CN102321623B - Cloned reference gene of kentucky bluegrass aquaporin - Google Patents
Cloned reference gene of kentucky bluegrass aquaporin Download PDFInfo
- Publication number
- CN102321623B CN102321623B CN 201110246952 CN201110246952A CN102321623B CN 102321623 B CN102321623 B CN 102321623B CN 201110246952 CN201110246952 CN 201110246952 CN 201110246952 A CN201110246952 A CN 201110246952A CN 102321623 B CN102321623 B CN 102321623B
- Authority
- CN
- China
- Prior art keywords
- gene
- reference gene
- aquaporin
- kentucky bluegrass
- cdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses a method for cloning reference gene of kentucky bluegrass aquaporin. The method comprises: (1) adopting the total RNA of the kentucky bluegrass as a template to carry out a reverse transcription reaction to obtain a first strand of the cDNA; (2) adopting the cDNA as a template, and adopting EF1alphaF1 as the primer to carry out PCR amplification; (3) carrying out recovery for the amplification product to recover the target gene band; (4) ligating the resulting target gene to a pMD18-T vector, and transforming the resulting vector into competent cells, then carrying out DNA sequencing for the cultured bacteria liquid to obtain the reference gene sequence of the kentucky bluegrass aquaporin, wherein the reference gene sequence comprises 176 bp. Compared to the traditional reference gene, the obtained reference gene EF-1alpha of the kentucky bluegrass is prevented from the influence due to the cell growth state, can undergo the influence due to external non-biological factors, and can be expressed stably in the tissue.
Description
Technical field
The invention belongs to the biotechnology breeding field, be specifically related to a kind of method of cloning reference gene of kentucky bluegrass aquaporin.
Background technology
Along with the develop rapidly of China's economic construction, the environment of depending on for existence to people in the lawn plays increasing improvement, beautifies and provide protection, becomes the important component part of living environment.In the city of China's population comparatively dense, the live and work environment that greenweed is spreaded and sink in, the fragrance of a flower overflows will bring immeasurable ecological benefits, Social benefit and economic benefit.Yet the increase of the scarcity of water resources and lawn area is the contradiction the most outstanding that use on the restriction lawn, people day by day rely on for counsel in the lawn functional, recreational and ornamental in, face again the problem that solves the required moisture of Turfgrass Growth.Particularly in the Urban areas that water resources becomes day by day in short supply, the lawn irrigation water requirement is an importance of competition water.In the northern China arid and semi-arid lands, water resources only accounts for about 7% of national total amount, and the trend of minimizing is arranged in recent years.At the Turfgrass Growth initial stage, what of moisture play a part to cause closes importantly, is determining the success or failure of turf establishment and is becoming speed, time and the quality on level ground.The approach that addresses this problem is except continuing to open up the water source, utilize agronomy and engineering to carry out effective water saving irrigation, the abiotic water saving measures such as soil moisture conservation improve outside the ambient water level of resources utilization, another prior measure is by biology self water saving potential (Biological Water Saving in Agriculture) (Zhang Zhengbin, 2006, the Advances in Genetic Improvement of Crop Water Use Efficiency) water use efficiency (the Water use efficiency of raising turfgrass, WUE), utilize modern science and technology developing lawn water saving new way, cultivate the resisting drought saving water new variety, allow each drip and produce more green, create more ecological benefits and social benefit.
English grass (formal name used at school: Poa pratensis L. English name: Kentucky bluegrass) belong to the perennial cold-season-type rhizome of Gramineae (Gramineae), annual bluegrass system (Poatae), Poa L. (Poa L.)-dredge clump type dogstail, it is universally acknowledged good cold-season turfgrass, for a long time, enjoy the attention of Lawn Industry developed country always.Its natural resources is distributed widely in temperate zone, the world, cool temperature zone and extremely frigid zones, and China also is the very abundant countries of English grass resource standing stock., the leaf and strain shape of English grass leaf look dark green is graceful, and the turf of formation is solid and therefore high resilience is widely used in the lawn greenings such as urban green space, park, garden, is used in addition alley and the top grass district of golf course.Because English grass is larger to water stress sensitivity and water loss, utilizes Protocols in Molecular Biology to excavate anti-drought gene and carry out gene recombination and breed drought-resistant variety and become present breeding objective.Discovered in recent years and obtain a kind of English grass moisture absorption mechanism to be had the water channel protein gene of important regulative, to its clone and with other gene recombination may for realizing that breeding objective provides.But owing to lack reference gene when water channel protein gene clone, be difficult to realize correction and the stdn of genetic expression, greatly hinder the application of water channel protein gene in gene recombination, become the scientific research difficult problem of universally acknowledged urgent need solution.
Reference gene is the gene that destination gene expression is used as reference, and it is relative with the expression in the cell constant at each tissue.The effect of reference gene mainly is that the expression of goal gene is proofreaied and correct, and makes goal gene when clone reach standard-required and the result that makes qRT-PCR accurately (Hu Ruibo, 2009, the selection of plant real-time fluorescence quantitative PCR reference gene).Real-time fluorescence quantitative RT-PCR (real-time fluorescent quantitative reverse transcription-polymerase chain reaction, FQ RT-PCR) is the sensitive method that detects low abundance mRNA, in order to remove the difference that different specimens may exist on the Yield and quality of RNA and reverse transcription efficient and obtain the specific expressed real difference of target gene, usually select certain reference gene to proofread and correct and stdn.Variation in the reference gene amplification can reflect the variation of RNA Yield and quality and/or cDNA combined coefficient.Selecting suitable reference gene is necessary to reduce the difference that detects between sample.So, seek the key that the suitable reference gene of English grass water channel protein gene becomes the breeding research of English grass water channel protein gene.
At present, acquisition and the application about reference gene both at home and abroad only has report (Zheng Xiaoya etc. in some crop investigationss, 2011, Glutinous Semen Maydis water use efficiency and aquaporin differential expression research under the adverse environmental factor), but the reference gene when being directed to the expression of English grass water channel protein gene there is not yet report both at home and abroad.
Summary of the invention
In view of this, in order to overcome the difficulty of English grass water channel protein gene breeding research in the prior art, the invention provides a kind of English grass aquaporin reference gene and cloning process thereof, this gene is not subjected to the impact of annual bluegrass cell growth state, be able to take the impact of the extraneous abiotic factors such as salt stress, arid, in tissue, express and stablize, can be used for correction and stdn that the English grass water channel protein gene is expressed.
One of purpose of the present invention is: a kind of primer for English grass aquaporin reference gene clone is provided, and described primer sequence is SEQ ID NO: 1 and SEQ ID NO: 2, that is:
EF1αF1∶5’-GTTGCHGTTGCHTBAAGCGTGG-3’
EF1αR1∶5’-TCWGCAAACTTRACAGCAATGTG-3’。
Two of purpose of the present invention is: the English grass aquaporin reference gene that provides above-mentioned primer clone to obtain, described reference gene sequence SEQ ID NO: 3 are: TGTTGCTGTTGCATTAAGCGTGGGTTTGTGGCTTCTAACTCCAAGGATGACCCAGC CAAGGAGGCTGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGCCAGA TCGGCAACGGTTACGCCCCGGTGCTGGACTGCCACACCTCCCACATTGCTGTCAAG TTTGCAGA.
Three of purpose of the present invention is: the clone is provided the method for above-mentioned English grass aquaporin reference gene, and described method comprises:
(1) take the total RNA of English grass as template, carry out reverse transcription and obtain cDNA the first chain,
(2) with the cDNA that obtains as template, with primer SEQ ID NO:1 and SEQ ID NO:2, that is:
EF1αF1∶5’-GTTGCHGTTGCHTBAAGCGTGG-3’
EF1 α R1: 5 '-TCWGCAAACTTRACAGCAATGTG-3 ' carries out pcr amplification,
(3) with pcr amplification product through the DNA electrophoresis, reclaim gel and obtain the goal gene band,
(4) goal gene that obtains is connected in the pMD18-T carrier, connects product and be converted in the competent cell, carry out dna sequencing to cultivating bacterium liquid, obtain the English grass aquaporin reference gene sequence of 176bp.
Four of purpose of the present invention is: the method that a kind of accurate correction water channel protein gene expression amount is provided, its implementation is: with the processing plant under the various condition of salt stress and non-processor adjoining tree, get the tender leaf position and carry out the clone of water channel protein gene and reference gene, clone gene is expressed in thalline, the expression amount of reference gene is corrected the expression amount of water channel protein gene under each stress conditions, wherein, the clone of described reference gene is: (1) is take the total RNA of English grass as template, carry out reverse transcription and obtain cDNA the first chain, (2) with the cDNA that obtains as template, with primer SEQ ID NO: 1 and SEQ ID NO: 2, that is:
EF1αF1∶5’-GTTGCHGTTGCHTBAAGCGTGG-3’
EF1αR1∶5’-TCWGCAAACTTRACAGCAATGTG-3’
Carry out pcr amplification, (3) with pcr amplification product through the DNA electrophoresis, reclaim gel and obtain the goal gene band, (4) goal gene that obtains is connected in the pMD18-T carrier, connecting product is converted in the competent cell, carry out dna sequencing to cultivating bacterium liquid, obtain the English grass aquaporin reference gene sequence of 176bp.
Beneficial effect of the present invention is:
(1) English grass EF-1 α reference gene of the present invention has reached the requirement of real-time fluorescence quantitative RT-PCR (real-time quantitative reverse transcription PCR, qRT-PCR) at the accurate quantitative analysis that carries out the water channel protein gene expression analysis.
(2) gene of the present invention is not subjected to the impact of cell growth state, is able to take the impact (salt stress, arid etc.) of extraneous abiotic factor, expresses highly stablely in tissue, and this is that traditional reference gene is unwarrantable.
The explanation of accompanying drawing table
Fig. 1 English grass EF-1 α gene amplification electrophorogram
Fig. 2 English grass EF-1 α gene amplification curve
Fig. 3 English grass EF-1 α gene solubility curve
The different adverse circumstance treating meadow of table 1 annual bluegrass EF-1 α gene expression amount
Table 2 is made the water channel protein gene expression of results of confidential reference items with English grass EF-1 α
Embodiment
The present invention carries out in accordance with the following steps:
(1) design of primers: the mRNA sequence (Accession Number.M90077.1/AB061263.1/D63396.1/AF242732.1/X14449.1/ AB073631.1) of the wheat (Wheat) that logs in according to Genbank/potato (Solanum tuberosum)/tobacco (Nicotiana tabacum)/capsicum (Capsicum annuum)/tomato (Tomato)/aptery Herba Salsolae Collinae (Salsola komarovii) EFl α gene, design a pair of degenerate primer EF1 α F1/EF1 α R1, primer sequence is as follows:
EF1αF1∶5’-GTTGCHGTTGCHTBAAGCGTGG-3’
EF1αR1∶5’-TCWGCAAACTTRACAGCAATGTG-3’
Primer is given birth to worker Bioisystech Co., Ltd by Shanghai and is synthesized.
(2) English grass EF-1a gene clone: take total RNA as template, the application test kit is HaiGene, and cDNA lst Synthesis Kit carries out reverse transcription and obtains cDNA the first chain; The following mixed solution of preparation in the PCR pipe:
On the PCR instrument, carry out reverse transcription reaction by following condition: 30 ℃ of 5min, 42 ℃ of 45min, 95 ℃ of 5min, 4 ℃.
As template, the primer Plant EF-1 α F1/Plant EF-1 α R1 designed with step (1) carries out pcr amplification, acquisition goal gene band with the cDNA that obtains.Reaction system is as follows:
On the PCR instrument, react by following condition: 95 ℃ of 5min, 95 ℃ of 20s, 58 ℃ of 45s, 72 ℃ of 42s, totally 35 circulations, 72 ℃ of 5min.
The goal gene electrophorogram that obtains is seen accompanying drawing 1.
(3) with the pcr amplification band that obtains after dna gel reclaims, be connected in the pMD18-T carrier, connecting product is converted in the competent cell, cultivate 9-16h for 37 ℃, picking list bacterium colony is cultivated in the LB liquid nutrient medium, and bacterium liquid is delivered to Shanghai living worker biotech company and checked order, and obtains the 176bp product, through sequence verification, this sequence is annual bluegrass EF-1 α gene order.Can be used for confidential reference items and correct analysis.Sequence is as follows: TGTTGCTGTTGCATTAAGCGTGGGTTTGTGGCTTCTAACTCCAAGGATGACCCAGC CAAGGAGGCTGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGCCAGA TCGGCAACGGTTACGCCCCGGTGCTGGACTGCCACACCTCCCACATTGCTGTCAAG TTTGCAGA
(4) get the English grass plant and carry out following Stress treatment: coerce 24h with 250mM Nacl, 100 μ M ABA, 5%PEG6000, and establish the non-processor plant for contrast, get tender leaf and extract total RNA.The application test kit is HaiGene, and cDNA 1st Synthesis Kit carries out reverse transcription and obtains cDNA the first chain.Take the cDNA that obtains as template, carry out RealTime pcr amplification HaiGene, SYBR Green Kit), its reaction system is as follows:
Reaction conditions: 95 ℃ of 2min, 95 ℃ of 10s, 62 ℃ of 35s, 40cycles
The quantitative PCR instrument is: Bio-Rad Min-Opticon2
The expression amount that obtains 1 which kind of Stress treatment no matter of seeing attached list, EF-1 alpha expression amount no significant difference in the English grass tender leaf, amplification curve good (seeing accompanying drawing 2), solubility curve single (seeing accompanying drawing 3), show this stable gene, can do the reference gene of clone's English grass aquaporin.This gene only is suitable for making the reference gene that the water channel protein gene under the English grass adverse environmental factor is expressed, and good stability is in traditional reference gene.
(5) do reference with EF-1 α gene, coerce English grass plant 24h with 250mM Nacl, 100 μ M ABA, 5%PEG6000, and establish the non-processor plant for contrasting, get the tender leaf position and carry out the clone of water channel protein gene (the accession number Accession Number of water channel protein gene in gene bank is JN383984), it the results are shown in subordinate list 2.As can be seen from the results, through behind the calibration standard, the tender leaf of coercing with 5%PEG6000, the aquaporin expression amount is the highest, secondly expression amount is higher is blade through 250mM Nacl Stress treatment, and the leaf expression amount of contrast only is 22.37% of 5%PEG6000 processing, is 53.34% of 250mMNacl processing, is 43.53% of 100 μ M ABA processing.If this step is proofreaied and correct without reference gene, can't judge the real value that water channel protein gene is expressed between each processing.
The different adverse circumstance treating meadow of table 1 annual bluegrass EF-1 α gene expression amount
EF-1α | EF-1α | EF-1α | Average | |
CK | 24.26 | 24.17 | 24.36 | 24.26 |
Nacl | 25.76 | 25.40 | 25.59 | 25.58 |
ABA | 24.58 | 24.87 | 24.39 | 24.61 |
PEG | 24.69 | 25.04 | 24.30 | 24.68 |
Table 2 is made the water channel protein gene expression of results of confidential reference items with English grass EF-1 α
Claims (1)
1. an English grass aquaporin reference gene is characterized in that, described reference gene base sequence is shown in sequence table SEQ ID NO.3.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110246952 CN102321623B (en) | 2011-08-25 | 2011-08-25 | Cloned reference gene of kentucky bluegrass aquaporin |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110246952 CN102321623B (en) | 2011-08-25 | 2011-08-25 | Cloned reference gene of kentucky bluegrass aquaporin |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102321623A CN102321623A (en) | 2012-01-18 |
CN102321623B true CN102321623B (en) | 2013-04-17 |
Family
ID=45449459
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110246952 Expired - Fee Related CN102321623B (en) | 2011-08-25 | 2011-08-25 | Cloned reference gene of kentucky bluegrass aquaporin |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102321623B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104357454A (en) * | 2014-10-10 | 2015-02-18 | 南阳师范学院 | CcRF1a (cinnamomum camphora elongation factor 1 alpha) gene segment sequence and cloning method |
-
2011
- 2011-08-25 CN CN 201110246952 patent/CN102321623B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN102321623A (en) | 2012-01-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103882142B (en) | A kind of method of Rapid identification and evaluation plant reference gene suitability | |
CN103695438B (en) | Arabidopsis MYB family transcription factor AtMYB17 gene, coded sequence and application thereof | |
CN102321758A (en) | Method for screening real-time fluorescent quantitative PCR internal reference molecules of desert plant Eremosparton songoricum (Litv.) Vass. | |
CN108486273B (en) | Excavation and application of SSR (simple sequence repeat) markers on chromosome 5 and closely linked with salt-tolerant QTL (quantitative trait locus) of rice | |
CN111100945A (en) | Reference gene of toona sinensis, primer and application thereof | |
CN107099588A (en) | Exploitation and its application for identifying the precocial SSR marker of upland cotton | |
CN108395995A (en) | Arbuscular mycorrhizal fungi high-efficiency strain quickly screens and identification method | |
CN102321623B (en) | Cloned reference gene of kentucky bluegrass aquaporin | |
CN110184384B (en) | Method for identifying drought resistance of corn variety based on real-time quantitative PCR | |
CN102517398A (en) | Molecular detection method for rapidly verifying salt-tolerant fraxinus velutina | |
CN103194458B (en) | Method for improving phosphorus absorption efficiency of wheat plant by using sucrose transporter gene | |
CN101760556A (en) | Molecular marker technology for identifying red grains and white grains of wheat | |
CN101831497B (en) | Molecular marking method for distinguishing salt-tolerance character of tomato | |
CN111534628B (en) | SSR molecular marker primer group for identifying sex of populus tremuloides and application thereof | |
CN109234289B (en) | Method for creating stress-resistant transgenic alfalfa | |
CN108504760B (en) | QTL excavation and application of excellent salt-tolerant resources of rice | |
CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance | |
CN106811448B (en) | Cotton tyrosine phosphatase GhPTP1 and its encoding gene and application | |
CN103981196B (en) | PFP gene is controlling the application in rice seedling thermotolerance | |
CN107630026A (en) | The red moss aldehyde dehydrogenase gene of extremely resistance to dry tooth rib and its encoding proteins | |
CN109082425A (en) | Rape Boron efficiency gene BnA3NIP5;The transposons Insert Fragment TEQ and primer of 1Q and its application | |
CN102140138A (en) | Plant drought-resistant associated protein TaNAC2742, coding genes and application thereof | |
CN112280789B (en) | Salt and alkali stress tolerance gene of sorghum, detection primer group, kit and application | |
CN116103306B (en) | Application of OsAC37 gene and encoding protein in regulation and control of suitability of paddy rice direct seeding | |
CN114480702B (en) | Fluorescent quantitative PCR reference gene of different tissues of sea buckthorn under drought stress, and screening method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130417 Termination date: 20180825 |
|
CF01 | Termination of patent right due to non-payment of annual fee |