produces proteic method according to the invention with recombinant technology.Can separate and purifying polynucleotide (DNA or RNA), carrier, host cell and organism through methods known in the art.
Being used for carrier of the present invention can be like phage, plasmid, clay, minichromosome, virus or retroviral vector.The carrier that can be used for cloning and/or express polynucleotide of the present invention is to duplicate and/or to express the carrier that duplicates and/or express polynucleotide in the host cell of polynucleotide at need.Generally speaking; Polynucleotide and/or carrier can be used for any eucaryon or prokaryotic cell prokaryocyte, comprise mammalian cell (like people (like HeLa), monkey (like Cos), rabbit (like the rabbit reticulocyte), rat, hamster (like CHO, NSO and baby hamster kidney cell) or mouse cell (like the L cell)), vegetable cell, yeast cell, insect cell or bacterial cell (like intestinal bacteria).Relevantly be applicable to that the example of the suitable carrier of broad variety host cell can be referring to for example F.Ausubel et al., Current Protocols in Molecular Biology.Greene Publishing Associates and Wiley-Interscience (1992) and Sambrook et al. (1989).Can use the host cell that contains these polynucleotide to come great expression to can be used for the for example protein of medicine, diagnostic reagent, vaccine and therapeutical agent.
Having developed several different methods is used for via the complementary sticky end DNA being operated with carrier and links to each other.For example, can add complementary with the aggressiveness sequence fragment by the DNA section in desire is inserted carrier DNA.Then through the hydrogen bond connection carrier between the complementary homopolymeric tail and DNA section to form recombinant DNA molecules.
The synthetic linker that contains one or more restriction site provides the method for another kind of connection DNA section and carrier.Handle the DNA section that produces through the endonuclease restrictive diges-tion with phage T4DNA polysaccharase or e. coli dna polymerase I; Described two kinds of polysaccharases with its 3 '; It is terminal that 5 '-exonucleolytic activity is removed outstanding γ-strand, and mend flat 3 '-recessed end with its polymerization activity.Therefore, these active associatings have produced flush end DNA section.The enzyme that connects at ability catalysis flush end dna molecular then is as under the existence of phage T4DNA ligase enzyme being incubated the linkers of flush end section with big molar excess.Therefore, reaction product is the DNA section that end carries the polylinker sequence.Use these DNA sections of suitable Restriction Enzyme cracking then, and be connected in the expression vector of using enzymatic lysis, said enzyme can produce and the compatible end of said DNA section.Can buy the synthetic linker that contains a plurality of restriction endonucleases site from a plurality of businessmans.
The polynucleotide inset is operably connected to on the compatible suitable promotor of the host cell of expressing polynucleotide.Promotor can be strong promoter and/or inducible promoter.The example of some promotors of enumerating comprises phage PL promotor of a specified duration, intestinal bacteria lac, trP, phoA, tac promotor, SV40 is early stage and late promoter and retrovirus LTR promotor.Other suitable promotor is well known by persons skilled in the art.The express recombinant carrier further contains transcription initiation, termination site, and contains the ribosome bind site that is useful on translation at transcriptional domain.The encoding part of the transcript that recombinant vectors is expressed can comprise the translation initiation codon that is positioned at the starting point place and suitably be positioned at by the terminator codon (UAA, UGA or UAG) of the end of translation polypeptide.
As stated, expression vector can comprise at least one selective marker.Said mark comprises Tetrahydrofolate dehydrogenase, G418, glutamine synthase or the neomycin resistance as far as eukaryotic cell culture; And the tsiklomitsin, kantlex or the acillin resistant gene that are used for intestinal bacteria and other microbial culture.Suitably host's representative example includes but not limited to: bacterial cell, like intestinal bacteria, streptomycete and salmonella typhimurium cell; The fungal cell is like yeast cell (like yeast saccharomyces cerevisiae or pichia pastoris phaff); Insect cell is like fruit bat S2 and noctuid SF9 cell; Zooblast, like CHO, COS, NSO, 293 with the Bowes melanoma cells; And vegetable cell.The appropriate culture medium of above-mentioned host cell and culture condition are known in the art.
The present invention also comprises the host cell that contains nucleotide sequence of the present invention, and said nucleotide sequence can be operated with one or more allos control region (like promotor and/or enhanser) through technology known in the art and link to each other.Can select to regulate the expression of the gene order of inserting, or can be according to the required particular form modification and the host strain of processed gene product.In the presence of some inductor, the expression that some promotor starts can raise; Therefore, can control polypeptide expression through genetic modification.In addition, different host cells have distinctive and special translation, translation post-treatment and the proteinic mechanism of modification (like phosphorylation, cracking).Can select suitable clone to guarantee that the exogenous protein of expressing is carried out desirable modification and processing.
Through the transfection of calcium phosphate transfection, the mediation of DEAE-VISOSE, transfection, electroporation, transduction, infection or other method of cation lipid mediation, can nucleic acid of the present invention and nucleic acid recombinant vectors be imported host cell.Said method is described in the laboratory manual of a plurality of standards, like Davis et al., and BasicMethods In Molecular Biology (1986).
The proteic polynucleotide of the present invention of encoding can be connected in the host, to breed with the carrier that contains selective marker.Generally speaking, can be at throw out, import plasmid vector in the mixture like calcium phosphate precipitation thing or itself and charged lipids.If carrier is a virus, can use suitable packing cell to tie up to and external it packed, transduce to host cell again.
Can identify by successful cell transformed through well-known technology, promptly contain the cell of DNA recombinant vectors of the present invention.For example, the cell that can cultivate importing express recombinant carrier gained is to produce required polypeptide.Collect and lysing cell, use like Southem (1975) J.Mol.Biol.95,503 or Berent et al (1985) Biotech.3,208 described methods detect the existence of DNA in its DNA content.Perhaps, use proteinic existence in the antibody test supernatant.
Through well-known method from the reconstitution cell culture, reclaim and the purifying people of the present invention chemer in albumen of recombinating comparatively favourable, said method comprise sulfuric acid by or ethanol sedimentation, acid extraction, negatively charged ion or cation-exchange chromatography, phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, dewatering electric charge effect chromatography and lectin chromatography.In some embodiments, can use high performance liquid chromatography (HPLC) to carry out purifying.
In some embodiments, can use above-mentioned one or more chromatography method purifying said albumen of the present invention.In other embodiments; Can use following one or more chromatography column purifying people's recombinant chemerin protein of the present invention, said chromatography column has: Q sepharose FF post, SP sepharose FF post, Q sepharose High Performance post, Blue sepharose FF post, Blue post, Phenyl Sepharose FF post, DEAE Sepharose FF or Methyl post.
In addition, can use the method purifying albumen of describing among the international publication number WO00/44772 (listing this paper in as a reference in full) according to the invention.Those skilled in the art can easily change wherein said method to be used for purifying albumen according to the invention.Can be from comprising that for example the protokaryon or the eucaryon host of bacterium, yeast, higher plant, insect and mammalian cell reclaim albumen according to the invention through the product that recombinant technology produces.
In the present invention, can use a series of methods known in the art to prepare proteic antibody to Schistosoma japonicum Ago.For example, the Schistosoma japonicum Ago protein product or its antigen fragment of purifying are injected in the animal body, produce polyclonal antibody.Equally, the cell of expression Schistosoma japonicum Ago albumen or its antigen fragment also can be used for animal immune is produced antibody.The antibody of the present invention's preparation also can be monoclonal antibody, and these monoclonal antibodies can prepare with hybridoma technology.
In the present invention, use Schistosoma japonicum Ago albumen and/or one group of small RNA molecular, can be used as the target site of schistosomiasis zhiliao medicine, thereby in the process of the medicine of developing prevention or treatment schistosomicide, play a significant role.In addition, the schistosomicide small RNA molecular in this discovery can be used as the marker molecule of schistosomiasis diagnosis.
Need not to further describe, can believe that those skilled in the art can use the embodiment of description and the hereinafter property of preceding text to prepare and utilize among the present invention detected change and put into practice desired method.Therefore, following work embodiment has specifically described certain embodiments of the present invention, can not regard it as to all the other contents restriction.
The clone of embodiment 1 Schistosoma japonicum Ago protein gene
(1) the total RNA extracting of Schistosoma japonicum.Schistosoma japonicum cercariae infected new zealand rabbit after 14 days, collected the virgin worm of Schistosoma japonicum, preserved for use in the liquid nitrogen.Utilize the Trizol method to extract the total RNA of schistosomicide, and utilize the DNA enzyme to handle the total RNA of gained, remove genome and pollute.
(2) proteic 3`RACE of Schistosoma japonicum Ago1 and 5`RACE amplification and full-length clone
Obtain the corresponding EST fragment (GenBank accession number AY809756.1) of 1 Schistosoma japonicum with (http://www.ncbi.nlm.nih.gov/BLAST) in the Ago Argine Monohydrochloride sequence inquiry Schistosoma japonicum EST storehouse of people and mouse; Long 701bp does not contain complete ORF.With this est sequence be the synthetic 5 ' RACE primer of stencil design (5GSP1:5 '-GAC TAG GTC GAG AAG TGC CTTGAA TAC CA-3 '; 5GSP2:5 '-ACG CAT GCT TCA CGT ATT GCA CGG AGT TC-3 '; 5GSP 3:5 '-CGA GCA GGT GGC TCA AAC TGT ATA AGG TG-3 '; 5GSP4:5 '-CAACTT GGT CCG CTG GTC CGT TAC CAA TC-3), concrete experimental procedure by 5 '-Full RACE Kit operational manual carries out.The RACE product cloning in pMD19-T Vector, is selected positive colony, carry out the sequencing analysis.
Schistosoma japonicum EST fragment (GenBank accession number AY809756.1) the design primer that obtains according to bioinformatic analysis (3GSP1:5 '-GTG GGA TGA TAA TAG ATT CAG CG-3; 3GSP25 '-GTT ATG TCA TAC ATA TGT ACG TTG-3 carries out the 3`RACE amplification.The RACE product cloning in pMD19-T Vector, is selected positive colony, carry out the sequencing analysis.
The sequence that 3`RACE and 5`RACE amplification is obtained is carried out electronics and is extended, the Ago1 sequence of the total length of extending according to electronics, design primer (Forwa rd CCG GAA TTC ATG CTG AAT ATG TAT GGAACT ATT; Reverse CCC GCT CGA GTG AAT GGA GGT TGA CTG GTG), utilize Schistosoma japonicum cDNA to be template, increase, the PCR product of acquisition carries out sequencing analysis, further verifies the acquisition of full-length cDNA.
(2) Schistosoma japonicum Ago2 and Ago 3 proteic 3`RACE and 5`RACE amplification and full-length clone Ago3
According to the Genbank accession number is that the sequence of AY814744.1 and AY813675.1 designs 3 ' RACE primer (Ago1:3GSP1ATG TCA CTC ACC CAG CTC CCA CTC, 3GSP2TAT TTT ACC GCG ATG GCG TGT CAGA to Ago2 and Ago 3 respectively; Ago3:GSP1:5`CAC GGA ATG TGGAAC CAG GAA CT 3`, GSP2:5`TTC CCA TTT AGC TGC ATT TCG TG 3`), carry out sleeve type PCR according to the test kit specification sheets, 94 ℃ of reaction conditionss, 3 minutes, 94 ℃ then, 30 seconds; 53 ℃, 20 seconds; 72 ℃, 3 minutes, carry out 20 cyclic amplifications, last 72 ℃ 10 minutes.The PCR product cloning arrives the pMDTM19-T carrier, and recombinant plasmid is transferred to competent escherichia coli cell DH5 α.Utilize GSP2,3`RACE test kit inner primer to identify, send Beijing six and Shanghai order-checking portion of the big Gene science stock company of China sequencing analysis positive recombinant clone for primer carries out PCR.
Handle the total RNA of Schistosoma japonicum according to SMARTerTM RACE cDNA Amplification Kit test kit specification sheets and obtain 5`RACE cDNA template.The Genbank accession number is AY813675.1 sequences Design 5`RACE primer GSP1:5`GCC TTC ATG AGA ACA AAT ATA GAA ATC A3`, GSP2:5`TTC TGA ACG ACG ATA AAT GTA ATA GCA G3`; The Genbank accession number designs 5`RACE primer 5GSP1:GTG AAT AAC TCG AGC GTT AAC AAC CAC AGG 5 ', 5GSP2:ATG CTG CAA CCG ATT GCT TTA GCT CTT C for AY814744.1.Carry out sleeve type PCR according to the test kit specification sheets, with second take turns PCR by above-mentioned 3 ' RACE method clone, the sequencing analysis.
The Ago2 and Ago 3 fragments of 3`RACE and 5`RACE amplification acquisition are carried out the electronics extension; Consequence devised primer (Ago2:Forward CGA GCT CCA TGT CTC AGA GAG GTTTCT, Rever se ATT TGC GGC CGC CTA CAG ATA AAA CAT CCC AT according to the electronics extension; Ago3:ForwardCGC GGA TCC ATG GAG GAC GGG AGC TCG AAT; Rever se CGG AAT TCTTAC AAG AAA AAC ATT CCA TC); Utilize Schistosoma japonicum cDNA to be template; Increase, the PCR product of acquisition carries out the acquisition that sequencing analysis is further verified full-length cDNA.
Recombinant expressed and the Antibody Preparation of embodiment 2 Schistosoma japonicum Ago albumen
(1) the proteic recombinant expressed and Antibody Preparation of Schistosoma japonicum Ago1: according to 3`RACE and 5`RACE amplification; Choose the conservative domain design of PIWI primer; Sense:5 ' CTCGAATTCTCTTGGTGCAGATGTTAC 3 ' (2306-2323bp); Anti-sense:5 ' GCGAAGCTTATGCGTTTAAAATTATGC 3 ' (3102-3119bp) also introduces HindIII, EcoR I restriction enzyme site sequence respectively at the upstream and downstream primer; Utilize 14d cDNA to carry out pcr amplification for template, utilize Spin Column DNA Gel Extraction Kit to reclaim amplified production and the PCR product is carried out enzyme cut processing, the PCR purified product that enzyme is cut processing is connected to through same enzyme to be cut on the expression vector pET28b (+) of processing; Construction recombination plasmid pET28b (+)-ago1, and be transformed in the e. coli bl21 and cultivate.The picking positive colony carries out PCR respectively, enzyme is cut and identified and sequence verification.Go to 37 ℃ of cultivations in the 500mlLB substratum with being verified as correct mono-clonal, induce 6h with the 200rpm shake-flask culture.Centrifugal collection thalline, the ultrasonic degradation tropina, through Ni column purification albumen, purified product is analyzed with the SDS-PAGE electrophoresis detection.
Protein immunization kunming mouse behind the purifying is prepared polyclonal antibody.Be specially, application 2 06 adjuvant emulsion purifying protein, immunizing dose be 50 μ g/ only/inferior, every at a distance from 14 days subcutaneous multiple spot reinforced immunologicals in back 1 time, totally 4 times, at the 8th week collection animal serum ,-20 ℃ of preservations are subsequent use.
(2) Schistosoma japonicum Ago2 and Ago 3 proteic recombinant expressed and Antibody Preparation: according to 3`RACE and 5`RACE amplification; The design primer; The BamHI restriction enzyme site is introduced at the upper reaches; Terminator codon TAA and HindIII restriction enzyme site (Ago2:Forward CGC GGA TCC ATG TTA CAT TGTTTA TAT AGA, Rever se CCC AAG CTT CTA TAG ATA AAA CAT CCC are introduced in downstream; Ago3:ForwardCGC GGA TCC ATG GAG GAC GGG AGC TCG AAT, Rever se CCC AAG CTT TTA TTGCTG TAT GTC ATC AGT).With the total RNA reverse transcription of 32d schistosomicide polypide is that cDNA is that the template pcr amplification goes out to be about 717bp target gene fragment with this cDNA, with fragment and pET28a (+) all with reclaiming behind BamHI and the HindIII double digestion.Should reclaim target fragment and be connected to pET28a (+), and connect product and transform B121.Select mono-clonal through PCR and enzyme cut evaluation send after all positive positive colony to Beijing six with the order-checking order-checking of Shanghai order-checking portion of the big Gene science stock company of China.Make up recombinant expression vector pET28a-SjAGO3, transform BL21.To cut and check order and identify that be male bacterium pET28a-SjAGO3/BL21 is inoculated in the LB substratum with PCR, enzyme, 37 ℃, the 200rpm shaking culture, when OD600=1.0, adding final concentration is the IPTG abduction delivering of 0.8mmol/L.Induce back 0h, 1h, 2h, 3h, 4h, 5h, different time points to collect bacterium liquid respectively at IPTG, confirm best induction time and relevant abduction delivering condition; With the tropina of SDS-PAGE electrophoretic analysis behind ultrasonic treatment, judge its expression situation simultaneously.Select optimum expression time great expression albumen, ultrasonic treatment is collected albumen, BBST NTA Resin protein purification column purification recombinant protein.Purified recombinant albumen and 206 adjuvant emulsion antigens (volume ratio 55:45) are mixed, and with recombinant protein immunity kunming mouse, per two all immunity are once gathered in the crops antibody after the immunity three times altogether with 30ug/ dosage only.Take a blood sample before the Kunming mouse immunity with behind each immunity back 7d, take a blood sample altogether 4 times.With before the immunity, one exempt from back 7d, two and exempt from back 7d, three and exempt from the dilution in 1: 200 of back 7d serum, with enzyme-linked immunosorbent assay (ELISA) detection antibody titer.Three exempt to gather in the crops antiserum(antisera) behind the 14d, and-20 ℃ of preservations obtain the antibody to Ago2 and Ago3.
(3) Western Blot method detects antibodies specific: the Schistosoma japonicum total protein carries out the SDS-PAGE electrophoresis, and half-dried commentaries on classics method is changeed film; The room temperature sealing is 2 hours in 5% the skim-milk solution (being dissolved among the PBST); Immunity gained antiserum(antisera) resists as one hatches 4 ℃ of incubated overnight; PBST washing three times, each 5 minutes, anti-then rabbit igg (AP mark) incubated at room 1-2 hour, the substrate colour developing is carried out in PBST washing three times, and the result is respectively like Fig. 1 and Fig. 2.
Embodiment 3RNA disturbs Ago albumen to influence the survival of Schistosoma japonicum: the cercaria that new zealand white rabbit belly paster is infected 8000 Schistosoma japonicum; Infect after 14 days it is cutd open extremely; Sterilization PBS (adding two anti-) with 37 ℃ of preheatings collects polypide with the portal vein lavage under aseptic condition, wash polypide twice with 37 ℃ of preheating PBS again, and then wash twice with 0.5% lactoalbumin hydrolysate solution of 37 ℃ of preheatings; Remove washing lotion; Add virgin worm substratum and divide to contain in 37 ℃ to 12 well culture plates and carry out vitro culture in the 5%CO2 cell culture incubator, every hole substratum is 2ml, and polypide is about 100.After cultivating 4h, renew bright substratum, add fresh rabbit erythrocyte and siRNA (S1:sense: 5 ' ACG CGU AAA UCGUGA GAU ATT 3 ', antisense:5 ' UAU CUC ACG AUU UAC GCG UTT 3 '; S2:sense:5 ' GGG UAA AUC UGG UAA UAU ATT 3 ', antisense:5 ' UAU AUUACC AGA UUU ACC CTT 3 '; S3:AGO-3075CCT GAA ACA TT AAG AGT AA, sense:5 ' CCU GAA ACA UUA AGA GUA ATT 3 ', antisense:5 ' UUA CUC UUA AUG UUUCAG GTT 3; Negat ive cont rol:sense:5 '-UUC UCC GAA CGU GUC ACGUTT-3, antisense:5 '-ACG UGA CAC GUU CGG AG AATT-3 ').Experiment is established altogether: blank, and negative control, positive control, totally 6 groups of S1, S2, S3 establish 3 repeating holes for every group, and the siRNA final concentration of adding is 100nM, changes once virgin worm substratum behind the 24h, adds fresh rabbit erythrocyte, and siRNA.Observe polypide after cultivating 48h, remove substratum, collect polypide, liquid nitrogen is preserved.
The result shows that siRNA continues to disturb Schistosoma japonicum after three days; Observe polypide survival rate and polypide vigor and find that the blank control group survival rate is higher; The polypide activity is more active, and interference group survival rate be merely blank control group 52.4%, 39.2-58.4%, the polypide vigor is lower.
The discovery of embodiment 4 Schistosoma japonicum small RNA moleculars
Collect schistosomicide different development stage polypide (14 days to 32 days), the male and female worm is (Fig. 3) separately, utilizes Trizol to extract total RNA; The total RNA that extracts is carried out the screening of 18-30nt size by Fig. 2; Amplification,, add top connection respectively at 3` and 5` end; The molecule that will add joint increases, and amplification utilizes solexia to carry out sequencing.The Solexa little RNA of gained 35nt that checks order is analyzed, identify miRNA.
With the mouse infection Schistosoma japonicum,, mouse is taken a blood sample at metainfective 14 days.Utilize the total RNA in the Trizol separating blood, 4 researchs obtain small RNA molecular design primer according to embodiment, and isolating total RNA is carried out rt; Obtain cDNA; With this cDNA is template, and the above-mentioned microRNA of discovering that increases carries out sequencing with the microRNA that increases.The result shows that using this research obtains small RNA molecular, utilizes Stem-loop RT-PCR technology to detect and infect to have this molecule (Fig. 4) in bilharzial host's blood, points out these small molecules to can be used as the potential beautiful molecule of schistosomiasis diagnosis.
Scope of the present invention does not receive the restriction of said specific embodiments, and said embodiment also comprises the method and the component of functional equivalent only as the single example of illustrating all respects of the present invention in the scope of the invention.In fact, except content as herein described, those skilled in the art can easily grasp multiple improvement of the present invention with reference to the description and the accompanying drawing of preceding text.Said improvement also falls within the scope of appended claims.The reference that preceding text are mentioned is listed this paper in as a reference all in full.
Claims (10)
1. Schistosoma japonicum Ago albumen is characterized in that it is (a) or protein (b) as follows:
(a) one of in the protein of its aminoacid sequence shown in SEQ ID NO.1～3;
(b) (a) described in aminoacid sequence through replacing, lack or adding one or several amino acid or modification and have an anti-apoptotic active by one of in (a) deutero-protein.
2. the coding said Schistosoma japonicum Ago of claim 1 proteic gene.
3. gene as claimed in claim 2, the nucleotide sequence that it is characterized in that said gene are one of in SEQ ID NO.4～6.
4. recombinant expression vector that comprises the said gene of claim 2.
5. transformant that comprises the said recombinant expression vector of claim 4.
6. Schistosoma japonicum small RNA molecular is characterized in that it is (a) or small RNA molecular (b) as follows:
(a) one of have shown in SEQ ID NO.7～15 in the nucleotide sequence; Or
(b) the small RNA molecular that forms by one or several replacement nucleic acid of small RNA molecular generation, disappearance or the insertion of (a) with (a) identical kind of subsequence.
One of 7. gene of the said small RNA molecular of claim 6 of encoding is characterized in that its nucleotides sequence classifies as: in the nucleotide sequence shown in SEQ ID NO.16～25; Or with the nucleotide sequence shown in SEQ ID NO.16～25 in one of in the complementary sequence of every sequence; Or with the nucleotide sequence shown in SEQ ID NO.16～25 in every sequence at least 70% homology is arranged and the identical small RNA molecular sequence of encoding in one of.
8. the proteic antibody of the said Schistosoma japonicum Ago of specific recognition claim 1 is characterized in that the immunogen of said antibody is the above-mentioned albumen of the present invention.
9. the purposes in the Schistosoma japonicum medicine is prevented and treated and/or treated to the said Schistosoma japonicum Ago of claim 1 albumen in preparation.
10. the said small RNA molecular of claim 6 is in preparation schistosomiasis diagnosis reagent or the purposes in preparation control and/or the treatment Schistosoma japonicum medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110247554A CN102329386A (en) | 2011-08-25 | 2011-08-25 | Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110247554A CN102329386A (en) | 2011-08-25 | 2011-08-25 | Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102329386A true CN102329386A (en) | 2012-01-25 |
Family
ID=45481371
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110247554A Pending CN102329386A (en) | 2011-08-25 | 2011-08-25 | Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102329386A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110643687A (en) * | 2019-11-19 | 2020-01-03 | 深圳市艾伟迪生物科技有限公司 | SRDA (sequence-related amplified deoxyribonucleic acid) isothermal nucleic acid amplification kit and application thereof |
-
2011
- 2011-08-25 CN CN201110247554A patent/CN102329386A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110643687A (en) * | 2019-11-19 | 2020-01-03 | 深圳市艾伟迪生物科技有限公司 | SRDA (sequence-related amplified deoxyribonucleic acid) isothermal nucleic acid amplification kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108707191B (en) | Truncated mutant of non-structural protein NS1 of Japanese encephalitis virus, and coding gene and application thereof | |
| CN113293145A (en) | New measles virus live vector corona vaccine | |
| CN104946686A (en) | Recombinant plasmid for expressing M protein, N protein and S1 protein in porcine epidemic diarrhea proteins, and construction method and application thereof | |
| US20080089904A1 (en) | Clostridium toxin, and process for the preparation of immunogenic composition | |
| CN102329386A (en) | Achistosoma japonica Ago protein, gene, micro RNA (Ribonucleic Acid) and application thereof | |
| CN103497241A (en) | Prawn anti-viral Argonaute protein, as well as encoding cDNA (complementary deoxyribonucleic acid) and application thereof | |
| CN101748151B (en) | Recombinant human hepatitis C virus antigen adenoviral vector and applications thereof | |
| CN116240222A (en) | Codon-optimized bovine viral diarrhea virus type 1E2 protein gene and application thereof | |
| CN108130340A (en) | Express the application of the method and this method of duck source avian influenza virus NS1 albumen | |
| Lupo et al. | Immunodetection of the 33 K/92 K polymerase proteins in cymbidium ringspot virus-infected and in transgenic plant tissue extracts | |
| CN109321583B (en) | Method for constructing reversed genetic system of muscovy duck reovirus | |
| CN108840934B (en) | Recombinant sheep long-acting interferon tau, fusion protein for preparing long-acting interferon tau and preparation method of fusion protein | |
| CN112843225A (en) | RA OmpA gene-based Riemerella anatipestifer DNA vaccine and preparation method and identification method thereof | |
| NZ520600A (en) | Novel therapeutic compositions for treating infection by Lawsonia spp | |
| CN107746848B (en) | Recombinant classical swine fever virus E2 protein and expression cell line, preparation method, application and classical swine fever virus subunit vaccine thereof | |
| CN110946877A (en) | Stem cell biological product for treating liver cirrhosis and preparation method and application thereof | |
| CN108517309A (en) | A kind of recombinant lactobacilli and preparation method of expression PRRSV-GP5 albumen | |
| CN117051043B (en) | Methicillin-resistant staphylococcus aureus endolysin based on cyclic RNA coding and application thereof | |
| CN106177993B (en) | Infectious bursal disease virus DNA vaccine and construction method thereof | |
| CN114574503B (en) | Swine fever E2 protein gene, porcine pseudorabies virus gD protein gene and application thereof | |
| CN107417784B (en) | Application of SjP40 protein of schistosoma japonicum | |
| CN117143207B (en) | Recombinant epitope protein, encoding gene, recombinant plasmid, preparation method, engineering bacteria and application | |
| CN113274491B (en) | RNA vaccine for porcine epidemic diarrhea and construction method thereof | |
| CN116444682B (en) | Biological protein degradation targeting chimeric for targeting degradation of PRRSV key replicase and application thereof | |
| CN112458063B (en) | Monoclonal antibody hybridoma cell strain for resisting chicken SAMHD1 protein, monoclonal antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120125 |