CN102321612B - Industrialized gene synthesis method - Google Patents
Industrialized gene synthesis method Download PDFInfo
- Publication number
- CN102321612B CN102321612B CN 201110249829 CN201110249829A CN102321612B CN 102321612 B CN102321612 B CN 102321612B CN 201110249829 CN201110249829 CN 201110249829 CN 201110249829 A CN201110249829 A CN 201110249829A CN 102321612 B CN102321612 B CN 102321612B
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide chain
- oligonucleotide
- sequence
- chain
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses an industrialized gene synthesis method. The industrialized gene synthesis method comprises the following steps of (1) analyzing and optimizing a DNA sequence for synthesis to obtain a target DNA sequence; (2) designing an oligodeoxynucleotide chain for extension according to the target DNA sequence; (3) synthesizing and purifying the oligodeoxynucleotide chain; (4) splicing the oligodeoxynucleotide chain to form a DNA fragment; (5) cloning the DNA fragment to a vector to obtain a recombinant plasmid; (6) carrying out sequencing analysis of the recombinant plasmid; and (7) carrying out a quality validation process on the recombinant plasmid with a correct sequence. The industrialized gene synthesis method has the characteristics of high success rate, high throughput, high speed, low cost, simple design, wide application scope and standardized operation. Therefore, the industrialized gene synthesis method has feasibility of industrial scale popularization, and is beneficial for reduction of costs, shortening of a synthesis cycle and improvement of synthesis quality.
Description
Technical field
The present invention relates to field of genetic engineering, relate in particular to a kind of method for synthesizing gene of suitable suitability for industrialized production.
Background technology
As one of basic technology of molecular biology operation, molecular cloning has successfully used more than two decades, be that scientists is carried out gene clone, detection, functional study and recombinant expressed necessary means, revolutionary pushing effect has been played in bionic development.In today of era gene high speed development, traditional molecule clone technology can not satisfy the genetic manipulation requirement of the needed efficiently and accurately of scientific research personnel, and this vacancy is just being filled up in the appearance of gene synthesis technology, becomes the important technical that target gene obtains.Utilize the synthetic mode of gene to obtain goal gene, not only can obtain the gene order that occurring in nature does not exist or template content is extremely low, and can improve expression amount or reach the purpose that gene function is modified by sequence optimisation.
Gene synthesis technology has been opened up a brand-new direction for the mankind transform biology, and any field that interrelates with gene all needs to carry out the synthetic of artificial gene, and utilizes the carriers such as plasmid or virus to be transported to the purpose cell or tissue, to reach various purposes.Along with the development of proteomics, the deepening continuously of the research of the industries such as bio-pharmaceuticals, the synthetic demand of full gene is also increasing day by day.In predictable future, gene is synthetic will play a great role in the fields such as life science and new forms of energy, novel material, artificial life, nucleic acid vaccine, biological medicine.
Gene is synthetic two kinds of approach, and the one, the business of gene Synesis Company is synthetic, and the 2nd, the own synthetic gene in local laboratory.The own synthetic gene in laboratory generally need to synthesize according to the method for reference with reference to academic article, but is all the synthetic of indivedual genes mostly, and cost is high, success ratio is low, therefore only possesses limited reference value.The business of gene Synesis Company is synthetic is to have the professional and technical personnel to operate, and it is short to have synthesis cycle, can modify to restriction enzyme site or the gene order of gene, can carry out codon optimized, also can obtain occurring in nature according to the design of researchist's oneself wish and be difficult to obtain even the advantages such as non-existent gene, so determined that the business of gene Synesis Company becomes the main channel that present gene synthesizes.
Gene synthesizes and mainly comprises three steps at present: the one, and chemical method synthetic oligonucleotide fragment, synthetic oligonucleotide fragment is at 150bp～200bp usually; The 2nd, manually splice the sequence that obtains growing with the oligonucleotide chain of enzyme process with chemosynthesis; The 3rd, take long sequence as the basis, further splice the DNA sequence dna that obtains more growing, until reach the length that needs.In the gene synthetic, the splicing of oligonucleotide chain is the main rate-limiting step of gene synthetic.Gene-splicing method commonly used mainly contains following two kinds:
First method is to connect enzyme process, first oligonucleotide to be activated, with 5 of upper necessity '-phosphate group, then with corresponding complementary oligonucleotide fragment annealing, formation is with the double chain oligonucleotide fragment of sticky end, use again ligase enzyme (T4 DNAS Ligase, Taq Ligase etc.) that they are connected to each other to a large fragment (Khorana HG. Science. V203,614-625.1979) of a complete gene or gene.Due to all ligase enzymes all need 5 '-end of phosphorylation with are connected '-hydroxyl connects, so before reaction, middle the primer that is used for connecting need to carry out 5 '-phosphatizing treatment, this cost that just makes gene synthesize increases greatly.Simultaneously, for the efficient that guarantees to synthesize, the length of the synthetic longer sequence of single ligase enzyme reaction is restricted, and usually should not surpass 500bp.
Second method is the PCR method, two are had complementary 3 '-oligonucleotide fragment of the length of end anneals each other, the single stranded DNA that produces as template under the effect of e. coli dna polymerase Klenow fragment, synthesize corresponding complementary strand, formed double chain DNA fragment is on can treated insertion suitable carrier.The PCR method also is used to more grow the synthetic of sequence usually; as the people such as Smith (Hamilton O. Smith; the ClydeA.Hutchison III; Cynthia Pfannkoch et al .PNAS. V100; 15440-15445.2003) with Tag Ligase, primer is connected after; again the connection product is carried out the PCR method and synthesize, obtained the Φ X174 bacteriophage genome of the 5386bp of total length.The PCR method does not need oligonucleotide chain is carried out any modification, and therefore synthetic cost connects enzyme process to be reduced greatly, but due to many oligonucleotide chain parallel reactions, the sequence that synthesize is longer, and the possibility of the extension that makes a mistake is just larger.The method for synthesizing gene of isothermal unidirectional growth (patent No. ZL 200610028886.6) is a kind of improvement of PCR method, when designing, the DNA oligonucleotide chain added hairpin structure and restriction enzyme site, add plurality of enzymes to comprise polysaccharase, excision enzyme and restriction enzyme in same reaction system, make a plurality of DNA oligonucleotide chains isothermal unidirectional growth under identical conditions, the polymerization of hybridizing, carry out next round complementary under the effect of three kinds of enzymes is afterwards extended.A plurality of DNA oligonucleotide chains of this kind method employing react under identical conditions has simplified operation, reduced cost, but but there is shortcomings, as complicated in the oligonucleotide chain design, plurality of enzymes is carried out polystep reaction simultaneously, and to cause splicing efficient low, the success ratio that the length dna sequence is synthesized is low and output that gene is synthetic is little, can't be directly used in downstream process, all to carry out again pcr amplification etc. as clone, ligation etc., therefore can't be used for longer gene, full gene or genomic synthesizing, more difficultly promote in actual production.
Summary of the invention
In view of the defective that above-mentioned prior art exists, the objective of the invention is to propose a kind of have high success rate, high-throughput, the synthetic method of industrialization gene at a high speed and cheaply.
Purpose of the present invention will be achieved by the following technical programs:
A kind of industrialized method for synthesizing gene is characterized in that comprising the following steps:
Step 1: DNA sequence dna to be synthesized is analyzed and optimized, obtain and design consistent target dna sequence;
Step 2: according to target dna sequence described in step 1, be designed for the oligonucleotide chain of extension;
Step 3: the described oligonucleotide chain of design in synthetic also purification step two;
Step 4: the described oligonucleotide chain that obtains in step 3 is spliced, form DNA fragmentation;
Step 5: the described DNA fragmentation that obtains in step 4 is cloned into the plasmid recombinant that carrier obtains described target dna sequence and carrier;
Step 6: described plasmid recombinant is carried out sequencing analysis;
Step 7: correct described plasmid recombinant carries out quality verification to checking order.
Further, above-mentioned industrialized method for synthesizing gene, wherein: the step that is designed for the oligonucleotide chain of extension in described step 2 is:
One, described target dna sequence is designated as normal chain, the complementary strand of normal chain is designated as minus strand, is segmented into end to end DNA fragmentation;
Two, every segment DNA fragment is divided into again a plurality of oligonucleotide chains, the oligonucleotide chain that each oligonucleotide chain is adjacent with its left and right has the overlapping complementary sequence of head and the tail, from 5 of described DNA fragmentation '-end begin oligonucleotide chain is numbered in order, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, and the quantity of the oligonucleotide chain in described DNA fragmentation is all even number;
Three, 5 of described target dna sequence '-oligonucleotide chain of last numbering of first DNA fragmentation of end 5 '-oligonucleotide chain of first numbering of second DNA fragmentation holding and be adjacent 5 '-end has overlapping complementary sequence, the like, between every two adjacent DNA fragmentations, overlapping complementary sequence is arranged;
Four, be positioned at target dna sequence 5 '-oligonucleotide chain of end 5 '-end add one section with carrier on the overlapping sequence of the upstream sequence of target dna sequence insertion point;
Five, be positioned at target dna sequence 3 '-oligonucleotide chain of end 5 '-end add one section with carrier on the sequence of the overlapping complementation of downstream sequence of target dna sequence insertion point.
Further, above-mentioned industrialized method for synthesizing gene, wherein: the length of every segment DNA fragment is between 20～20000 base pairs; The length of each oligonucleotide chain is between 20～500 bases; The length of the overlapping complementary sequence between the oligonucleotide chain that each oligonucleotide chain is adjacent is between 10～50 bases.
Further, above-mentioned industrialized method for synthesizing gene, wherein: the described overlap of interpolation and described overlapping complementary sequence are respectively the DNA sequence dna of length between 0～100 base.
Further, above-mentioned industrialized method for synthesizing gene, wherein: the annealing temperature of described oligonucleotide chain is between 30 ℃～70 ℃.
Further, above-mentioned industrialized method for synthesizing gene, wherein: in described step 3, the method for synthetic oligonucleotide chain is any one in phosphodiester method, phosphotriester method, tris phosphite method, solid-phase synthesis, automatization method and gene chips.
Further; above-mentioned industrialized method for synthesizing gene; wherein: described solid phase phosphoramidite triester method be 3 of the oligonucleotide chain that will will synthesize '-end first with 3 '-OH is connected with a solid phase carrier; then successively from 3 '-5 ' direction will protect the nucleotide monomer of active function groups to add up; form at last with 3 ', 5 '-oligonucleotide fragment that phosphodiester bond couples together.
Further, above-mentioned industrialized method for synthesizing gene, wherein: in described step 3, the method for purification of oligonucleotides chain is any one in C18 post, OPC post, PAGE and HPLC.
Further, above-mentioned industrialized method for synthesizing gene, wherein: the joining method of described oligonucleotide chain is any one in connection enzyme process and PCR method.
Further, above-mentioned industrialized method for synthesizing gene, wherein: described connection enzyme process comprises the following steps:
(1) be designed for the oligonucleotide chain of extension, make the overlapping complementation of the adjacent oligonucleotide chain in every oligonucleotide chain and left and right, from 5 of DNA fragmentation '-end begin oligonucleotide chain is numbered, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, and the quantity of the oligonucleotide chain of every DNA fragmentation is all even number;
5 of each oligonucleotide chain that (2) will synthesize '-end carries out phosphorylation, make on the oligonucleotide chain band 5 '-phosphate group;
(3) synthetic oligonucleotide chain is according to number order, in the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide chain, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide, described normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add resistant to elevated temperatures ligase enzyme to carry out splicing reaction, reaction conditions is as follows:
94 ℃～96 ℃ sex change 2min～5min slowly anneal 30min to 30 ℃～60 ℃, hatch 30min～60min for 40 ℃～60 ℃;
(4) get recovery product in step (3) as template, add the oligonucleotide chain at head and the tail two ends in DNA fragmentation as primer, add archaeal dna polymerase to carry out pcr amplification, finally obtain a large amount of DNA fragmentations; The reaction conditions of described pcr amplification is as follows:
94 ℃～96 ℃ denaturation 2min～5min carry out 1 circulation; Afterwards, 95 ℃ of sex change 15s～30s, the 15s～30s that anneals under the annealing temperature Tm of oligonucleotide chain, 72 ℃ of extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 18～25 circulations; At last, 72 ℃ are extended 1min～7min.The following formula Tm=2 of described Tm general satisfaction * (A+T)+4 * (G+C); The described extension time refers to what the size according to target dna sequence decided, is generally 1min/3kb～1min/4kb.
Further, above-mentioned industrialized method for synthesizing gene, wherein: described resistant to elevated temperatures ligase enzyme is Taq DNA ligase or T4 DNA ligase.
Further, above-mentioned industrialized method for synthesizing gene, wherein: described PCR method comprises the following steps:
(1) describedly has the oligonucleotide chain of overlapping complementary sequence according to number order with synthetic, in the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide, described normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add archaeal dna polymerase to increase;
(2) reaction conditions of PCR method amplification is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, 5s～90s anneals under the annealing temperature Tm of described oligonucleotide chain, 70 ℃～75 ℃ extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min; Can obtain described target dna sequence.The following formula Tm=2 of described Tm general satisfaction * (A+T)+4 * (G+C); The described extension time refers to what the size according to target dna sequence decided, is generally 1min/3kb～1min/4kb.
Further, above-mentioned industrialized method for synthesizing gene, wherein: further comprising the steps of (3): the product of the pcr amplification for the first time that obtains with described step (2) reclaims as template, add the oligonucleotide chain as head and the tail two ends in the DNA fragmentation of primer, and add archaeal dna polymerase to carry out pcr amplification for the second time, finally obtain DNA fragmentation; The reaction conditions of described pcr amplification for the second time is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, 5s～90s anneals under the annealing temperature Tm of oligonucleotide chain, 70 ℃～75 ℃ extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min.The following formula Tm=2 of described Tm general satisfaction * (A+T)+4 * (G+C); The described extension time refers to what the size according to target dna sequence decided, is generally 1min/3kb～1min/4kb.
Further, above-mentioned industrialized method for synthesizing gene, wherein: described archaeal dna polymerase is the high temperature-resisting DNA polymerase of high-fidelity.
Further, above-mentioned industrialized method for synthesizing gene, wherein: it is any one in connection method, PCR method and homologous recombination method that described DNA fragmentation is cloned into method that carrier obtains plasmid recombinant.
Further, above-mentioned industrialized method for synthesizing gene, wherein: described homologous recombination method is any one in the restructuring splicing method of the restructuring splicing method of single fragment and carrier and multi-disc section and carrier.
Outstanding effect of the present invention is: the present invention have high success rate, high-throughput, at a high speed, characteristics cheaply, its simplicity of design, widely applicable, operational standardization, can carry out industrially scalable and promote, be conducive to reduce costs, shorten synthesis cycle and improve synthetic quality.In addition, the present invention not only is applicable to the synthetic of gene, also can be used for genomic synthesizing, and will play important pushing effect for the fast development in the fields such as new forms of energy, novel material, artificial life, nucleic acid vaccine, biological medicine.
Following constipation closes the embodiment accompanying drawing, the specific embodiment of the present invention is described in further detail, so that technical solution of the present invention is easier to understand, grasp.
Description of drawings
Fig. 1 is gene building-up process schematic flow sheet of the present invention;
Fig. 2 is the synthetic oligonucleotide chain design diagram of gene of the present invention;
Fig. 3 is that multi-disc section interpolation of the present invention and carrier polysaccharase ring extend the process schematic diagram;
Fig. 4 A is the oligonucleotide chain PCR splicing electrophorogram of the embodiment of the present invention 1;
Fig. 4 B is the recombinant plasmid FucT2-pUC57 restriction enzyme digestion and electrophoresis figure of the embodiment of the present invention 1;
Fig. 5 A is the PCR splicing electrophorogram of two groups of oligonucleotide chains of the P110-alpha-A of the embodiment of the present invention 2;
Fig. 5 B is the electrophorogram that two groups of oligonucleotide chains of the P110-alpha-A of the embodiment of the present invention 2 are spliced into total length;
Fig. 5 C is the electrophorogram that three spellings of the P110-alpha-B of the embodiment of the present invention 2 are connected into total length;
Fig. 5 D is the P110-alpha total length gel electrophoresis figure of the embodiment of the present invention 2;
Fig. 5 E is recombinant plasmid BamHI and the NotI double digestion proof diagram of the embodiment of the present invention 2;
Fig. 6 A is the PCR splicing electrophorogram of four groups of oligonucleotide chains of the NaV15_6AhH1-A of the embodiment of the present invention 3;
Fig. 6 B is the electrophorogram of the NaV15_6AhH1-A total length of the embodiment of the present invention 3;
Fig. 6 C is the evaluation figure of the recombinant plasmid human NaV15_6AhH1-pcDNA3.1 (+) of the embodiment of the present invention 3;
Fig. 7 is the sequencing result of the FucT2-pUC57 of the embodiment of the present invention 1;
Fig. 8 is the sequencing result of the P110-alpha-pLVX-Tight-puro of the embodiment of the present invention 2;
Fig. 9 is the sequencing result of the humanNaV15_6AhH1-pcDNA3.1 (+) of the embodiment of the present invention 3;
Figure 10 A is the electrophorogram of the A34RoptIHD-J total length of the embodiment of the present invention 4;
Figure 10 B is the evaluation figure of the recombinant plasmid A34RoptIHD-J-pUC57 of the embodiment of the present invention 4;
Figure 11 is the sequencing result of the A34RoptIHD-J-pUC57 of the embodiment of the present invention 4.
Embodiment
The present invention utilizes bioinformatic analysis, by gene optimization algorithm and oligonucleotide sequence algorithm for design, obtains a series of oligonucleotide chains for extending, and these oligonucleotide chains are through being spliced to form DNA fragmentation.Described DNA fragmentation comprises that the splicing of multi-disc section and the method that carrier polysaccharase ring extends are cloned on the purpose carrier, the final target dna sequence of annular and the plasmid recombinant of carrier of forming further by several different methods.
Specifically comprise the following steps:
1. according to bioinformatic analysis, DNA sequence dna to be synthesized analyzed and optimized, obtain and design consistent target dna sequence;
2. according to target dna sequence, be designed for the oligonucleotide chain of extension;
3. synthesize and the described oligonucleotide chain of purifying;
4. described oligonucleotide chain synthetic in step 3 is spliced, form DNA fragmentation;
5. described DNA fragmentation is cloned into the plasmid recombinant that carrier obtains target dna sequence and carrier;
6. described plasmid recombinant is carried out sequencing analysis;
7. the correct described plasmid recombinant that checks order is carried out quality verification.
The method of described bioinformatic analysis is: use the gene design softwares such as gene work, collect bioinformatic data a large amount of and that high frequency is upgraded, wherein included from genetic transcription, translated nearly all known sequence factors that may affect protein expression level such as posttranslational modification, DNA sequence dna to be synthesized is carried out omnibearing analysis and optimization, comprise and adjust the base that consists of secondary structure, tumor-necrosis factor glycoproteins and high GC content in sequence; Optimizing codon is complementary gene to be synthesized and host's codon preference frequency and optimizes initiation site of protein translation etc.Aforesaid method has improved that gene in the past was high due to GC content in synthetic, secondary structure is complicated etc. to be difficult to check order or the problem such as synthetic gene transformation can not expressed in the host cell or expression amount is low, has finally greatly improved the protein expression level.
The method of design of described oligonucleotide chain for extending is as follows:
One, target dna sequence is called normal chain, the complementary strand of normal chain is called minus strand, is segmented into end to end DNA fragmentation;
Two, every segment DNA fragment is divided into again a plurality of oligonucleotide chains, the oligonucleotide chain that these oligonucleotide chains are adjacent with its left and right has the overlapping complementary sequence of head and the tail, from 5 of DNA fragmentation '-end begin oligonucleotide chain is numbered in order, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, and the quantity of the oligonucleotide chain in each DNA fragmentation is even number;
Three, 5 of target dna sequence '-oligonucleotide chain of last numbering of first DNA fragmentation of end 5 '-oligonucleotide chain of first numbering of second DNA fragmentation holding and be adjacent 5 '-end has overlapping complementary sequence, the like, between every two adjacent DNA fragmentations, overlapping complementary sequence is arranged;
Four, as requested be positioned at target dna sequence 5 '-oligonucleotide chain of end 5 '-end adds one section sequence, on this section sequence and carrier, the upstream sequence of target dna sequence insertion point is overlapping;
Five, be positioned at target dna sequence 3 '-oligonucleotide chain of end 5 '-end also adds one section sequence, the overlapping complementation of the downstream sequence of target dna sequence insertion point on this section sequence and carrier.
Its length of the DNA fragmentation that described segmentation obtains is between 20～20000 base pairs.
Described have its length of oligonucleotide chain of overlapping complementary sequence between 20～500 bases.
The length of the overlapping complementary sequence between the oligonucleotide chain that described each oligonucleotide chain is adjacent is between 10～50 bases.
Described be positioned at target dna sequence 5 '-oligonucleotide chain of end 5 '-end refer to target dna sequence 5 '-oligonucleotide chain of first numbering of first DNA fragmentation of end 5 '-end, namely 5 of target dna sequence '-end.
Described be positioned at target dna sequence 3 '-oligonucleotide chain of end 5 '-end refer to target dna sequence 5 '-oligonucleotide chain of last numbering of last DNA fragmentation of end 5 '-end, namely 3 of target dna sequence '-end.
Sequence described interpolation and that carrier has a homology is the DNA sequence dna of length between 0～100 base.
Described have the annealing temperature (Tm) of the oligonucleotide chain of overlapping complementary sequence between 30 ℃～70 ℃.
The method of design of above-mentioned oligonucleotide chain is one of core content that guarantees high success rate, high-throughput, high-speed, low-cost method for synthesizing gene, use the general DNA sequence dna design softwares such as gene work, make designed sequence have relatively uniform Tm value, simple secondary structure and can effectively avoid mispairing or wrong hybridization in certain length range.The oligonucleotide chain of designing like this uses identical annealing temperature when pcr amplification, simplified the experimental implementation step, has greatly improved the gene resultant velocity.All oligonucleotide chains all and corresponding overlapping complementary sequence arranged between the adjacent oligonucleotide chain in addition, pass through the regional complementary pairing of homology in the process of pcr amplification, can be by the long DNA fragmentation template of oligonucleotide chain formation, reduce the mispairing probability of amplification DNA long fragment, improved the success ratio of synthetic gene.
After described oligonucleotide chain designs, can utilize common oligonucleotide automatic DNA synthesizer DNA synthetic.The chemical synthesis process of existing existing oligonucleotide chain comprises: the phosphodiester method, phosphotriester method, the tris phosphite method, solid-phase synthesis, automatization method and up-to-date gene chips etc., described gene chips is the synthetic fresh approach of gene, what adopt at present is the in-situ synthesis of gene chip, refer to a plurality of oligonucleotide fragments directly are incorporated into the chip for preparing on the specific position of carrier with the mononucleotide substrate, comprise photochemistry gene chip synthesis method, physical method, mechanical means, microfluid method etc.But the method is many research and development and experimental stages of also being at present, and the gene fragment that synthesizes is also relatively short.Generally all adopt at present solid phase phosphoramidite triester method synthetic DNA fragment.
Described solid phase phosphoramidite triester method refer to 3 of the oligonucleotide chain that will will synthesize '-end first with 3 '-OH and a solid phase carrier; as connections such as Bio-Glas (CPG); then successively from 3 '-5 ' direction nucleotide monomer is added up; the active function groups of the nucleotide monomer that uses is all through overprotection; form at last with 3 ', 5 '-oligonucleotide fragment that phosphodiester bond couples together.
Described purifying refers to according to the composition of institute's synthetic oligonucleotide and should be used for the method for selected purifying, and purification process commonly used has: C18 post, OPC post, PAGE and HPLC.
(1) C18 column purification also is called simple and easy anti-phase column purification, and this is a kind of gac pillar, and it has specific absorption to DNA, can be by the organic solution wash-out, but can be by water elution, so desalination effectively.It can not effectively remove the small segment shorter than purpose fragment.
(2) OPC column purification, OPC purifying are to carry out the purification of target DNA fragmentation according to the principle of the avidity effect of interlaminar resin in DNA protecting group (DMT yl) and Cartridge post.The DNA purity of OPC method purifying is greater than 95%.Be applicable to the purifying of the following primer of 40mer.
(3) HPLC purifying is the principle of using high performance liquid chromatography, and DNA fragmentation is carried out purifying.Be according to the fragment of different sizes with net charge how much come separated product, purity can be greater than 99%.Be mainly used in the purifying of short chain and Mdification primer.The weakness of this method is that cost is higher, and batch production efficient is not high.
(4) PAGE purifying is to use denaturing polyacrylamide gel electrophoresis, and DNA fragmentation is separated, and then reclaims the method for target dna from gel.DNA purity after purifying is greater than 95%, and is effective especially to the purifying of long-chain Oligo DNA (greater than 50mer).
The splicing of described oligonucleotide chain comprises connection enzyme process and PCR method.
Described connection enzyme process is first oligonucleotide to be activated, with 5 of upper necessity '-phosphate group, then with corresponding complementary oligonucleotide fragment annealing, formation is with the double chain oligonucleotide fragment of sticky end, then with ligase enzyme, they is connected to each other to a large fragment of a complete gene or gene.Specifically comprise the following steps:
1. be designed for the oligonucleotide chain of extension, make the overlapping complementation of the adjacent oligonucleotide chain in every oligonucleotide chain and left and right, from 5 of DNA fragmentation '-end begin oligonucleotide chain is numbered, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, and the quantity of the oligonucleotide chain of every DNA fragmentation is all even number.
2. when the synthetic oligonucleotide chain, to 5 of each oligonucleotide chain '-end carries out phosphorylation, make it to be with 5 '-phosphate group.
3. the synthetic oligonucleotide chain with overlapping complementary sequence is according to number order, in the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide chain, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide, normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add resistant to elevated temperatures ligase enzyme to carry out splicing reaction.Reaction conditions is as follows:
94 ℃～96 ℃ sex change 2min～5min slowly anneal 30min to 30 ℃～60 ℃, hatch 30min～60min for 40 ℃～60 ℃.
4. get recovery product in step 3 as template, add the oligonucleotide chain at head and the tail two ends in DNA fragmentation as primer, add archaeal dna polymerase to carry out pcr amplification, finally obtain a large amount of DNA fragmentations.The pcr amplification condition is as follows:
94 ℃～96 ℃ denaturation 2min～5min carry out 1 circulation; Afterwards, 95 ℃ of sex change 15s～30s, Tm degree annealing 15s～30s, 72 ℃ are extended X min, carry out altogether 18～25 circulations; At last, 72 ℃ are extended 1min～7min.
Described resistant to elevated temperatures ligase enzyme refers to resistant to elevated temperatures Taq DNA ligase, T4 DNA ligase etc.;
Described Tm degree refers to determine annealing temperature according to the size of oligonucleotide chain Tm value, Tm=2 * (A+T)+4 * (G+C);
Described X refers to decide the extension time according to the size of DNA sequence dna, X=1min/3kb～1min/4kb;
Described archaeal dna polymerase refers to form the resistant to elevated temperatures archaeal dna polymerase of high-fidelity;
Described reaction system refers to effectively to bring into play the system of the resistant to elevated temperatures DNA polymerase activity of high-fidelity, and the cationic kind of adding by adjusting and concentration, the kind of additive and the pH of concentration and system etc. obtain.
That described PCR method refers to is complementary 3 with having '-oligonucleotide fragment of the length of end anneals each other, and the single stranded DNA that produces under the archaeal dna polymerase effect, synthesizes the process of corresponding complementary strand as template, specifically comprises the following steps:
With the synthetic oligonucleotide chain with overlapping complementary sequence according to number order, normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add archaeal dna polymerase to increase;
2. adopt the amplification of touchdown PCR (Touch Down PCR) method, reaction conditions is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, the 5s～90s that anneals under the annealing temperature Tm of oligonucleotide chain, 70 ℃ ~ 75 ℃ are extended X min, carry out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min;
3. the PCR product that obtains with step 2 reclaims as template, adds the oligonucleotide chain at head and the tail two ends in DNA fragmentation as primer, adds archaeal dna polymerase to carry out pcr amplification for the second time, finally obtains DNA fragmentation.As shorter in gene order, as about 1000bp, just can directly obtain goal gene through PCR does not for the first time need to carry out PCR for the second time.
In the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide chain, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide.Described archaeal dna polymerase refers to form the resistant to elevated temperatures archaeal dna polymerase of high-fidelity.Described reaction system refers to effectively to bring into play the system of the resistant to elevated temperatures DNA polymerase activity of high-fidelity, and the cationic kind of adding by adjusting and concentration, the kind of additive and the pH of concentration and system etc. obtain.
Described pcr amplification for the second time, reaction conditions is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, the 5s～90s that anneals under the annealing temperature Tm of oligonucleotide chain, 70 ℃～75 ℃ are extended X min, carry out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min.
Described Tm degree refers to determine annealing temperature according to the size of oligonucleotide chain Tm value, Tm=2 * (A+T)+4 * (G+C);
Described X refers to decide extension time, X=1min/3kb～1min/4kb according to the size of DNA sequence dna;
Described DNA fragmentation is cloned into the method that carrier obtains plasmid recombinant and generally includes connection method, PCR method and homologous recombination method.
Described connection method comprises following three kinds of methods:
First method is the connection of sticky end: distinguish DNA digestion fragment and carrier with the same restriction enzyme or with two kinds of restriction enzymes that can produce identical sticky end, form sticky end complimentary to one another, will have the DNA fragmentation of complementary sticky end and carrier with DNA ligase and couple together the formation recombinant chou.
Second method is directly the DNA fragmentation of flat end to be coupled together with the carrier of processing through flat end with ligase enzyme, or with 3 of the DNA fragmentation of blunt end '-end adds the tail of polynucleotide, add complementary tail on carrier, then with DNA ligase, they are coupled together.
The third method is first to add at the DNA fragmentation end after making it to form sticky end, then with DNA ligase, they to be coupled together linker or the joint of chemosynthesis.
Described PCR method refers to use the method for the primer with overlap, make the overlapping complementation in insertion point upstream and downstream of synthetic DNA fragmentation two ends and purpose carrier, afterwards DNA fragmentation is mixed with carrier, carry out the PCR reaction, form annular recombinant chou through DNA fragmentation after the circulation of sex change, annealing and extension and carrier.
Described homologous recombination method has the restructuring splicing of single fragment and carrier and the restructuring splicing of multi-disc section and carrier.
The splicing of described multi-disc section and carrier refers to multi-disc section interpolation and carrier polysaccharase ring extension method, comprises the following steps:
(1) the purpose carrier is carried out special processing, make it be inserted into the site linearizing;
(2) DNA fragmentation to be spliced is mixed with linearizing carrier, add recombinase, through all homology regional complementarities splicings after sex change and annealing, carry out ring-type and extend;
(3) sex change, annealing and extension can repeatedly move in circles, and finally obtain a large amount of target dna sequences and the recombinant plasmid of carrier.
The site linearization process that is inserted into of described carrier refers to use the method for digestion with restriction enzyme or PCR to obtain linearizing purpose carrier;
Described special recombinase refers to not have the archaeal dna polymerase of the high-fidelity of 5 '-3 ' excision enzyme function;
Described sex change, annealing and extension can repeatedly circulate different from PCR, owing to not introducing a large amount of primers, do not have the repeated amplification process, do not introduce sudden change.
Aforesaid method is that the polysaccharase ring extends the splicing method, and described method is completed the splicing of multi-disc section and insertion vector plasmid process in same reaction, greatly improved synthesis rate, and clone's success ratio is multiplied.
Described sequencing analysis refers to use general sequenator to carry out sequence verification to synthetic target dna sequence and the recombinant chou of carrier.If find to have the problems such as the sudden change of sequence or mispairing in the order-checking process, can return to PCR splicing step repairs targetedly to the zone at the place that suddenlys change, and do not need the complete sequence de novo synthesis, only have once in a while the reparation that suddenlys change of the synthetic needs of only a few but success ratio of the present invention is very high.
Described quality verification refers to that the correct recombinant plasmid that checks order is carried out experimental data check, sequencing result check, plasmid purification, enzyme cuts checking etc., and the gene that is synthesized to guarantee is correct, and recombinant construction is correct.
Below by specific embodiment, method of the present invention is described, but the present invention is not limited thereto.Gene building-up process schematic flow sheet of the present invention as Fig. 1; Fig. 2 is the synthetic oligonucleotide chain design diagram of gene of the present invention, A in Fig. 2 ~ C representation DNA fragment, 1 ~ 10 representative is for the oligonucleotide chain with overlapping complementary sequence of DNA fragmentation A design, wherein No. 15 '-end added one section with carrier on the overlap of upstream sequence homology of target dna sequence insertion point, No. 10 5 '-hold and to have added one section sequence with the adjacent overlapping complementation of DNA fragmentation B; Fig. 3 is that multi-disc section interpolation of the present invention and carrier polysaccharase ring extend the process schematic diagram.Experimental technique described in following embodiment if no special instructions, is ordinary method; Described reagent and material if no special instructions, all can obtain from commercial channels.
Embodiment 1:
The target synthetic product of the present embodiment is that length is the FucT2(helicobacter pylori fucosyltransferase B of 926 bases) gene order, and be connected on carrier pUC57.The Fuct2 gene contains high mutant nucleotide sequence (poly (C) and TAA repeats), incurs loss through delay mechanism by polysaccharase and can often move into or produce encoder block, expresses human carcinoembryonic antigen LewisY albumen.Synthetic FucT2 gene can be used for analysis and the research of anticancer aspect.
The gene building-up process of the present embodiment is as follows:
1. the DNA sequence dna after target dna sequence carries out sequential analysis and optimizes through gene design softwares such as information biology gene work is as follows:
5′-ACAGGTTGACGCTATGGCTTTTAAAGTGGTGCAAATTTGTGGGGGGCTTGGGAATCAAATGTTTCAATACGCTTTCGCTAAAAGTTTGCAAAAACACCTTAATACGCCCGTGCTATTAGACACTACTTCTTTTGATTGGAGCAATAGGAAAATGCAATTAGAGCTTTTCCCTATTGATTTGCCCTATGCGAATGCAAAAGAAATCGCTATAGCTAAAATGCAACATCTCCCCAAGTTAGTAAGAGATGCACTCAAATACATAGGATTTGATAGGGTGAGTCAAGAAATCGTTTTTGAATACGAGCCTAAATTGTTAAAGCCAAGCCGTTTGACTTATTTTTTTGGCTATTTCCAAGATCCACGATATTTTGATGCTATATCCTCTTTAATCAAGCAAACCTTCACTCTACCCCCCCCCCCCGAAAATAATAAAAATAATAATAAAAAAGAGGAAGAATACCAGCGCAAGCTTTCTTTGATTTTAGCCGCTAAAAACAGCGTATTTGTGCATATAAGAAGAGGGGATTATGTGGGGATTGGCTGTCAGCTTGGTATTGATTATCAAAAAAAGGCGCTTGAGTATATGGCAAAGCGCGTGCCAAACATGGAGCTTTTTGTGTTTTGCGAAGACTTAAAATTCACGCAAAATCTTGATCTTGGCTACCCTTTCACGGACATGACCACTAGGGATAAAGAAGAAGAGGCGTATTGGGATATGCTGCTCATGCAATCTTGCAAGCATGGCATTATCGCTAATAGCACTTATAGCTGGTGGGCGGCTTATTTGATGGAAAATCCAGAAAAAATCATTATTGGCCCCAAACACTGGCTTTTTGGGCATGAAAATATTCTTTGTAAGGAATGGGTGAAAATAGAATCCCATTTTGAGGTAAAATCCCAAAAATATAACGCTTAAGCGGCCGCGA-3′
Wherein the amount of four kinds of bases is respectively A:296, T:265, C:171 and G 194, GC content: GC%=39.42%.
2. the design of oligonucleotide chain is with synthetic
Design and synthesize for the oligonucleotide chain that extends according to target dna sequence, add protection bases G GAAC/GTTCC at the two ends of target dna sequence, to prevent the disappearance of first base when synthetic.Be connected on cloning vector pUC57 owing to only requiring, therefore can directly adopt flat end splicing method.Target dna sequence is shorter, only have 926 bases, the division that does not need to carry out fragment can directly be divided into the oligonucleotide chain with overlapping complementary sequence, has 32, the length of each oligonucleotide chain (oligonucleotide chain is called again primer) between 40bp ~ 50bp wherein is as follows:
| Numbering | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | GTGCTATTAGACACTACTTCTTTTGATTGGAGCAATAGGAAAATGCAATT |
| 6 | CATAGGGCAAATCAATAGGGAAAAGCTCTAATTGCATTTTCCTATTGCTC |
| 7 | CCCTATTGATTTGCCCTATGCGAATGCAAAAGAAATCGCTATAGCTAAAA |
| 8 | CTCTTACTAACTTGGGGAGATGTTGCATTTTAGCTATAGCGATTTCTTTT |
| 9 | |
| 10 | |
| 11 | AGTCAAGAAATCGTTTTTGAATACGAGCCTAAATTGTTAAAGCCAAGCCG |
| 12 | ATCTTGGAAATAGCCAAAAAAATAAGTCAAACGGCTTGGCTTTAACAATT |
| 13 | ATTTTTTTGGCTATTTCCAAGATCCACGATATTTTGATGCTATATCCTCT |
| 14 | GGTAGAGTGAAGGTTTGCTTGATTAAAGAGGATATAGCATCAAAATATCG |
| 15 | AGCAAACCTTCACTCTACCCCCCCCCCCCGAAAATAATAAAAAT |
| 16 | GCGCTGGTATTCTTCCTCTTTTTTATTATTATTTTTATTATTTTCG |
| 17 | GAGGAAGAATACCAGCGCAAGCTTTCTTTGATTTTAGCCGCTAAAAACAG |
| 18 | AATCCCCTCTTCTTATATGCACAAATACGCTGTTTTTAGCGGCTAAAATC |
| 19 | TGCATATAAGAAGAGGGGATTATGTGGGGATTGGCTGTCAGCTTGGTATT |
| 20 | GCCATATACTCAAGCGCCTTTTTTTGATAATCAATACCAAGCTGACAGCC |
| 21 | GGCGCTTGAGTATATGGCAAAGCGCGTGCCAAACATGGAGCTTTTTGTGT |
| 22 | GATTTTGCGTGAATTTTAAGTCTTCGCAAAACACAAAAAGCTCCATGTTT |
| 23 | GACTTAAAATTCACGCAAAATCTTGATCTTGGCTACCCTTTCACGGACAT |
| 24 | AATACGCCTCTTCTTCTTTATCCCTAGTGGTCATGTCCGTGAAAGGGTAG |
| 25 | GATAAAGAAGAAGAGGCGTATTGGGATATGCTGCTCATGCAATCTTGCAA |
| 26 | AGCTATAAGTGCTATTAGCGATAATGCCATGCTTGCAAGATTGCATGAGC |
| 27 | TCGCTAATAGCACTTATAGCTGGTGGGCGGCTTATTTGATGGAAAATCCA |
| 28 | AGTGTTTGGGGCCAATAATGATTTTTTCTGGATTTTCCATCAAATAAGCC |
| 29 | TTATTGGCCCCAAACACTGGCTTTTTGGGCATGAAAATATTCTTTGTAAG |
| 30 | AAAATGGGATTCTATTTTCACCCATTCCTTACAAAGAATATTTTCATGCC |
| 31 | GGTGAAAATAGAATCCCATTTTGAGGTAAAATCCCAAAAATATAACGCTT |
| 32 | GGAACTCGCGGCCGCTTAAGCGTTATATTTTTGGGATTTT |
3.PCR splicing
Due to target dna sequence shorter (＜1000bp) adopt a PCR reaction can complete splicing.
PCR splicing reaction system is as follows:
Working fluid I (H
2O:860ul, dNTP (10mM): 30ul, 5 * Buffer:300ul): 40ul, primer mixture (250ul H
2In O, every primer adds 3ul, and wherein the head and the tail primer adds 6ul): 10ul, pfu polysaccharase (GENEWIZ, 2.5U/ul): 0.5ul mixing.
PCR splicing reaction condition:
As shown in Fig. 4 A, be oligonucleotide chain PCR splicing electrophorogram, wherein 1 is Marker DS5000; 2 is that No. 1 PCR to No. 32 oligonucleotide chains splices result.Goal gene FucT2 total length 926bp, this figure explanation has obtained required goal gene by the PCR splicing of oligonucleotide chain.
4. gene clone is to the vector construction recombinant chou
Because the pfu archaeal dna polymerase is flat end polysaccharase, therefore adopt flat end splicing method: first use the EcoR V to carry out enzyme carrier pUC57 and cut processing, then DNA fragmentation is mixed with carrier.Endonuclease reaction system and reaction conditions are as follows: pUC57 (300ng): 1.5ul, 10 * Buffer:5ul, EcoR V: 1ul, H2O:42.5ul.The ligation system is reaction conditions: 2 * Buffer:10ul, DNA fragmentation: 7ul, pUC57(4ng): 2ul, T4 DNA ligase (Fermentas, 1000U 1000CEU/ul): 1ul; 22 ℃, 30min.
5. detect
To link product changes intestinal bacteria over to and carries out the screening of blue hickie, selecting mono-clonal hickie bacterium colony checks order, find that 4 all order-checking bacterial strains all contain right-on target dna sequence, recombinant plasmid FucT2-pUC57 enzyme is cut the checking electrophoresis result as shown in Figure 4 B, be target dna sequence and the restriction enzyme MluI of vectored recombinant use and the double digestion electrophorogram of AscI, wherein 1 is vehicle Control, and 2 cut the result for enzyme, and 3 is Marker DS10000.Synthetic and target gene recombinant chou that build is correct as can be known by Fig. 4 B.Sequencing result is seen Fig. 7.
The target synthetic product of the present embodiment is phosphatidyl inositol kinase (PI3K) catalytic subunit P110-alpha, and mrna length is the sequence of 3230 bases, and is connected on carrier pLVX-Tight-puro by 5 ' BamHI and 3 ' NotI restriction enzyme site.The catalytic subunit of P110-alpha phosphatidyl inositol kinase (PI3K) is expressed the important component promotor c-fos that p110-alpha albumen can fully activate sero-reaction in Chinese hamster ovary celI.The recombinant chou that builds will be for the transfection yeast cell, the effect of analyzing proteins P110-alpha.
The gene building-up process of the present embodiment is as follows:
1. the DNA sequence dna after target sequence carries out sequential analysis and optimizes through gene design softwares such as information biology gene work is as follows:
5′-GGATCCGCCGCCACCATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATCCTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAACTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACCCAAGAAGCAGAAAGGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAAGTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCTATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGAAGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCACATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCAAATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTAATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAACTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATACTTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGGAGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTCTATTCTCAACTGCCAATGGACTGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGAGAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGTGCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATCTACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGACTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGACAATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACTATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTAGCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAACTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAAAAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAATATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAATCAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTTAGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAGCACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAACAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGGCGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAACTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGGTTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATCTTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATGGAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCAATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATTCAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGGCTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGAAAGACGATGGACAGCTGTTTCATATAGATTTTGGACACTTTTTGGATCACAAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTCTTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTTCAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAATCTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCATACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCACACAATTAAACAGCATGCATTGAACTGAGCGGCCGC-3′
Wherein four kinds of bases and quantity are respectively A:1045, T:909, C:598 and G 678, GC content: GC%=39.5%
2. the design of oligonucleotide chain is with synthetic
Design and synthesize for the oligonucleotide chain that extends according to target dna sequence.
(1) target dna sequence is divided into two DNA fragmentations: P110-alpha-A(1123bp) and P110-alpha-B(2153bp).
The sequence of P110-alpha-A is as follows:
5′-GGATCCGCCGCCACCATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATCCTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAACTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACCCAAGAAGCAGAAAGGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAAGTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCTATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGAAGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCACATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCAAATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTAATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAACTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATACTTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGGAGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTCTATTCTCAACTGCCAATGGACTGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGAGAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGTGCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATCTACCATGGAGGAGAACCCTTATGTGACA-3′
The sequence of P110-alpha-B is as follows:
5′-TATGTTCGAACAGGTATCTACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGACTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGACAATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACTATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTAGCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAACTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAAAAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAATATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAATCAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTTAGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAGCACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAACAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGGCGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAACTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGGTTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATCTTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATGGAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCAATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATTCAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGGCTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCATGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAACATCATGGTGAAAGACGATGGACAGCTGTTTCATATAGATTTTGGACACTTTTTGGATCACAAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTCTTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTTCAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAATCTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCATACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCACACAATTAAACAGCATGCATTGAACTGAGCGGCCGC-3′
2. go out 40 sections oligonucleotide chains with overlapping complementary sequence according to the P110-alpha-A sequences Design, the length of every section is between 30-50bp.Numbering and sequence are as follows:
| Numbering | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | CTTTAGAATGCCTCCGTGAGGCTACATTAATAACCATAAAGCATGAACTA |
| 6 | GGGGGTATTTTCTTGCTTCTTTAAATAGTTCATGCTTTATGGTTATTAAT |
| 7 | AGAAGCAAGAAAATACCCCCTCCATCAACTTCTTCAAGATGAATCTTCTT |
| 8 | TTCTTGGGTAACACTTACGAAAATGTAAGAAGATTCATCTTGAAGAAGTT |
| 9 | |
| 10 | |
| 11 | TTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAAGTAATTGAACCAGTA |
| 12 | GAGGATCTTTTCTTCACGGTTGCCTACTGGTTCAATTACTTTTAAAAAGG |
| 13 | ACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCTATCGGCATG |
| 14 | GGATCTTTAACCATATCAAATTCACACACTGGCATGCCGATAGCAAAACC |
| 15 | GTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGAAGAAAT |
| 16 | TCCACAGCTTCTTTACAAACGTTCAGAATATTTCTTCGGAAGTCCTGTAC |
| 17 | GTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCATAGTAG |
| 18 | TACATTTGGAGGATAGACATACATTGCTCTACTATGAGGTGAATTGAGGT |
| 19 | TGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC |
| 20 | ATTATTTGCCCTTTATCTAATTTATTATATATGTGCTTTGGCAATTCTGG |
| 21 | TATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGT |
| 22 | GTATACTTCTGCTTGTCATTATTTGGAGAAACTATTACCCAGATCACCAC |
| 23 | CAAATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTA |
| 24 | TGATTGCTTCAGCAATTACTTGTTCTGGTACACAGTCATGGTTGATTTTC |
| 25 | AAGTAATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCC |
| 26 | TCTAAAACACAGAGTTTTAGTTGTTCAGAGGATAGCAACATACTTCGAGT |
| 27 | ACAACTAAAACTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAG |
| 28 | AGGAAGTATTCATCACATCCACACACTTTTAAAATATACTTGCCCTGATA |
| 29 | TGGATGTGATGAATACTTCCTAGAAAAATATCCTCTGAGTCAGTATAAGT |
| 30 | CCCAAGCATTATACAGCTTCTTATATACTTATACTGACTCAGAGGATATT |
| 31 | GAAGCTGTATAATGCTTGGGAGGATGCCCAATTTGATGTTGATGGCTAAA |
| 32 | CCATTGGCAGTTGAGAATAGAGGCTTTCTTTAGCCATCAACATCAAATTG |
| 33 | CTATTCTCAACTGCCAATGGACTGTTTTACAATGCCATCTTATTCCAGAC |
| 34 | ATTCATATATGGTGTAGCTGTGGAAATGCGTCTGGAATAAGATGGCATTG |
| 35 | CACAGCTACACCATATATGAATGGAGAAACATCTACAAAATCCCTTTGGG |
| 36 | AATTTTTATTCTGAGTGCACTATTTATAACCCAAAGGGATTTTGTAGATG |
| 37 | AAATAGTGCACTCAGAATAAAAATTCTTTGTGCAACCTACGTGAATGTAA |
| 38 | GAACATAGATCTTATCAATGTCTCGAATATTTACATTCACGTAGGTTGCA |
| 39 | GAGACATTGATAAGATCTATGTTCGAACAGGTATCTACCATGGAGGAGAA |
| 40 | TGTCACATAAGGGTTCTCCTCCATGGTAGATAC |
Wherein 5 of No. 1 oligonucleotide chain ' end has the BamHI restriction enzyme site GGATCC of requirement, and is added with protection bases G GAAC before restriction enzyme site; No. 1 oligonucleotide interchain of No. 40 oligonucleotide chains and P110-alpha-B has overlapping complementary sequence, and sequence is as follows:
5′-TATGTTCGAACAGGTATCTACCATGGAGGAG -3′
Go out 76 sections oligonucleotide chains with overlapping complementary sequence according to the P110-alpha-B sequences Design, the length of every section is between 40-50bp.Numbering and sequence are as follows:
| Numbering | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | GCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTT |
| 6 | CCTTTCGGCCTTTAACAGAGCAAATGGAAAGGCAAAGTCGAGCAGCACGA |
| 7 | CTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCAT |
| 8 | TCTGTGTAATCAAACAAGTTTATATTTCCCCATGCCAATGGACAGTGTTC |
| 9 | |
| 10 | |
| 11 | CTTTGGCCAGTACCTCATGGACTAGAAGATTTGCTGAACCCTATTGGTGT |
| 12 | TGGAGTTTCTTTATTTGGATTTGATCCAGTAACACCAATAGGGTTCAGCA |
| 13 | ATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGT |
| 14 | CATATCTGGGAACTTTACCACACTGCTGAACCAGTCAAACTCCAACTCTA |
| 15 | TGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGT |
| 16 | GAATAGCTAAATCCTGCTTCTCGGGATACAGACCAATTGGCATGCTCTTC |
| 17 | GAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCT |
| 18 | TTGTCATTTTCCCTTAATTCATTGTCTCTAGCTAGTCTGTTACTCAGTCC |
| 19 | CAATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACAC |
| 20 | CTGCTCAGTGATTTCAGAGAGAGGATCTCGTGTAGAAATTGCTTTGAGCT |
| 21 | CTCTCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACA |
| 22 | TAGAATTTCGGGGATAGTTACACAATAGTGTCTGTGACTCCATAGAAAAT |
| 23 | GTGTAACTATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGG |
| 24 | ACATCTGGGCTACTTCATCTCTAGAATTCCATTTAACAGACAGAAGCAAT |
| 25 | AGATGAAGTAGCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCA |
| 26 | GTCCAGAAGTTCCATAGCCTGTTCAGGTTTGATTGGAGGCCAATCTTTTA |
| 27 | AGGCTATGGAACTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGT |
| 28 | TAAATATTTTTCCAAGCACCGAACAGCAAAACCTCGAACCATAGGATCTG |
| 29 | TTCGGTGCTTGGAAAAATATTTAACAGATGACAAACTTTCTCAGTATTTA |
| 30 | ATTTTAGGACCTGTACTAGCTGAATTAAATACTGAGAAAGTTTGTCATCT |
| 31 | CAGCTAGTACAGGTCCTAAAATATGAACAATATTTGGATAACTTGCTTGT |
| 32 | TCAATGCTTTCTTCAGTAAAAATCTCACAAGCAAGTTATCCAAATATTGT |
| 33 | AGATTTTTACTGAAGAAAGCATTGACTAATCAAAGGATTGGGCACTTTTT |
| 34 | TTGTGCATCTCAGATTTTAAATGCCAAAAGAAAAAGTGCCCAATCCTTTG |
| 35 | CATTTAAAATCTGAGATGCACAATAAAACAGTTAGCCAGAGGTTTGGCCT |
| 36 | CATCCCACATGCACGACAATAGGACTCCAAAAGCAGGCCAAACCTCTGGC |
| 37 | TGTCGTGCATGTGGGATGTATTTGAAGCACCTGAATAGGCAAGTCGAGGC |
| 38 | AATGTCAGTTAAGTTAATGAGCTTTTCCATTGCCTCGACTTGCCTATTCA |
| 39 | AAAGCTCATTAACTTAACTGACATTCTCAAACAGGAGAAGAAGGATGAAA |
| 40 | ACTAAAAACTTCATCTGTACCTTTTGTGTTTCATCCTTCTTCTCCTGTTT |
| 41 | AAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGGCGACCAGATTTC |
| 42 | AGGAGACAGAAAGCCCTGTAGAGCATCCATGAAATCTGGTCGCCTCATTT |
| 43 | CAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAACTAGGAAACCTCAG |
| 44 | CAGAGGACATAATTCGACACTCTTCAAGCCTGAGGTTTCCTAGTTGATGA |
| 45 | AGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGGTTGAATTGGGAG |
| 46 | AAACAGTAACTCTGACATGATGTCTGGGTTCTCCCAATTCAACCACAGTG |
| 47 | ACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATCTTTAAAAAT |
| 48 | CATATCTTGCCGTAAATCATCCCCATTTTTAAAGATGATCTCATTGTTCT |
| 49 | GGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATGG |
| 50 | AGACCTTGATTTTGCCAGATATTTTCCATAATACGAATAATTTGAAGTGT |
| 51 | TATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTC |
| 52 | ATAAGTCCCACACAGTCACCGATTGACAGACAACCATAAGGTAACATTCG |
| 53 | GGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTAT |
| 54 | TTCAAGCCGCCTTTGCACTGAATTTGCATAATAGTGTGAGAATTTCGCAC |
| 55 | GCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACAT |
| 56 | TTTCTCCTTTGTTCTTGTCTTTGAGCCACTGATGTAGTGTGTGGCTGTTG |
| 57 | CAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTA |
| 58 | GTAGCTACACAGTATCCAGCACATGAACGTGTAAACAGGTCAATGGCTGC |
| 59 | GCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAA |
| 60 | TGTCCATCGTCTTTCACCATGATGTTACTATTGTGACGATCTCCAATTCC |
| 61 | TGGTGAAAGACGATGGACAGCTGTTTCATATAGATTTTGGACACTTTTTG |
| 62 | AACCAAATTTTTTCTTCTTGTGATCCAAAAAGTGTCCAAAATCTATATGA |
| 63 | GATCACAAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGT |
| 64 | ACTAATCACTATTAAGAAATCCTGTGTCAAAACAAATGGCACACGTTCTC |
| 65 | ACAGGATTTCTTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGA |
| 66 | CACATCTCCTGAAACCTCTCAAATTCTCTTGTCTTTGTGCATTCTTGGGC |
| 67 | GAGAGGTTTCAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCA |
| 68 | TGAGAAAAGATTTATGAAGAGATTGGCATGCTGTCGAATAGCTAGATAAG |
| 69 | |
| 70 | AATGTATGCAATGTCATCAAAAGATTGTAGTTCTGGCATTCCAGAGCCAA |
| 71 | TCTTTTGATGACATTGCATACATTCGAAAGACCCTAGCCTTAGATAAAAC |
| 72 | ATGAAATACTCCAAAGCCTCTTGCTCAGTTTTATCTAAGGCTAGGGTCTT |
| 73 | AGAGGCTTTGGAGTATTTCATGAAACAAATGAATGATGCACATCATGGTG |
| 74 | GGAAGATCCAATCCATTTTTGTTGTCCAGCCACCATGATGTGCATCATTC |
| 75 | ACAAAAATGGATTGGATCTTCCACACAATTAAACAGCATGCATTGAACTG |
| 76 | GGAACGCGGCCGCTCAGTTCAATGCATGCTGTTTA |
Wherein contain the overlapping complementary sequence with P110-alpha-A in No. 1 oligonucleotide chain, 5 of No. 76 oligonucleotide chains ' end is connected with the NotI restriction enzyme site GCGGCCGC of requirement, and has added protection bases G GAAC before restriction enzyme site.
3.PCR splicing
First P110-alpha-A and these two DNA fragmentations of P110-alpha-B are spliced respectively, again they are stitched together afterwards.
(1) splicing of P110-alpha-A is divided into two groups with 40 oligonucleotide chains, and the oligonucleotide chain of numbering No. 1-22 is first group, and the oligonucleotide chain of No. 21-40 is second group.
PCR splicing reaction system:
Working fluid I: 40ul, primer mixture: 10ul, pfu polysaccharase (GENEWIZ, 2.5U/ul): 0.5ul mixing.
PCR splicing reaction condition:
As shown in Fig. 5 A, be the PCR splicing electrophorogram of two groups of oligonucleotide chains of P110-alpha-A, the length of two groups of oligonucleotide chains DNA fragmentation that splicing obtains through PCR of P110-alpha-A is correct as can be known by Fig. 5 A.Wherein 1 is the PCR splicing result of No. 40 oligonucleotide chain combinations of 21-; 2 is the PCR splicing result of 1-22 oligonucleotide chain; 3 is Marker DS5000.
Reclaim the PCR product, add No. 1 take two groups of products reclaiming as template and No. 40 oligonucleotide chains carry out for the second time as primer that PCR splices, to obtain the complete sequence of P110-alpha-A.
PCR splicing reaction system is as follows for the second time:
Working fluid II (H
2O:1100ul, dNTP(10mM): 30ul, 5 * Buffer:300ul) 95ul, each 1ul of upstream and downstream primer, each 1ul of template, pfu polysaccharase (2.5U/ul) 1ul mixing.
PCR splicing reaction condition:
。
As shown in Fig. 5 B, be spliced into the electrophorogram of total length for two groups of oligonucleotide chains of P110-alpha-A, again Fig. 5 B as can be known, correct through the P110-alpha-A sequence length that obtains after the splicing of PCR for the second time.Wherein 1 for splicing the P110-alpha-A that obtains; 2 is Marker DS5000.
(1) splicing of P110-alpha-B, 76 oligonucleotide chains are divided into three groups: first group: No. 1-26, second group No. 25-50, and the 3rd group No. 49-76, the mixed pcr amplification that carries out of the oligonucleotide chain of each group is spliced, carry out again PCR splicing for the second time take amplification product out as template, obtain at last the total length of P110-alpha-B, reaction system is identical with P110-alpha-A with condition, the PCR product gel electrophoresis result of P110-alpha-B total length is seen Fig. 5 C, by Fig. 5 C as can be known, the P110-alpha-B sequence length that obtains is correct.Wherein 1 for splicing the P110-alpha-B that obtains; 2 is Marker DS5000.
(2) gene P110-alpha's is synthetic, the P110-alpha-A that obtains in step (1) and (2) and two fragments of P110-alpha-B are as template, carry out pcr amplification take No. 76 oligonucleotide chains of No. 1 oligonucleotide chain of P110-alpha-A and P110-alpha-B as primer.Reaction system: working fluid II: 95ul, each 1ul of upstream and downstream primer, each 1ul of template, pfu polysaccharase (2.5U/ul) 1ul mixing.
Reaction conditions is as follows:
As shown in Fig. 5 D, for P110-alpha-A and P110-alpha-B carry out the gel electrophoresis figure that the PCR splicing obtains the P110-alpha total length.The 1 P110-alpha total length that obtains for PCR splicing wherein; 2 is Marker DS5000.
4. gene clone is to the vector construction recombinant chou
(1) the P110-alpha sequence that splices is connected to carries out sequence verification on cloning vector pUC57, linked system and condition are identical with embodiment 1;
(2) check order correct sequence and destination carrier pLVX-Tight-puro are used BamHI and NotI double digestion simultaneously, reclaim enzyme and cut product, carry out ligation under the effect of T4 DNA ligase.
Enzyme is cut system and reaction conditions: carrier: 1.5ul(600-700ng), and 10 * Buffer:5ul, BamHI:1ul, NotI:1ul, H
2O:41.5ul, 37 ℃, 30min.
Linked system and condition: carrier pLVX-Tight-puro:2ul(10-20ng), fragment P110-alpha:7ul, 2 * Buffer:10ul, T4 DNA ligase: 1ul, 22 ℃, 30min.
To link product and be transformed in intestinal bacteria TOP10F ' competent cell, select the mono-clonal bacterium colony, upgrading grain screening P110-alpha-pLVX-Tight-puro recombinant chou.
5. detect
The recombinant chou P110-alpha-pLVX-Tight-puro that filters out is carried out sequence verification, result proof sequence is entirely true, enzyme is cut proof diagram as shown in Fig. 5 E, for using restriction enzyme BamHI and NotI to carry out to recombinant plasmid the electrophorogram that enzyme is cut checking, wherein 1 is recombinant plasmid P110-alpha-pLVX-Tight-puro contrast; 2 is BamHI and NotI double digestion result; 3 is Marker DS5000.By Fig. 5 E as can be known, the sequence that synthesizes is target dna sequence just.Sequencing result is seen Fig. 8.
The target synthetic product behaviour sodium-ion channel albumen humanNaV15_6AhH1 gene of the present embodiment, length is 6,074 bp, and is connected on carrier pcDNA3.1 (+) by restriction enzyme site 5 ' NheI and 3 ' NotI.HumanNaV15_6AhH1 is the transmembrane channel albumen of expressing in various muscle cells, and the recombinant chou of structure is used for the function of transfectional cell analyzing proteins humanNaV15_6AhH1.
The gene building-up process of the present embodiment is as follows:
2. the DNA sequence dna after target sequence carries out sequential analysis and optimizes through gene design softwares such as information biology gene work is as follows:
5′-GCTAGCGCCACCATGGCAAACTTCCTCCTCCCTCGGGGCACATCTTCTTTTCGGCGGTTCACTAGAGAGTCACTGGCTGCTATCGAGAAACGGATGGCTGAGAAACAGGCTAGAGGCTCCACAACACTCCAGGAGTCTAGAGAGGGCCTGCCTGAGGAGGAGGCCCCTAGACCTCAGCTGGATCTCCAGGCCTCAAAAAAACTGCCCGACCTGTACGGAAACCCACCACAGGAACTCATTGGCGAACCTCTCGAGGATCTGGACCCTTTCTACTCTACCCAGAAAACCTTCATCGTGCTGAACAAGGGCAAAACCATCTTTCGGTTCTCCGCTACCAACGCTCTGTACGTGCTGTCTCCATTCCACCCCATTAGGAGAGCTGCCGTCAAAATTCTGGTCCACTCCCTGTTCAATATGCTCATCATGTGTACTATCCTCACAAACTGTGTGTTCATGGCCCAGCATGATCCACCTCCATGGACAAAATACGTGGAGTACACTTTCACCGCCATCTACACATTTGAGTCCCTGGTGAAAATTCTCGCTCGGGGATTCTGTCTCCATGCCTTCACCTTTCTCCGGGATCCTTGGAATTGGCTGGACTTCTCCGTCATTATTATGGCCTACACCACCGAATTTGTCGATCTCGGCAACGTGTCTGCTCTGAGAACATTCCGAGTGCTGAGAGCCCTGAAAACAATCTCCGTGATCTCCGGGCTGAAAACAATTGTCGGCGCCCTGATTCAGAGTGTGAAAAAACTCGCCGATGTGATGGTGCTCACCGTGTTCTGCCTGTCTGTGTTTGCTCTCATTGGACTCCAGCTCTTCATGGGCAACCTGAGACACAAGTGTGTCCGGAATTTCACTGCCCTCAATGGCACCAATGGATCTGTCGAGGCCGATGGACTGGTCTGGGAATCTCTGGATCTGTACCTGAGCGATCCTGAAAATTACCTGCTGAAAAACGGAACATCCGACGTCCTGCTGTGTGGCAACTCTTCCGATGCCGGAACTTGTCCTGAGGGATACCGGTGTCTGAAAGCCGGGGAAAATCCTGACCACGGCTACACCTCATTCGATTCTTTCGCTTGGGCATTCCTGGCTCTGTTTCGGCTCATGACACAGGACTGTTGGGAACGGCTGTACCAGCAGACTCTGAGGAGTGCTGGCAAAATCTACATGATTTTCTTTATGCTCGTGATCTTCCTGGGATCTTTCTACCTCGTGAATCTCATTCTGGCTGTCGTGGCTATGGCTTACGAGGAACAGAATCAGGCCACAATTGCCGAAACTGAGGAAAAGGAGAAACGGTTCCAGGAAGCCATGGAAATGCTCAAAAAGGAGCATGAGGCACTCACCATTAGAGGAGTCGATACTGTGAGTCGGTCATCACTGGAAATGAGCCCTCTGGCTCCTGTGAATTCCCACGAACGACGGTCTAAACGGCGAAAACGAATGTCATCTGGGACCGAGGAATGTGGAGAGGATCGACTGCCCAAATCCGATAGCGAGGACGGACCTCGAGCAATGAATCACCTGTCCCTCACCCGGGGACTGTCTCGAACTTCTATGAAACCTCGGAGTAGTAGGGGATCAATCTTCACTTTCCGACGGCGGGACCTGGGCTCTGAGGCCGACTTTGCCGATGACGAAAACTCTACTGCCGGCGAATCTGAGTCTCATCATACTAGCCTGCTGGTGCCTTGGCCACTGAGGCGAACATCCGCCCAGGGGCAGCCTAGTCCCGGCACTAGTGCTCCCGGACATGCCCTCCACGGCAAAAAAAACTCCACCGTGGACTGTAATGGAGTCGTGTCACTGCTGGGAGCTGGCGATCCCGAGGCAACTTCCCCTGGATCTCATCTGCTGAGGCCCGTGATGCTGGAGCATCCTCCCGATACAACAACCCCATCCGAGGAGCCTGGCGGACCACAGATGCTCACATCTCAGGCCCCATGTGTGGACGGCTTTGAGGAACCCGGCGCTCGCCAGAGAGCACTCTCTGCTGTCTCCGTGCTCACTTCTGCTCTGGAGGAACTCGAAGAAAGCAGACATAAGTGCCCTCCATGTTGGAATCGACTGGCTCAGAGATACCTCATTTGGGAATGCTGTCCTCTGTGGATGTCCATCAAACAGGGCGTCAAACTGGTGGTGATGGATCCTTTTACCGACCTCACCATTACCATGTGTATCGTCCTCAACACCCTCTTTATGGCCCTCGAACACTACAATATGACTAGCGAATTTGAGGAGATGCTCCAGGTCGGGAATCTGGTGTTTACCGGAATCTTTACCGCTGAAATGACCTTCAAAATCATTGCCCTGGACCCATACTACTACTTCCAGCAGGGCTGGAACATTTTCGACTCTATCATCGTGATCCTGTCACTCATGGAACTGGGCCTGTCACGGATGAGTAATCTGTCTGTGCTGAGGAGCTTTAGACTGCTCCGAGTGTTCAAACTGGCCAAATCTTGGCCTACCCTGAATACCCTCATCAAAATCATCGGGAACTCCGTGGGGGCTCTGGGAAATCTCACACTGGTGCTGGCCATTATCGTCTTCATCTTTGCCGTGGTCGGAATGCAGCTGTTTGGAAAAAACTACTCTGAACTCCGGGATAGCGATTCTGGACTGCTCCCTCGGTGGCATATGATGGATTTCTTCCACGCCTTCCTCATCATTTTCCGGATCCTGTGTGGCGAATGGATCGAGACAATGTGGGACTGTATGGAGGTGTCCGGACAGTCTCTGTGTCTGCTGGTGTTTCTCCTGGTCATGGTGATTGGGAACCTGGTCGTGCTGAACCTGTTTCTGGCTCTGCTCCTCTCTTCTTTCTCTGCCGACAACCTCACTGCTCCCGACGAGGATAGAGAGATGAATAACCTCCAGCTCGCCCTGGCTAGAATCCAGAGGGGACTCCGATTCGTCAAACGAACAACTTGGGACTTCTGCTGTGGGCTGCTGAGACAGCGACCTCAGAAACCTGCTGCTCTGGCCGCTCAGGGACAGCTCCCATCTTGTATTGCCACTCCCTACTCACCCCCTCCACCTGAAACCGAAAAAGTGCCCCCAACACGAAAGGAAACTCGCTTTGAGGAGGGCGAACAGCCTGGACAGGGAACACCTGGAGATCCTGAACCTGTGTGTGTGCCTATTGCTGTGGCTGAATCCGATACCGATGATCAGGAGGAGGACGAGGAGAATTCTCTGGGCACTGAGGAGGAATCCTCTAAACAGGAGTCACAGCCTGTCTCTGGGGGACCTGAAGCTCCACCCGATAGTAGAACATGGTCCCAGGTGTCCGCTACTGCTTCTTCCGAGGCTGAGGCTTCTGCCTCTCAGGCCGATTGGAGGCAGCAGTGGAAAGCCGAACCACAGGCCCCTGGATGTGGGGAAACTCCTGAGGACTCTTGCTCTGAGGGATCAACTGCCGATATGACAAACACCGCCGAACTGCTGGAGCAGATTCCCGATCTCGGCCAGGACGTGAAAGATCCTGAGGATTGCTTCACTGAGGGCTGTGTGCGGCGGTGCCCTTGCTGCGCTGTCGATACCACTCAGGCACCCGGGAAAGTGTGGTGGCGACTGAGAAAAACTTGCTACCATATTGTGGAACACTCATGGTTTGAGACTTTCATCATCTTCATGATTCTGCTGAGTTCTGGAGCACTGGCCTTCGAGGACATCTACCTGGAGGAACGGAAAACAATCAAAGTCCTGCTCGAGTACGCCGACAAAATGTTCACCTACGTCTTTGTGCTGGAAATGCTGCTGAAATGGGTGGCCTACGGCTTCAAAAAATACTTCACCAACGCCTGGTGCTGGCTCGATTTCCTCATCGTGGATGTGTCTCTCGTGTCACTGGTGGCCAATACTCTGGGATTTGCCGAAATGGGCCCCATCAAATCACTCCGAACACTGAGGGCTCTCCGGCCTCTCCGGGCTCTGTCACGCTTTGAGGGCATGAGAGTGGTGGTGAATGCTCTCGTGGGCGCTATTCCTTCTATTATGAACGTGCTGCTGGTCTGTCTCATCTTTTGGCTCATCTTTAGCATCATGGGCGTGAATCTCTTCGCTGGGAAATTTGGGCGCTGTATCAACCAGACTGAGGGAGATCTGCCACTGAATTACACCATCGTGAATAACAAATCACAGTGTGAATCCCTCAATCTCACCGGAGAACTGTACTGGACCAAAGTCAAAGTGAACTTCGACAATGTCGGAGCCGGCTACCTGGCTCTGCTCCAGGTGGCAACCTTTAAGGGATGGATGGATATCATGTACGCCGCTGTGGATAGTCGAGGCTACGAGGAACAGCCACAGTGGGAGTACAATCTCTACATGTACATCTACTTCGTCATTTTCATCATTTTCGGATCTTTCTTCACCCTCAACCTCTTCATTGGCGTCATCATCGACAACTTCAACCAGCAGAAAAAAAAGCTGGGAGGCCAGGACATCTTTATGACCGAGGAACAGAAAAAATACTACAATGCCATGAAAAAACTCGGCTCCAAAAAACCCCAGAAACCCATCCCTAGACCCCTGAACAAATACCAGGGCTTCATTTTCGACATCGTGACCAAACAGGCCTTCGACGTGACTATCATGTTTCTCATCTGCCTGAATATGGTGACCATGATGGTGGAAACCGACGATCAGTCTCCTGAAAAAATCAACATCCTCGCCAAAATCAATCTGCTCTTCGTGGCCATTTTTACCGGCGAGTGTATTGTGAAACTGGCTGCTCTGAGACACTACTACTTTACCAACTCTTGGAACATCTTCGACTTTGTGGTGGTGATCCTGTCTATTGTGGGAACTGTGCTCTCCGATATCATCCAGAAATACTTCTTCTCCCCTACCCTCTTTAGAGTCATCCGGCTGGCTAGAATTGGACGGATTCTGAGGCTCATTCGAGGCGCTAAGGGAATTCGAACACTGCTCTTTGCCCTCATGATGTCTCTGCCTGCCCTGTTCAATATTGGCCTGCTGCTCTTTCTCGTGATGTTCATCTACTCCATCTTCGGCATGGCCAATTTCGCTTACGTGAAATGGGAGGCTGGAATCGACGACATGTTCAACTTCCAGACCTTCGCCAACTCTATGCTGTGTCTGTTTCAGATCACTACTAGTGCTGGCTGGGACGGACTGCTGTCTCCTATCCTCAATACCGGACCCCCTTACTGTGACCCTACACTGCCCAACTCAAACGGCTCTAGAGGCGATTGTGGGAGTCCCGCTGTGGGGATTCTCTTCTTTACAACCTACATTATCATCTCATTCCTCATCGTGGTGAACATGTACATTGCCATCATCCTGGAAAATTTCTCCGTGGCTACTGAGGAGTCAACTGAGCCCCTCTCCGAGGACGACTTCGACATGTTTTACGAGATCTGGGAAAAATTCGACCCTGAGGCCACACAGTTTATCGAGTACTCCGTCCTGAGCGATTTCGCCGATGCTCTGTCCGAACCACTCCGAATTGCTAAACCAAATCAGATTTCCCTCATCAATATGGATCTGCCCATGGTGAGTGGCGATAGAATTCACTGTATGGACATCCTGTTCGCCTTCACTAAACGAGTGCTCGGGGAGAGTGGGGAAATGGATGCCCTGAAAATCCAGATGGAAGAGAAGTTTATGGCCGCCAACCCTTCTAAAATCTCCTACGAACCAATCACAACAACACTGAGGCGGAAACACGAAGAAGTGAGCGCCATGGTCATTCAGAGAGCCTTTAGGCGACATCTGCTCCAGAGATCCCTCAAACACGCTTCCTTTCTCTTCCGGCAGCAGGCTGGATCTGGACTGTCTGAGGAGGATGCTCCCGAACGAGAGGGACTCATTGCTTACGTCATGTCCGAGAACTTTAGTAGGCCACTGGGACCACCCTCATCTTCATCAATCTCATCAACTTCATTCCCCCCATCCTACGATTCTGTGACTAGGGCCACTAGCGACAATCTCCAGGTCCGGGGATCCGATTACTCACATTCCGAGGACCTCGCCGATTTCCCACCTTCTCCCGATCGGGATCGAGAGTCTATTGTGTGATGATGAGCGGCCGC-3′
Wherein the quantity of four kinds of bases is respectively A:1412, T:1503, C:1681, G:1478, GC content GC%=52.01%.
2. the design of oligonucleotide chain is with synthetic
Design and synthesize for the oligonucleotide chain that extends according to target dna sequence.
(1) because target dna sequence is longer, it is divided into three sections respectively called afters: NaV15_6AhH1-A(2590bp), NaV15_6AhH1-B(2122bp) and NaV15_6AhH1-C(1462bp).
The sequence of NaV15_6AhH1-A is as follows:
5′-GCTAGCGCCACCATGGCAAACTTCCTCCTCCCTCGGGGCACATCTTCTTTTCGGCGGTTCACTAGAGAGTCACTGGCTGCTATCGAGAAACGGATGGCTGAGAAACAGGCTAGAGGCTCCACAACACTCCAGGAGTCTAGAGAGGGCCTGCCTGAGGAGGAGGCCCCTAGACCTCAGCTGGATCTCCAGGCCTCAAAAAAACTGCCCGACCTGTACGGAAACCCACCACAGGAACTCATTGGCGAACCTCTCGAGGATCTGGACCCTTTCTACTCTACCCAGAAAACCTTCATCGTGCTGAACAAGGGCAAAACCATCTTTCGGTTCTCCGCTACCAACGCTCTGTACGTGCTGTCTCCATTCCACCCCATTAGGAGAGCTGCCGTCAAAATTCTGGTCCACTCCCTGTTCAATATGCTCATCATGTGTACTATCCTCACAAACTGTGTGTTCATGGCCCAGCATGATCCACCTCCATGGACAAAATACGTGGAGTACACTTTCACCGCCATCTACACATTTGAGTCCCTGGTGAAAATTCTCGCTCGGGGATTCTGTCTCCATGCCTTCACCTTTCTCCGGGATCCTTGGAATTGGCTGGACTTCTCCGTCATTATTATGGCCTACACCACCGAATTTGTCGATCTCGGCAACGTGTCTGCTCTGAGAACATTCCGAGTGCTGAGAGCCCTGAAAACAATCTCCGTGATCTCCGGGCTGAAAACAATTGTCGGCGCCCTGATTCAGAGTGTGAAAAAACTCGCCGATGTGATGGTGCTCACCGTGTTCTGCCTGTCTGTGTTTGCTCTCATTGGACTCCAGCTCTTCATGGGCAACCTGAGACACAAGTGTGTCCGGAATTTCACTGCCCTCAATGGCACCAATGGATCTGTCGAGGCCGATGGACTGGTCTGGGAATCTCTGGATCTGTACCTGAGCGATCCTGAAAATTACCTGCTGAAAAACGGAACATCCGACGTCCTGCTGTGTGGCAACTCTTCCGATGCCGGAACTTGTCCTGAGGGATACCGGTGTCTGAAAGCCGGGGAAAATCCTGACCACGGCTACACCTCATTCGATTCTTTCGCTTGGGCATTCCTGGCTCTGTTTCGGCTCATGACACAGGACTGTTGGGAACGGCTGTACCAGCAGACTCTGAGGAGTGCTGGCAAAATCTACATGATTTTCTTTATGCTCGTGATCTTCCTGGGATCTTTCTACCTCGTGAATCTCATTCTGGCTGTCGTGGCTATGGCTTACGAGGAACAGAATCAGGCCACAATTGCCGAAACTGAGGAAAAGGAGAAACGGTTCCAGGAAGCCATGGAAATGCTCAAAAAGGAGCATGAGGCACTCACCATTAGAGGAGTCGATACTGTGAGTCGGTCATCACTGGAAATGAGCCCTCTGGCTCCTGTGAATTCCCACGAACGACGGTCTAAACGGCGAAAACGAATGTCATCTGGGACCGAGGAATGTGGAGAGGATCGACTGCCCAAATCCGATAGCGAGGACGGACCTCGAGCAATGAATCACCTGTCCCTCACCCGGGGACTGTCTCGAACTTCTATGAAACCTCGGAGTAGTAGGGGATCAATCTTCACTTTCCGACGGCGGGACCTGGGCTCTGAGGCCGACTTTGCCGATGACGAAAACTCTACTGCCGGCGAATCTGAGTCTCATCATACTAGCCTGCTGGTGCCTTGGCCACTGAGGCGAACATCCGCCCAGGGGCAGCCTAGTCCCGGCACTAGTGCTCCCGGACATGCCCTCCACGGCAAAAAAAACTCCACCGTGGACTGTAATGGAGTCGTGTCACTGCTGGGAGCTGGCGATCCCGAGGCAACTTCCCCTGGATCTCATCTGCTGAGGCCCGTGATGCTGGAGCATCCTCCCGATACAACAACCCCATCCGAGGAGCCTGGCGGACCACAGATGCTCACATCTCAGGCCCCATGTGTGGACGGCTTTGAGGAACCCGGCGCTCGCCAGAGAGCACTCTCTGCTGTCTCCGTGCTCACTTCTGCTCTGGAGGAACTCGAAGAAAGCAGACATAAGTGCCCTCCATGTTGGAATCGACTGGCTCAGAGATACCTCATTTGGGAATGCTGTCCTCTGTGGATGTCCATCAAACAGGGCGTCAAACTGGTGGTGATGGATCCTTTTACCGACCTCACCATTACCATGTGTATCGTCCTCAACACCCTCTTTATGGCCCTCGAACACTACAATATGACTAGCGAATTTGAGGAGATGCTCCAGGTCGGGAATCTGGTGTTTACCGGAATCTTTACCGCTGAAATGACCTTCAAAATCATTGCCCTGGACCCATACTACTACTTCCAGCAGGGCTGGAACATTTTCGACTCTATCATCGTGATCCTGTCACTCATGGAACTGGGCCTGTCACGGATGAGTAATCTGTCTGTGCTGAGGAGCTTTAGACTGCTCCGAGTGTTCAAACTGGCCAAATCTTGGCCTACCCTGAATACCCTCATCAAAATCATCGGGAACTCCGTGGGGGCTCTGGGAAATCTCACACTGGTGCTGGCCATTATCGTCTTCATCTTTGCCGTGGTCGGAATGCAGC-3′
The sequence of NaV15_6AhH1-B is as follows:
5′-ACTGGTGCTGGCCATTATCGTCTTCATCTTTGCCGTGGTCGGAATGCAGCTGTTTGGAAAAAACTACTCTGAACTCCGGGATAGCGATTCTGGACTGCTCCCTCGGTGGCATATGATGGATTTCTTCCACGCCTTCCTCATCATTTTCCGGATCCTGTGTGGCGAATGGATCGAGACAATGTGGGACTGTATGGAGGTGTCCGGACAGTCTCTGTGTCTGCTGGTGTTTCTCCTGGTCATGGTGATTGGGAACCTGGTCGTGCTGAACCTGTTTCTGGCTCTGCTCCTCTCTTCTTTCTCTGCCGACAACCTCACTGCTCCCGACGAGGATAGAGAGATGAATAACCTCCAGCTCGCCCTGGCTAGAATCCAGAGGGGACTCCGATTCGTCAAACGAACAACTTGGGACTTCTGCTGTGGGCTGCTGAGACAGCGACCTCAGAAACCTGCTGCTCTGGCCGCTCAGGGACAGCTCCCATCTTGTATTGCCACTCCCTACTCACCCCCTCCACCTGAAACCGAAAAAGTGCCCCCAACACGAAAGGAAACTCGCTTTGAGGAGGGCGAACAGCCTGGACAGGGAACACCTGGAGATCCTGAACCTGTGTGTGTGCCTATTGCTGTGGCTGAATCCGATACCGATGATCAGGAGGAGGACGAGGAGAATTCTCTGGGCACTGAGGAGGAATCCTCTAAACAGGAGTCACAGCCTGTCTCTGGGGGACCTGAAGCTCCACCCGATAGTAGAACATGGTCCCAGGTGTCCGCTACTGCTTCTTCCGAGGCTGAGGCTTCTGCCTCTCAGGCCGATTGGAGGCAGCAGTGGAAAGCCGAACCACAGGCCCCTGGATGTGGGGAAACTCCTGAGGACTCTTGCTCTGAGGGATCAACTGCCGATATGACAAACACCGCCGAACTGCTGGAGCAGATTCCCGATCTCGGCCAGGACGTGAAAGATCCTGAGGATTGCTTCACTGAGGGCTGTGTGCGGCGGTGCCCTTGCTGCGCTGTCGATACCACTCAGGCACCCGGGAAAGTGTGGTGGCGACTGAGAAAAACTTGCTACCATATTGTGGAACACTCATGGTTTGAGACTTTCATCATCTTCATGATTCTGCTGAGTTCTGGAGCACTGGCCTTCGAGGACATCTACCTGGAGGAACGGAAAACAATCAAAGTCCTGCTCGAGTACGCCGACAAAATGTTCACCTACGTCTTTGTGCTGGAAATGCTGCTGAAATGGGTGGCCTACGGCTTCAAAAAATACTTCACCAACGCCTGGTGCTGGCTCGATTTCCTCATCGTGGATGTGTCTCTCGTGTCACTGGTGGCCAATACTCTGGGATTTGCCGAAATGGGCCCCATCAAATCACTCCGAACACTGAGGGCTCTCCGGCCTCTCCGGGCTCTGTCACGCTTTGAGGGCATGAGAGTGGTGGTGAATGCTCTCGTGGGCGCTATTCCTTCTATTATGAACGTGCTGCTGGTCTGTCTCATCTTTTGGCTCATCTTTAGCATCATGGGCGTGAATCTCTTCGCTGGGAAATTTGGGCGCTGTATCAACCAGACTGAGGGAGATCTGCCACTGAATTACACCATCGTGAATAACAAATCACAGTGTGAATCCCTCAATCTCACCGGAGAACTGTACTGGACCAAAGTCAAAGTGAACTTCGACAATGTCGGAGCCGGCTACCTGGCTCTGCTCCAGGTGGCAACCTTTAAGGGATGGATGGATATCATGTACGCCGCTGTGGATAGTCGAGGCTACGAGGAACAGCCACAGTGGGAGTACAATCTCTACATGTACATCTACTTCGTCATTTTCATCATTTTCGGATCTTTCTTCACCCTCAACCTCTTCATTGGCGTCATCATCGACAACTTCAACCAGCAGAAAAAAAAGCTGGGAGGCCAGGACATCTTTATGACCGAGGAACAGAAAAAATACTACAATGCCATGAAAAAACTCGGCTCCAAAAAACCCCAGAAACCCATCCCTAGACCCCTGAACAAATACCAGGGCTTCATTTTCGACATCGTGACCAAACAGGCCTTCGACGTGACTATCATGTTTCTCATCTGCCTGAATATGGTGACCATGATGGTGGAAACCGACGAT-3′
The sequence of NaV15_6AhH1-C is as follows:
5′-TGTTTCTCATCTGCCTGAATATGGTGACCATGATGGTGGAAACCGACGATCAGTCTCCTGAAAAAATCAACATCCTCGCCAAAATCAATCTGCTCTTCGTGGCCATTTTTACCGGCGAGTGTATTGTGAAACTGGCTGCTCTGAGACACTACTACTTTACCAACTCTTGGAACATCTTCGACTTTGTGGTGGTGATCCTGTCTATTGTGGGAACTGTGCTCTCCGATATCATCCAGAAATACTTCTTCTCCCCTACCCTCTTTAGAGTCATCCGGCTGGCTAGAATTGGACGGATTCTGAGGCTCATTCGAGGCGCTAAGGGAATTCGAACACTGCTCTTTGCCCTCATGATGTCTCTGCCTGCCCTGTTCAATATTGGCCTGCTGCTCTTTCTCGTGATGTTCATCTACTCCATCTTCGGCATGGCCAATTTCGCTTACGTGAAATGGGAGGCTGGAATCGACGACATGTTCAACTTCCAGACCTTCGCCAACTCTATGCTGTGTCTGTTTCAGATCACTACTAGTGCTGGCTGGGACGGACTGCTGTCTCCTATCCTCAATACCGGACCCCCTTACTGTGACCCTACACTGCCCAACTCAAACGGCTCTAGAGGCGATTGTGGGAGTCCCGCTGTGGGGATTCTCTTCTTTACAACCTACATTATCATCTCATTCCTCATCGTGGTGAACATGTACATTGCCATCATCCTGGAAAATTTCTCCGTGGCTACTGAGGAGTCAACTGAGCCCCTCTCCGAGGACGACTTCGACATGTTTTACGAGATCTGGGAAAAATTCGACCCTGAGGCCACACAGTTTATCGAGTACTCCGTCCTGAGCGATTTCGCCGATGCTCTGTCCGAACCACTCCGAATTGCTAAACCAAATCAGATTTCCCTCATCAATATGGATCTGCCCATGGTGAGTGGCGATAGAATTCACTGTATGGACATCCTGTTCGCCTTCACTAAACGAGTGCTCGGGGAGAGTGGGGAAATGGATGCCCTGAAAATCCAGATGGAAGAGAAGTTTATGGCCGCCAACCCTTCTAAAATCTCCTACGAACCAATCACAACAACACTGAGGCGGAAACACGAAGAAGTGAGCGCCATGGTCATTCAGAGAGCCTTTAGGCGACATCTGCTCCAGAGATCCCTCAAACACGCTTCCTTTCTCTTCCGGCAGCAGGCTGGATCTGGACTGTCTGAGGAGGATGCTCCCGAACGAGAGGGACTCATTGCTTACGTCATGTCCGAGAACTTTAGTAGGCCACTGGGACCACCCTCATCTTCATCAATCTCATCAACTTCATTCCCCCCATCCTACGATTCTGTGACTAGGGCCACTAGCGACAATCTCCAGGTCCGGGGATCCGATTACTCACATTCCGAGGACCTCGCCGATTTCCCACCTTCTCCCGATCGGGATCGAGAGTCTATTGTGTGATGATGAGCGGCCGC-3′
(2) be the oligonucleotide chain with overlapping complementary sequence with these three sections sequence Further Divisions respectively, take NaV15_6AhH1-A(2590bp) and NaV15_6AhH1-C(1462bp) describe as example.
2590 bases of fragment NaV15_6AhH1-A length are divided into as length 82 oligonucleotide chains between 37-50bp, and are as follows:
| Coding | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | AGAAACAGGCTAGAGGCTCCACAACACTCCAGGAGTCTAGAGAGGGCCTG |
| 6 | TCCAGCTGAGGTCTAGGGGCCTCCTCCTCAGGCAGGCCCTCTCTAGACTC |
| 7 | CCCTAGACCTCAGCTGGATCTCCAGGCCTCAAAAAAACTGCCCGACCTGT |
| 8 | GTTCGCCAATGAGTTCCTGTGGTGGGTTTCCGTACAGGTCGGGCAGTTTT |
| 9 | |
| 10 | |
| 11 | CGTGCTGAACAAGGGCAAAACCATCTTTCGGTTCTCCGCTACCAACGCTC |
| 12 | CTCCTAATGGGGTGGAATGGAGACAGCACGTACAGAGCGTTGGTAGCGGA |
| 13 | CATTCCACCCCATTAGGAGAGCTGCCGTCAAAATTCTGGTCCACTCCCTG |
| 14 | TGTGAGGATAGTACACATGATGAGCATATTGAACAGGGAGTGGACCAGAA |
| 15 | CATCATGTGTACTATCCTCACAAACTGTGTGTTCATGGCCCAGCATGATC |
| 16 | AAGTGTACTCCACGTATTTTGTCCATGGAGGTGGATCATGCTGGGCCATG |
| 17 | CAAAATACGTGGAGTACACTTTCACCGCCATCTACACATTTGAGTCCCTG |
| 18 | AGACAGAATCCCCGAGCGAGAATTTTCACCAGGGACTCAAATGTGTAGAT |
| 19 | GCTCGGGGATTCTGTCTCCATGCCTTCACCTTTCTCCGGGATCCTTGGAA |
| 20 | TAGGCCATAATAATGACGGAGAAGTCCAGCCAATTCCAAGGATCCCGGAG |
| 21 | CTCCGTCATTATTATGGCCTACACCACCGAATTTGTCGATCTCGGCAACG |
| 22 | GCTCTCAGCACTCGGAATGTTCTCAGAGCAGACACGTTGCCGAGATCGAC |
| 23 | TTCCGAGTGCTGAGAGCCCTGAAAACAATCTCCGTGATCTCCGGGCTGAA |
| 24 | TTCACACTCTGAATCAGGGCGCCGACAATTGTTTTCAGCCCGGAGATCAC |
| 25 | CCCTGATTCAGAGTGTGAAAAAACTCGCCGATGTGATGGTGCTCACCGTG |
| 26 | GGAGTCCAATGAGAGCAAACACAGACAGGCAGAACACGGTGAGCACCATC |
| 27 | TTTGCTCTCATTGGACTCCAGCTCTTCATGGGCAACCTGAGACACAAGTG |
| 28 | GGTGCCATTGAGGGCAGTGAAATTCCGGACACACTTGTGTCTCAGGTTGC |
| 29 | TGCCCTCAATGGCACCAATGGATCTGTCGAGGCCGATGGACTGGTCTGGG |
| 30 | TTTCAGGATCGCTCAGGTACAGATCCAGAGATTCCCAGACCAGTCCATCG |
| 31 | ACCTGAGCGATCCTGAAAATTACCTGCTGAAAAACGGAACATCCGACGTC |
| 32 | AGTTCCGGCATCGGAAGAGTTGCCACACAGCAGGACGTCGGATGTTCCGT |
| 33 | CTTCCGATGCCGGAACTTGTCCTGAGGGATACCGGTGTCTGAAAGCCGGG |
| 34 | AATCGAATGAGGTGTAGCCGTGGTCAGGATTTTCCCCGGCTTTCAGACAC |
| 35 | GGCTACACCTCATTCGATTCTTTCGCTTGGGCATTCCTGGCTCTGTTTCG |
| 36 | ACAGCCGTTCCCAACAGTCCTGTGTCATGAGCCGAAACAGAGCCAGGAAT |
| 37 | TGTTGGGAACGGCTGTACCAGCAGACTCTGAGGAGTGCTGGCAAAATCTA |
| 38 | CAGGAAGATCACGAGCATAAAGAAAATCATGTAGATTTTGCCAGCACTCC |
| 39 | TTATGCTCGTGATCTTCCTGGGATCTTTCTACCTCGTGAATCTCATTCTG |
| 40 | TGTTCCTCGTAAGCCATAGCCACGACAGCCAGAATGAGATTCACGAGGTA |
| 41 | CTATGGCTTACGAGGAACAGAATCAGGCCACAATTGCCGAAACTGAGGAA |
| 42 | TTTCCATGGCTTCCTGGAACCGTTTCTCCTTTTCCTCAGTTTCGGCAATT |
| 43 | TCCAGGAAGCCATGGAAATGCTCAAAAAGGAGCATGAGGCACTCACCATT |
| 44 | AGTGATGACCGACTCACAGTATCGACTCCTCTAATGGTGAGTGCCTCATG |
| 45 | TGTGAGTCGGTCATCACTGGAAATGAGCCCTCTGGCTCCTGTGAATTCCC |
| 46 | CATTCGTTTTCGCCGTTTAGACCGTCGTTCGTGGGAATTCACAGGAGCCA |
| 47 | TAAACGGCGAAAACGAATGTCATCTGGGACCGAGGAATGTGGAGAGGATC |
| 48 | GGTCCGTCCTCGCTATCGGATTTGGGCAGTCGATCCTCTCCACATTCCTC |
| 49 | GATAGCGAGGACGGACCTCGAGCAATGAATCACCTGTCCCTCACCCGGGG |
| 50 | CTACTACTCCGAGGTTTCATAGAAGTTCGAGACAGTCCCCGGGTGAGGGA |
| 51 | TATGAAACCTCGGAGTAGTAGGGGATCAATCTTCACTTTCCGACGGCGGG |
| 52 | TTCGTCATCGGCAAAGTCGGCCTCAGAGCCCAGGTCCCGCCGTCGGAAAG |
| 53 | GACTTTGCCGATGACGAAAACTCTACTGCCGGCGAATCTGAGTCTCATCA |
| 54 | CCTCAGTGGCCAAGGCACCAGCAGGCTAGTATGATGAGACTCAGATTCGC |
| 55 | GCCTTGGCCACTGAGGCGAACATCCGCCCAGGGGCAGCCTAGTCCCGGCA |
| 56 | TTTTTTGCCGTGGAGGGCATGTCCGGGAGCACTAGTGCCGGGACTAGGCT |
| 57 | CCCTCCACGGCAAAAAAAACTCCACCGTGGACTGTAATGGAGTCGTGTCA |
| 58 | AAGTTGCCTCGGGATCGCCAGCTCCCAGCAGTGACACGACTCCATTACAG |
| 59 | CGATCCCGAGGCAACTTCCCCTGGATCTCATCTGCTGAGGCCCGTGATGC |
| 60 | CTCGGATGGGGTTGTTGTATCGGGAGGATGCTCCAGCATCACGGGCCTCA |
| 61 | ACAACAACCCCATCCGAGGAGCCTGGCGGACCACAGATGCTCACATCTCA |
| 62 | GGGTTCCTCAAAGCCGTCCACACATGGGGCCTGAGATGTGAGCATCTGTG |
| 63 | CGGCTTTGAGGAACCCGGCGCTCGCCAGAGAGCACTCTCTGCTGTCTCCG |
| 64 | TTTCTTCGAGTTCCTCCAGAGCAGAAGTGAGCACGGAGACAGCAGAGAGT |
| 65 | TCTGGAGGAACTCGAAGAAAGCAGACATAAGTGCCCTCCATGTTGGAATC |
| 66 | GCATTCCCAAATGAGGTATCTCTGAGCCAGTCGATTCCAACATGGAGGGC |
| 67 | GATACCTCATTTGGGAATGCTGTCCTCTGTGGATGTCCATCAAACAGGGC |
| 68 | TCGGTAAAAGGATCCATCACCACCAGTTTGACGCCCTGTTTGATGGACAT |
| 69 | |
| 70 | ATTGTAGTGTTCGAGGGCCATAAAGAGGGTGTTGAGGACGATACACATGG |
| 71 | GCCCTCGAACACTACAATATGACTAGCGAATTTGAGGAGATGCTCCAGGT |
| 72 | CGGTAAAGATTCCGGTAAACACCAGATTCCCGACCTGGAGCATCTCCTCA |
| 73 | GTTTACCGGAATCTTTACCGCTGAAATGACCTTCAAAATCATTGCCCTGG |
| 74 | TCCAGCCCTGCTGGAAGTAGTAGTATGGGTCCAGGGCAATGATTTTGAAG |
| 75 | TCCAGCAGGGCTGGAACATTTTCGACTCTATCATCGTGATCCTGTCACTC |
| 76 | GATTACTCATCCGTGACAGGCCCAGTTCCATGAGTGACAGGATCACGATG |
| 77 | CCTGTCACGGATGAGTAATCTGTCTGTGCTGAGGAGCTTTAGACTGCTCC |
| 78 | GTAGGCCAAGATTTGGCCAGTTTGAACACTCGGAGCAGTCTAAAGCTCCT |
| 79 | GGCCAAATCTTGGCCTACCCTGAATACCCTCATCAAAATCATCGGGAACT |
| 80 | CAGTGTGAGATTTCCCAGAGCCCCCACGGAGTTCCCGATGATTTTGATGA |
| 81 | CTCTGGGAAATCTCACACTGGTGCTGGCCATTATCGTCTTCATCTTTGCC |
| 82 | GCTGCATTCCGACCACGGCAAAGATGAAGACGATAAT |
Wherein added one section sequence of folding with restriction enzyme site NheI and the upper orderly column weight thereof of carrier pcDNA3.1 (+) in No. 1 oligonucleotide chain, sequence is as follows:
5′-ACTCACTATAGGGAGACCCAAGCTGGCTAGC-3′（31bp），
Be positioned at No. 82 last oligonucleotide chain and contain one section sequence with the overlapping complementation of NaV15_6AhH1-B, sequence is as follows:
5′-CACGGCAAAGATGAAGACGATAAT-3′（24bp）。
1462 bases of NaV15_6AhH1-C length are divided into totally 50 of the oligonucleotide chain of length between 28-50bp with it, and are as follows:
| Numbering | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | ACCGGCGAGTGTATTGTGAAACTGGCTGCTCTGAGACACTACTACTTTAC |
| 6 | ACAAAGTCGAAGATGTTCCAAGAGTTGGTAAAGTAGTAGTGTCTCAGAGC |
| 7 | TTGGAACATCTTCGACTTTGTGGTGGTGATCCTGTCTATTGTGGGAACTG |
| 8 | GAAGTATTTCTGGATGATATCGGAGAGCACAGTTCCCACAATAGACAGGA |
| 9 | |
| 10 | |
| 11 | GCTAGAATTGGACGGATTCTGAGGCTCATTCGAGGCGCTAAGGGAATTCG |
| 12 | GCAGAGACATCATGAGGGCAAAGAGCAGTGTTCGAATTCCCTTAGCGCCT |
| 13 | GCCCTCATGATGTCTCTGCCTGCCCTGTTCAATATTGGCCTGCTGCTCTT |
| 14 | GCCGAAGATGGAGTAGATGAACATCACGAGAAAGAGCAGCAGGCCAATAT |
| 15 | TTCATCTACTCCATCTTCGGCATGGCCAATTTCGCTTACGTGAAATGGGA |
| 16 | CTGGAAGTTGAACATGTCGTCGATTCCAGCCTCCCATTTCACGTAAGCGA |
| 17 | GACGACATGTTCAACTTCCAGACCTTCGCCAACTCTATGCTGTGTCTGTT |
| 18 | CGTCCCAGCCAGCACTAGTAGTGATCTGAAACAGACACAGCATAGAGTTG |
| 19 | TAGTGCTGGCTGGGACGGACTGCTGTCTCCTATCCTCAATACCGGACCCC |
| 20 | GTTTGAGTTGGGCAGTGTAGGGTCACAGTAAGGGGGTCCGGTATTGAGGA |
| 21 | CTACACTGCCCAACTCAAACGGCTCTAGAGGCGATTGTGGGAGTCCCGCT |
| 22 | GATAATGTAGGTTGTAAAGAAGAGAATCCCCACAGCGGGACTCCCACAAT |
| 23 | ATTCTCTTCTTTACAACCTACATTATCATCTCATTCCTCATCGTGGTGAA |
| 24 | AAATTTTCCAGGATGATGGCAATGTACATGTTCACCACGATGAGGAATGA |
| 25 | TGCCATCATCCTGGAAAATTTCTCCGTGGCTACTGAGGAGTCAACTGAGC |
| 26 | AAACATGTCGAAGTCGTCCTCGGAGAGGGGCTCAGTTGACTCCTCAGTAG |
| 27 | AGGACGACTTCGACATGTTTTACGAGATCTGGGAAAAATTCGACCCTGAG |
| 28 | CAGGACGGAGTACTCGATAAACTGTGTGGCCTCAGGGTCGAATTTTTCCC |
| 29 | TTTATCGAGTACTCCGTCCTGAGCGATTTCGCCGATGCTCTGTCCGAACC |
| 30 | GGGAAATCTGATTTGGTTTAGCAATTCGGAGTGGTTCGGACAGAGCATCG |
| 31 | GCTAAACCAAATCAGATTTCCCTCATCAATATGGATCTGCCCATGGTGAG |
| 32 | ACAGGATGTCCATACAGTGAATTCTATCGCCACTCACCATGGGCAGATCC |
| 33 | TTCACTGTATGGACATCCTGTTCGCCTTCACTAAACGAGTGCTCGGGGAG |
| 34 | CATCTGGATTTTCAGGGCATCCATTTCCCCACTCTCCCCGAGCACTCGTT |
| 35 | GATGCCCTGAAAATCCAGATGGAAGAGAAGTTTATGGCCGCCAACCCTTC |
| 36 | TCAGTGTTGTTGTGATTGGTTCGTAGGAGATTTTAGAAGGGTTGGCGGCC |
| 37 | AACCAATCACAACAACACTGAGGCGGAAACACGAAGAAGTGAGCGCCATG |
| 38 | AGCAGATGTCGCCTAAAGGCTCTCTGAATGACCATGGCGCTCACTTCTTC |
| 39 | CCTTTAGGCGACATCTGCTCCAGAGATCCCTCAAACACGCTTCCTTTCTC |
| 40 | GACAGTCCAGATCCAGCCTGCTGCCGGAAGAGAAAGGAAGCGTGTTTGAG |
| 41 | GGCTGGATCTGGACTGTCTGAGGAGGATGCTCCCGAACGAGAGGGACTCA |
| 42 | CCTACTAAAGTTCTCGGACATGACGTAAGCAATGAGTCCCTCTCGTTCGG |
| 43 | CATGTCCGAGAACTTTAGTAGGCCACTGGGACCACCCTCATCTTCATCAA |
| 44 | GTAGGATGGGGGGAATGAAGTTGATGAGATTGATGAAGATGAGGGTGGTC |
| 45 | CTTCATTCCCCCCATCCTACGATTCTGTGACTAGGGCCACTAGCGACAAT |
| 46 | GAATGTGAGTAATCGGATCCCCGGACCTGGAGATTGTCGCTAGTGGCCCT |
| 47 | GGGATCCGATTACTCACATTCCGAGGACCTCGCCGATTTCCCACCTTCTC |
| 48 | CATCACACAATAGACTCTCGATCCCGATCGGGAGAAGGTGGGAAATCGGC |
| 49 | GATCGAGAGTCTATTGTGTGATGATGAGCGGCCGCTCGAGTCTAGAGGGC |
| 50 | GTTTAAACGGGCCCTCTAGACTCGAGCG |
Wherein No. 1 oligonucleotide chain is the sequence with the overlapping complementation of 3 ' end of NaV15_6AhH1-B, also contains one section sequence with the overlapping complementation of end of NaV15_6AhH1-B3 ' in No. 2 oligonucleotide chains, and sequence is as follows:
No. 1: 5 '-TGTTTCTCATCTGCCTGAATATGGTGACCATGATGGTGGAAACC-3 ' (44bp),
No. 2: 5 '-ATCGTCGGTTTCCACCATCATGGTCA-3 ' is (26bp).
The same sequence that goes up one section overlapping complementation of sequence in NotI restriction enzyme site and downstream thereof with carrier pcDNA3.1 (+) of having added on No. 49 oligonucleotide chains of sequence, No. 50 oligonucleotide chains are one section and No. 49 complementary sequences that overlap, simultaneously again with the sequence of the overlapping complementation of NotI restriction enzyme site downstream sequence of carrier pcDNA3.1 (+), sequence is as follows:
No. 49: 5 '-GCGGCCGCTCGAGTCTAGAGGGC-3 ' (23bp),
No. 50: 5 '-GTTTAAACGGGCCCTCTAGACTCGAGCG-3 ' is (28bp).
3.PCR splicing
Three sections fragment NaV15_6AhH1-A, NaV15_6AhH1-B and NaV15_6AhH1-C are spliced respectively, take NaV15_6AhH1-A as the example explanation.
82 oligonucleotide chains are divided into four groups, and the oligonucleotide chain of numbering No. 1-20 is first group, and the oligonucleotide chain of No. 19-40 is second group, and the 39-60 oligonucleotide chain is the 3rd group, and the 59-82 oligonucleotide chain is the 4th group.
Use the method for PCR respectively each group to be spliced, reaction system: working fluid I: 40ul, primer mixture: 10ul, pfu polysaccharase (2.5U/ul): 0.5ul.
PCR splicing reaction condition:
As shown in Figure 6A, be the PCR splicing electrophorogram of four groups of oligonucleotide chains of NaV15_6AhH1-A, pass through as can be known pcr amplification by Fig. 6 A, the DNA fragmentation length that four groups of oligonucleotide chains of NaV15_6AhH1-A are spliced into is correct.Wherein 1 is the PCR splicing result of 1-20 oligonucleotide chain combination; 2 is Marker DS5000; 3 is the PCR splicing result of 19-40 oligonucleotide chain combination; 4 is the PCR splicing result of 39-60 oligonucleotide chain combination; 5 is the PCR splicing result of 59-82 oligonucleotide chain combination.
Reclaim the PCR product, and take four groups of products reclaiming as template, add No. 1 and No. 82 oligonucleotide chains carry out for the second time as primer that PCR splices, obtain the complete sequence of NaV15_6AhH1-A.PCR splicing reaction system is as follows: working fluid II: 95ul, each 1ul of upstream and downstream primer, each 1ul of template, pfu polysaccharase (2.5U/ul): 1ul.
PCR splicing reaction condition:
As shown in Fig. 6 B, be the electrophorogram of NaV15_6AhH1-A total length, correct through the NaV15_6AhH1-A sequence length that obtains after splicing for the second time as can be known by Fig. 6 B.1 NaV15_6AhH1-A that obtains for PCR splicing wherein; 2 is Marker DS5000.
Obtain thus three fragments of NaV15_6AhH1-A, NaV15_6AhH1-B and NaV15_6AhH1-C, first they are connected to and carry out sequencing analysis on cloning vector pUC57, have 2 sequences synthetic entirely true in 4 bacterium colonies of result demonstration order-checking.
4. gene clone is to the vector construction recombinant chou
The method that adopts multi-disc section interpolation and carrier polysaccharase ring to extend, concrete steps are as follows:
One, the linearizing of carrier: use restriction enzyme NheI and NotI cut vector pcDNA3.1 (+), agarose gel electrophoresis reclaims linearizing carrier, and reaction system and reaction conditions are as follows:
Carrier pcDNA3.1 (+): 3ul(600-700ng), 10 * Buffer:5ul, NheI:1ul, NotI:1ul, H
2O:40ul, 37 ℃, 30min.(restriction enzyme of all uses is all the quick enzyme of buying in Fermentas company, the general Buffer that Buffer used provides for Fermentas)
Two, take the recombinant chou of check order correct NaV15_6AhH1-A, NaV15_6AhH1-B and NaV15_6AhH1-C and carrier pUC57 as template, the method of using PCR with NaV15_6AhH1-A, NaV15_6AhH1-B and three fragment amplifications of NaV15_6AhH1-C out, agarose gel electrophoresis reclaims the PCR product.
Three, the linearized vector pcDNA3.1 (+) that recovery is obtained, DNA fragmentation NaV15_6AhH1-A, NaV15_6AhH1-B and NaV15_6AhH1-C mix, and add recombinase to splice, and reaction system and reaction conditions are as follows:
Carrier pcDNA3.1 (+): 1.5ul, NaV15_6AhH1-A:1.2ul, NaV15_6AhH1-B:1.2ul, NaV15_6AhH1-C:1.2ul, recombinase: 15ul, 55 ℃, 1 hour.
Four, transformation and selection, to connect product is transformed in competence intestinal bacteria TOP10F ' cell, select the mono-clonal bacterium colony, carry out sequencing analysis, there are 4 sequences entirely true in 6 bacterium colonies of result order-checking, prove and successfully synthesize and built people humanNaV15_6AhH1-pcDNA3.1 (+) recombinant chou, restriction enzyme NheI and NotI enzyme are cut proof diagram and are seen Fig. 6 C, by Fig. 6 C as can be known synthetic and plasmid recombinant humanNaV15_6AhH1-pcDNA3.1 (+) DNA sequence dna that builds correct.Wherein 1 is recombinant plasmid humanNaV15_6AhH1-pcDNA3.1 (+) contrast; 2 is restriction enzyme NheI and NotI double digestion result; 3 is Marker DS10000.Sequencing result is seen Fig. 9.
The target synthetic product of the present embodiment is the A34R gene of A34RoptIHD-J(vaccinia bacterial strain WR (Western Reserve)) a segment length be the sequence of 543bp base, and be connected on carrier pUC57.The similar glycoprotein triplet of this genes encoding C type lectin gp22-24 suppresses A34R and can cause stigma piece phenotype, and A34R albumen can also affect relevant strip of paper used for sealing virus (CEV) release from cells infected of cell.Synthetic A34RoptIHD-J gene is used for the research of anti-virus aspect.
The gene building-up process of the present embodiment is as follows:
2. the DNA sequence dna after target sequence carries out sequential analysis and optimizes through gene design softwares such as information biology gene work is as follows:
5′-GGAACGCGGCCGCGCCACCATGAAGTCCCTCAACAGGCAGACCGTGTCCAGGTTCAAGAAGCTCAGCGTCCCCGCCGCCATCATGATGATTCTGAGCACCATCATCAGCGGCATCGGCACCTTCCTGCACTACAAAGAGGAGCTGATGCCCAGCGCCTGCGCTAACGGCTGGATCCAGTACGACAAGCACTGCTACCTGGACACCAACATCAAGATGAGCACAGACAACGCCGTCTACCAGTGTAGGAAGCTGAGGGCCAGACTCCCTAGGCCCGACACAAGGCACCTGAGGGTGCTGTTCAGCATCTTCTACAAGGACTACTGGGTGAGCCTGAAGAAGACCAACAACAAATGGCTCGACATCAACAACGACAAAGACATCGACATCAGCAAACTGACCAACTTCAAGCAGCTCAACAGCACCACCGACGCCGAGGCCTGCTACATCTACAAGTCCGGCAAGCTGGTGGAGACCGTGTGCAAATCCACCCAGAGCGTGCTCTGTGTGAAGAAGTTCTACAAATGATGATGAAGATCTGTTCC-3′
Wherein the quantity of four kinds of bases is respectively A:153, T:86, C:164, G:130, GC content GC%=55.16%.
2. the design of oligonucleotide chain is with synthetic
Design and synthesize for the oligonucleotide chain that extends according to target dna sequence, add protection bases G GAAC/GTTCC at the two ends of target dna sequence, to prevent the disappearance of first base when synthetic.Target dna sequence 543 base pairs, design has the oligonucleotide chain of overlapping complementary sequence, has 26, and wherein the oligonucleotide chain length of each is between 35bp ~ 54bp.When synthetic primer to 5 of every oligonucleotide chain '-end carries out phosphatizing treatment, make it to be with 5 '-phosphate group.
Primer sequence is as follows:
| Numbering | Sequence (5 '-3 ') |
| 1 | |
| 2 | |
| 3 | |
| 4 | |
| 5 | GTCCCCGCCGCCATCATGATGATTCTGAGCACCATCATCAGCGGCA |
| 6 | TCCTCTTTGTAGTGCAGGAAGGTGCCGATGCCGCTGATGATGGTGCTCAG |
| 7 | CTGAGCACCATCATCAGCGGCATCGGCACCTTCCTGCACTA |
| 8 | CAGGCGCTGGGCATCAGCTCCTCTTTGTAGTGCAGGAA |
| 9 | |
| 10 | |
| 11 | CCAGTACGACAAGCACTGCTACCTGGACACCAACATCAAGATGAGCACAG |
| 12 | TACACTGGTAGACGGCGTTGTCTGTGCTCATCTTGATGTTGGTGTCCAGG |
| 13 | ACAACGCCGTCTACCAGTGTAGGAAGCTGAGGGCCAGACT |
| 14 | TTGTGTCGGGCCTAGGGAGTCTGGCCCTCAGCTTCC |
| 15 | CCCTAGGCCCGACACAAGGCACCTGAGGGTGCTGTT |
| 16 | TCACCCAGTAGTCCTTGTAGAAGATGCTGAACAGCACCCTCAGGTGCC |
| 17 | CAGCATCTTCTACAAGGACTACTGGGTGAGCCTGAAGAAGACCAACAACAAATG |
| 18 | GTCTTTGTCGTTGTTGATGTCGAGCCATTTGTTGTTGGTCTTCTTCAGGC |
| 19 | GCTCGACATCAACAACGACAAAGACATCGACATCAGCAAACTGACCAACT |
| 20 | TGGTGCTGTTGAGCTGCTTGAAGTTGGTCAGTTTGCTGATGTCGAT |
| 21 | TCAAGCAGCTCAACAGCACCACCGACGCCGAGGCCT |
| 22 | TTGCCGGACTTGTAGATGTAGCAGGCCTCGGCGTCGG |
| 23 | GCTACATCTACAAGTCCGGCAAGCTGGTGGAGACCGTGTGCAAAT |
| 24 | GCACGCTCTGGGTGGATTTGCACACGGTCTCCACCAGC |
| 25 | CCACCCAGAGCGTGCTCTGTGTGAAGAAGTTCTACAAATGATG |
| 26 | GGAACAGATCTTCATCATCATTTGTAGAACTTCTTCACACAGA |
3. connect the enzyme process splicing
Reaction conditions: the 100ul reaction system includes the 20ul primer mixture, 10ul Taq DNA ligase Buffer, 60ulH
2O, 10ul Taq DNA ligase (Fermentas, 1000U 1000CEU/ul).95 ° of C sex change 2min of mixture, 30min to the 55 ° of C that slowly anneal afterwards, 55 ° of C are hatched 1h.
After reaction was completed, getting 2ul electrophoresis recovery product was template, adds No. 1 and No. 26 each 1ul of oligonucleotide chain working fluid II: 95ul, pfu polysaccharase (2.5U/ul) 1ul mixing.
PCR splicing reaction condition:
As shown in Figure 10 A, be PCR product electrophorogram, wherein 1 is Marker DS5000; The 2 A34RoptIHD-J gene orders that obtain for pcr amplification.Correct by the A34RoptIHD-J sequence length that Figure 10 A synthesizes as can be known.
4. gene clone is to the vector construction recombinant chou
The DNA fragmentation that the connection enzyme process obtains is connected the flat end splicing method that adopts with carrier: first carrier pUC57 use EcoR V is carried out enzyme and cut processing, then DNA fragmentation is mixed with carrier.Endonuclease reaction system and reaction conditions are as follows: pUC57 (300ng): 1.5ul, 10 * Buffer:5ul, EcoR V: 1ul, H2O:42.5ul.The ligation system is reaction conditions: 2 * Buffer:10ul, DNA fragmentation: 8ul, pUC57(4ng): 1ul, T4 DNA ligase (Fermentas, 1000U 1000CEU/ul): 1ul; 22 ℃, 30min.
5. detect
To link product changes intestinal bacteria over to and carries out the screening of blue hickie, selecting mono-clonal hickie bacterium colony checks order, 5 bacterial strains finding order-checking all contain right-on target dna sequence, and recombinant plasmid A34RoptIHD-J-pUC57 enzyme is cut the checking electrophoresis result as shown in Figure 10 B.By Figure 10 B synthetic gene target dna sequence just as can be known, wherein 1 for recombinant plasmid A34RoptIHD-J-pUC57 contrasts, and 2 cut result for restriction enzyme BamHI enzyme, and 3 is Marker DS5000.Sequencing result is seen Figure 11.
If find to have the problems such as the sudden change of sequence or mispairing in the present invention's order-checking process, can return to PCR splicing step to the zone at the place that suddenlys change repairs targetedly, and do not need the complete sequence de novo synthesis, only have the reparation that need to suddenly change of once in a while only a few but success ratio of the present invention is very high.The present invention have high success rate, high-throughput, at a high speed, characteristics cheaply, and its simplicity of design, widely applicable, operational standardization, can carry out commercial scale production, to the fast development of gene compound industry, huge effect is played in the development in the fields such as life science and new forms of energy, novel material, artificial life, nucleic acid vaccine, biological medicine.
The present invention still has numerous embodiments, and all employing equivalents or equivalent transformation and all technical schemes of forming are within all dropping on protection scope of the present invention.
＜110〉Suzhou gold intelligence bio tech ltd only
＜120〉industrialized method for synthesizing gene
<160> 9
<210> 1
<211> 926
<212> DNA
＜213〉helicobacter pylori fucosyltransferase B gene FucT2
<400>1
acaggttgac gctatggctt ttaaagtggt gcaaatttgt ggggggcttg ggaatcaaat 60
gtttcaatac gctttcgcta aaagtttgca aaaacacctt aatacgcccg tgctattaga 120
cactacttct tttgattgga gcaataggaa aatgcaatta gagcttttcc ctattgattt 180
gccctatgcg aatgcaaaag aaatcgctat agctaaaatg caacatctcc ccaagttagt 240
aagagatgca ctcaaataca taggatttga tagggtgagt caagaaatcg tttttgaata 300
cgagcctaaa ttgttaaagc caagccgttt gacttatttt tttggctatt tccaagatcc 360
acgatatttt gatgctatat cctctttaat caagcaaacc ttcactctac cccccccccc 420
cgaaaataat aaaaataata ataaaaaaga ggaagaatac cagcgcaagc tttctttgat 480
tttagccgct aaaaacagcg tatttgtgca tataagaaga ggggattatg tggggattgg 540
ctgtcagctt ggtattgatt atcaaaaaaa ggcgcttgag tatatggcaa agcgcgtgcc 600
aaacatggag ctttttgtgt tttgcgaaga cttaaaattc acgcaaaatc ttgatcttgg 660
ctaccctttc acggacatga ccactaggga taaagaagaa gaggcgtatt gggatatgct 720
gctcatgcaa tcttgcaagc atggcattat cgctaatagc acttatagct ggtgggcggc 780
ttatttgatg gaaaatccag aaaaaatcat tattggcccc aaacactggc tttttgggca 840
tgaaaatatt ctttgtaagg aatgggtgaa aatagaatcc cattttgagg taaaatccca 900
aaaatataac gcttaagcgg ccgcga 926
<210>2
<211>3230
<212>DNA
＜213〉phosphatidyl inositol kinase (PI3K) catalytic subunit P110-alpha gene
<400>2
ggatccgccg ccaccatgcc tccaagacca tcatcaggtg aactgtgggg catccacttg 60
atgcccccaa gaatcctagt agaatgttta ctaccaaatg gaatgatagt gactttagaa 120
tgcctccgtg aggctacatt aataaccata aagcatgaac tatttaaaga agcaagaaaa 180
taccccctcc atcaacttct tcaagatgaa tcttcttaca ttttcgtaag tgttacccaa 240
gaagcagaaa gggaagaatt ttttgatgaa acaagacgac tttgtgacct tcggcttttt 300
caaccctttt taaaagtaat tgaaccagta ggcaaccgtg aagaaaagat cctcaatcga 360
gaaattggtt ttgctatcgg catgccagtg tgtgaatttg atatggttaa agatccagaa 420
gtacaggact tccgaagaaa tattctgaac gtttgtaaag aagctgtgga tcttagggac 480
ctcaattcac ctcatagtag agcaatgtat gtctatcctc caaatgtaga atcttcacca 540
gaattgccaa agcacatata taataaatta gataaagggc aaataatagt ggtgatctgg 600
gtaatagttt ctccaaataa tgacaagcag aagtatactc tgaaaatcaa ccatgactgt 660
gtaccagaac aagtaattgc tgaagcaatc aggaaaaaaa ctcgaagtat gttgctatcc 720
tctgaacaac taaaactctg tgttttagaa tatcagggca agtatatttt aaaagtgtgt 780
ggatgtgatg aatacttcct agaaaaatat cctctgagtc agtataagta tataagaagc 840
tgtataatgc ttgggaggat gcccaatttg atgttgatgg ctaaagaaag cctctattct 900
caactgccaa tggactgttt tacaatgcca tcttattcca gacgcatttc cacagctaca 960
ccatatatga atggagaaac atctacaaaa tccctttggg ttataaatag tgcactcaga 1020
ataaaaattc tttgtgcaac ctacgtgaat gtaaatattc gagacattga taagatctat 1080
gttcgaacag gtatctacca tggaggagaa cccttatgtg acaatgtgaa cactcaaaga 1140
gtaccttgtt ccaatcccag gtggaatgaa tggctgaatt atgatatata cattcctgat 1200
cttcctcgtg ctgctcgact ttgcctttcc atttgctctg ttaaaggccg aaagggtgct 1260
aaagaggaac actgtccatt ggcatgggga aatataaact tgtttgatta cacagacact 1320
ctagtatctg gaaaaatggc tttgaatctt tggccagtac ctcatggact agaagatttg 1380
ctgaacccta ttggtgttac tggatcaaat ccaaataaag aaactccatg cttagagttg 1440
gagtttgact ggttcagcag tgtggtaaag ttcccagata tgtcagtgat tgaagagcat 1500
gccaattggt ctgtatcccg agaagcagga tttagctatt cccacgcagg actgagtaac 1560
agactagcta gagacaatga attaagggaa aatgacaaag aacagctcaa agcaatttct 1620
acacgagatc ctctctctga aatcactgag caggagaaag attttctatg gagtcacaga 1680
cactattgtg taactatccc cgaaattcta cccaaattgc ttctgtctgt taaatggaat 1740
tctagagatg aagtagccca gatgtattgc ttggtaaaag attggcctcc aatcaaacct 1800
gaacaggcta tggaacttct ggactgtaat tacccagatc ctatggttcg aggttttgct 1860
gttcggtgct tggaaaaata tttaacagat gacaaacttt ctcagtattt aattcagcta 1920
gtacaggtcc taaaatatga acaatatttg gataacttgc ttgtgagatt tttactgaag 1980
aaagcattga ctaatcaaag gattgggcac tttttctttt ggcatttaaa atctgagatg 2040
cacaataaaa cagttagcca gaggtttggc ctgcttttgg agtcctattg tcgtgcatgt 2100
gggatgtatt tgaagcacct gaataggcaa gtcgaggcaa tggaaaagct cattaactta 2160
actgacattc tcaaacagga gaagaaggat gaaacacaaa aggtacagat gaagttttta 2220
gttgagcaaa tgaggcgacc agatttcatg gatgctctac agggctttct gtctcctcta 2280
aaccctgctc atcaactagg aaacctcagg cttgaagagt gtcgaattat gtcctctgca 2340
aaaaggccac tgtggttgaa ttgggagaac ccagacatca tgtcagagtt actgtttcag 2400
aacaatgaga tcatctttaa aaatggggat gatttacggc aagatatgct aacacttcaa 2460
attattcgta ttatggaaaa tatctggcaa aatcaaggtc ttgatcttcg aatgttacct 2520
tatggttgtc tgtcaatcgg tgactgtgtg ggacttattg aggtggtgcg aaattctcac 2580
actattatgc aaattcagtg caaaggcggc ttgaaaggtg cactgcagtt caacagccac 2640
acactacatc agtggctcaa agacaagaac aaaggagaaa tatatgatgc agccattgac 2700
ctgtttacac gttcatgtgc tggatactgt gtagctacct tcattttggg aattggagat 2760
cgtcacaata gtaacatcat ggtgaaagac gatggacagc tgtttcatat agattttgga 2820
cactttttgg atcacaagaa gaaaaaattt ggttataaac gagaacgtgt gccatttgtt 2880
ttgacacagg atttcttaat agtgattagt aaaggagccc aagaatgcac aaagacaaga 2940
gaatttgaga ggtttcagga gatgtgttac aaggcttatc tagctattcg acagcatgcc 3000
aatctcttca taaatctttt ctcaatgatg cttggctctg gaatgccaga actacaatct 3060
tttgatgaca ttgcatacat tcgaaagacc ctagccttag ataaaactga gcaagaggct 3120
ttggagtatt tcatgaaaca aatgaatgat gcacatcatg gtggctggac aacaaaaatg 3180
gattggatct tccacacaat taaacagcat gcattgaact gagcggccgc 3230
<210>3
<211>1123
<212>DNA
＜213〉the fragment P110-alpha-A of phosphatidyl inositol kinase (PI3K) catalytic subunit P110-alpha gene
<400>3
ggatccgccg ccaccatgcc tccaagacca tcatcaggtg aactgtgggg catccacttg 60
atgcccccaa gaatcctagt agaatgttta ctaccaaatg gaatgatagt gactttagaa 120
tgcctccgtg aggctacatt aataaccata aagcatgaac tatttaaaga agcaagaaaa 180
taccccctcc atcaacttct tcaagatgaa tcttcttaca ttttcgtaag tgttacccaa 240
gaagcagaaa gggaagaatt ttttgatgaa acaagacgac tttgtgacct tcggcttttt 300
caaccctttt taaaagtaat tgaaccagta ggcaaccgtg aagaaaagat cctcaatcga 360
gaaattggtt ttgctatcgg catgccagtg tgtgaatttg atatggttaa agatccagaa 420
gtacaggact tccgaagaaa tattctgaac gtttgtaaag aagctgtgga tcttagggac 480
ctcaattcac ctcatagtag agcaatgtat gtctatcctc caaatgtaga atcttcacca 540
gaattgccaa agcacatata taataaatta gataaagggc aaataatagt ggtgatctgg 600
gtaatagttt ctccaaataa tgacaagcag aagtatactc tgaaaatcaa ccatgactgt 660
gtaccagaac aagtaattgc tgaagcaatc aggaaaaaaa ctcgaagtat gttgctatcc 720
tctgaacaac taaaactctg tgttttagaa tatcagggca agtatatttt aaaagtgtgt 780
ggatgtgatg aatacttcct agaaaaatat cctctgagtc agtataagta tataagaagc 840
tgtataatgc ttgggaggat gcccaatttg atgttgatgg ctaaagaaag cctctattct 900
caactgccaa tggactgttt tacaatgcca tcttattcca gacgcatttc cacagctaca 960
ccatatatga atggagaaac atctacaaaa tccctttggg ttataaatag tgcactcaga 1020
ataaaaattc tttgtgcaac ctacgtgaat gtaaatattc gagacattga taagatctat 1080
gttcgaacag gtatctacca tggaggagaa cccttatgtg aca 1123
<210>4
<211>2153
<212>DNA
＜213〉the fragment P110-alpha-B of phosphatidyl inositol kinase (PI3K) catalytic subunit P110-alpha gene
<400>4
tatgttcgaa caggtatcta ccatggagga gaacccttat gtgacaatgt gaacactcaa 60
agagtacctt gttccaatcc caggtggaat gaatggctga attatgatat atacattcct 120
gatcttcctc gtgctgctcg actttgcctt tccatttgct ctgttaaagg ccgaaagggt 180
gctaaagagg aacactgtcc attggcatgg ggaaatataa acttgtttga ttacacagac 240
actctagtat ctggaaaaat ggctttgaat ctttggccag tacctcatgg actagaagat 300
ttgctgaacc ctattggtgt tactggatca aatccaaata aagaaactcc atgcttagag 360
ttggagtttg actggttcag cagtgtggta aagttcccag atatgtcagt gattgaagag 420
catgccaatt ggtctgtatc ccgagaagca ggatttagct attcccacgc aggactgagt 480
aacagactag ctagagacaa tgaattaagg gaaaatgaca aagaacagct caaagcaatt 540
tctacacgag atcctctctc tgaaatcact gagcaggaga aagattttct atggagtcac 600
agacactatt gtgtaactat ccccgaaatt ctacccaaat tgcttctgtc tgttaaatgg 660
aattctagag atgaagtagc ccagatgtat tgcttggtaa aagattggcc tccaatcaaa 720
cctgaacagg ctatggaact tctggactgt aattacccag atcctatggt tcgaggtttt 780
gctgttcggt gcttggaaaa atatttaaca gatgacaaac tttctcagta tttaattcag 840
ctagtacagg tcctaaaata tgaacaatat ttggataact tgcttgtgag atttttactg 900
aagaaagcat tgactaatca aaggattggg cactttttct tttggcattt aaaatctgag 960
atgcacaata aaacagttag ccagaggttt ggcctgcttt tggagtccta ttgtcgtgca 1020
tgtgggatgt atttgaagca cctgaatagg caagtcgagg caatggaaaa gctcattaac 1080
ttaactgaca ttctcaaaca ggagaagaag gatgaaacac aaaaggtaca gatgaagttt 1140
ttagttgagc aaatgaggcg accagatttc atggatgctc tacagggctt tctgtctcct 1200
ctaaaccctg ctcatcaact aggaaacctc aggcttgaag agtgtcgaat tatgtcctct 1260
gcaaaaaggc cactgtggtt gaattgggag aacccagaca tcatgtcaga gttactgttt 1320
cagaacaatg agatcatctt taaaaatggg gatgatttac ggcaagatat gctaacactt 1380
caaattattc gtattatgga aaatatctgg caaaatcaag gtcttgatct tcgaatgtta 1440
ccttatggtt gtctgtcaat cggtgactgt gtgggactta ttgaggtggt gcgaaattct 1500
cacactatta tgcaaattca gtgcaaaggc ggcttgaaag gtgcactgca gttcaacagc 1560
cacacactac atcagtggct caaagacaag aacaaaggag aaatatatga tgcagccatt 1620
gacctgttta cacgttcatg tgctggatac tgtgtagcta ccttcatttt gggaattgga 1680
gatcgtcaca atagtaacat catggtgaaa gacgatggac agctgtttca tatagatttt 1740
ggacactttt tggatcacaa gaagaaaaaa tttggttata aacgagaacg tgtgccattt 1800
gttttgacac aggatttctt aatagtgatt agtaaaggag cccaagaatg cacaaagaca 1860
agagaatttg agaggtttca ggagatgtgt tacaaggctt atctagctat tcgacagcat 1920
gccaatctct tcataaatct tttctcaatg atgcttggct ctggaatgcc agaactacaa 1980
tcttttgatg acattgcata cattcgaaag accctagcct tagataaaac tgagcaagag 2040
gctttggagt atttcatgaa acaaatgaat gatgcacatc atggtggctg gacaacaaaa 2100
atggattgga tcttccacac aattaaacag catgcattga actgagcggc cgc 2153
<210>5
<211>6074
<212>DNA
＜213〉people's sodium-ion channel albumen humanNaV15_6AhH1 gene
<400>5
gctagcgcca ccatggcaaa cttcctcctc cctcggggca catcttcttt tcggcggttc 60
actagagagt cactggctgc tatcgagaaa cggatggctg agaaacaggc tagaggctcc 120
acaacactcc aggagtctag agagggcctg cctgaggagg aggcccctag acctcagctg 180
gatctccagg cctcaaaaaa actgcccgac ctgtacggaa acccaccaca ggaactcatt 240
ggcgaacctc tcgaggatct ggaccctttc tactctaccc agaaaacctt catcgtgctg 300
aacaagggca aaaccatctt tcggttctcc gctaccaacg ctctgtacgt gctgtctcca 360
ttccacccca ttaggagagc tgccgtcaaa attctggtcc actccctgtt caatatgctc 420
atcatgtgta ctatcctcac aaactgtgtg ttcatggccc agcatgatcc acctccatgg 480
acaaaatacg tggagtacac tttcaccgcc atctacacat ttgagtccct ggtgaaaatt 540
ctcgctcggg gattctgtct ccatgccttc acctttctcc gggatccttg gaattggctg 600
gacttctccg tcattattat ggcctacacc accgaatttg tcgatctcgg caacgtgtct 660
gctctgagaa cattccgagt gctgagagcc ctgaaaacaa tctccgtgat ctccgggctg 720
aaaacaattg tcggcgccct gattcagagt gtgaaaaaac tcgccgatgt gatggtgctc 780
accgtgttct gcctgtctgt gtttgctctc attggactcc agctcttcat gggcaacctg 840
agacacaagt gtgtccggaa tttcactgcc ctcaatggca ccaatggatc tgtcgaggcc 900
gatggactgg tctgggaatc tctggatctg tacctgagcg atcctgaaaa ttacctgctg 960
aaaaacggaa catccgacgt cctgctgtgt ggcaactctt ccgatgccgg aacttgtcct 1020
gagggatacc ggtgtctgaa agccggggaa aatcctgacc acggctacac ctcattcgat 1080
tctttcgctt gggcattcct ggctctgttt cggctcatga cacaggactg ttgggaacgg 1140
ctgtaccagc agactctgag gagtgctggc aaaatctaca tgattttctt tatgctcgtg 1200
atcttcctgg gatctttcta cctcgtgaat ctcattctgg ctgtcgtggc tatggcttac 1260
gaggaacaga atcaggccac aattgccgaa actgaggaaa aggagaaacg gttccaggaa 1320
gccatggaaa tgctcaaaaa ggagcatgag gcactcacca ttagaggagt cgatactgtg 1380
agtcggtcat cactggaaat gagccctctg gctcctgtga attcccacga acgacggtct 1440
aaacggcgaa aacgaatgtc atctgggacc gaggaatgtg gagaggatcg actgcccaaa 1500
tccgatagcg aggacggacc tcgagcaatg aatcacctgt ccctcacccg gggactgtct 1560
cgaacttcta tgaaacctcg gagtagtagg ggatcaatct tcactttccg acggcgggac 1620
ctgggctctg aggccgactt tgccgatgac gaaaactcta ctgccggcga atctgagtct 1680
catcatacta gcctgctggt gccttggcca ctgaggcgaa catccgccca ggggcagcct 1740
agtcccggca ctagtgctcc cggacatgcc ctccacggca aaaaaaactc caccgtggac 1800
tgtaatggag tcgtgtcact gctgggagct ggcgatcccg aggcaacttc ccctggatct 1860
catctgctga ggcccgtgat gctggagcat cctcccgata caacaacccc atccgaggag 1920
cctggcggac cacagatgct cacatctcag gccccatgtg tggacggctt tgaggaaccc 1980
ggcgctcgcc agagagcact ctctgctgtc tccgtgctca cttctgctct ggaggaactc 2040
gaagaaagca gacataagtg ccctccatgt tggaatcgac tggctcagag atacctcatt 2100
tgggaatgct gtcctctgtg gatgtccatc aaacagggcg tcaaactggt ggtgatggat 2160
ccttttaccg acctcaccat taccatgtgt atcgtcctca acaccctctt tatggccctc 2220
gaacactaca atatgactag cgaatttgag gagatgctcc aggtcgggaa tctggtgttt 2280
accggaatct ttaccgctga aatgaccttc aaaatcattg ccctggaccc atactactac 2340
ttccagcagg gctggaacat tttcgactct atcatcgtga tcctgtcact catggaactg 2400
ggcctgtcac ggatgagtaa tctgtctgtg ctgaggagct ttagactgct ccgagtgttc 2460
aaactggcca aatcttggcc taccctgaat accctcatca aaatcatcgg gaactccgtg 2520
ggggctctgg gaaatctcac actggtgctg gccattatcg tcttcatctt tgccgtggtc 2580
ggaatgcagc tgtttggaaa aaactactct gaactccggg atagcgattc tggactgctc 2640
cctcggtggc atatgatgga tttcttccac gccttcctca tcattttccg gatcctgtgt 2700
ggcgaatgga tcgagacaat gtgggactgt atggaggtgt ccggacagtc tctgtgtctg 2760
ctggtgtttc tcctggtcat ggtgattggg aacctggtcg tgctgaacct gtttctggct 2820
ctgctcctct cttctttctc tgccgacaac ctcactgctc ccgacgagga tagagagatg 2880
aataacctcc agctcgccct ggctagaatc cagaggggac tccgattcgt caaacgaaca 2940
acttgggact tctgctgtgg gctgctgaga cagcgacctc agaaacctgc tgctctggcc 3000
gctcagggac agctcccatc ttgtattgcc actccctact caccccctcc acctgaaacc 3060
gaaaaagtgc ccccaacacg aaaggaaact cgctttgagg agggcgaaca gcctggacag 3120
ggaacacctg gagatcctga acctgtgtgt gtgcctattg ctgtggctga atccgatacc 3180
gatgatcagg aggaggacga ggagaattct ctgggcactg aggaggaatc ctctaaacag 3240
gagtcacagc ctgtctctgg gggacctgaa gctccacccg atagtagaac atggtcccag 3300
gtgtccgcta ctgcttcttc cgaggctgag gcttctgcct ctcaggccga ttggaggcag 3360
cagtggaaag ccgaaccaca ggcccctgga tgtggggaaa ctcctgagga ctcttgctct 3420
gagggatcaa ctgccgatat gacaaacacc gccgaactgc tggagcagat tcccgatctc 3480
ggccaggacg tgaaagatcc tgaggattgc ttcactgagg gctgtgtgcg gcggtgccct 3540
tgctgcgctg tcgataccac tcaggcaccc gggaaagtgt ggtggcgact gagaaaaact 3600
tgctaccata ttgtggaaca ctcatggttt gagactttca tcatcttcat gattctgctg 3660
agttctggag cactggcctt cgaggacatc tacctggagg aacggaaaac aatcaaagtc 3720
ctgctcgagt acgccgacaa aatgttcacc tacgtctttg tgctggaaat gctgctgaaa 3780
tgggtggcct acggcttcaa aaaatacttc accaacgcct ggtgctggct cgatttcctc 3840
atcgtggatg tgtctctcgt gtcactggtg gccaatactc tgggatttgc cgaaatgggc 3900
cccatcaaat cactccgaac actgagggct ctccggcctc tccgggctct gtcacgcttt 3960
gagggcatga gagtggtggt gaatgctctc gtgggcgcta ttccttctat tatgaacgtg 4020
ctgctggtct gtctcatctt ttggctcatc tttagcatca tgggcgtgaa tctcttcgct 4080
gggaaatttg ggcgctgtat caaccagact gagggagatc tgccactgaa ttacaccatc 4140
gtgaataaca aatcacagtg tgaatccctc aatctcaccg gagaactgta ctggaccaaa 4200
gtcaaagtga acttcgacaa tgtcggagcc ggctacctgg ctctgctcca ggtggcaacc 4260
tttaagggat ggatggatat catgtacgcc gctgtggata gtcgaggcta cgaggaacag 4320
ccacagtggg agtacaatct ctacatgtac atctacttcg tcattttcat cattttcgga 4380
tctttcttca ccctcaacct cttcattggc gtcatcatcg acaacttcaa ccagcagaaa 4440
aaaaagctgg gaggccagga catctttatg accgaggaac agaaaaaata ctacaatgcc 4500
atgaaaaaac tcggctccaa aaaaccccag aaacccatcc ctagacccct gaacaaatac 4560
cagggcttca ttttcgacat cgtgaccaaa caggccttcg acgtgactat catgtttctc 4620
atctgcctga atatggtgac catgatggtg gaaaccgacg atcagtctcc tgaaaaaatc 4680
aacatcctcg ccaaaatcaa tctgctcttc gtggccattt ttaccggcga gtgtattgtg 4740
aaactggctg ctctgagaca ctactacttt accaactctt ggaacatctt cgactttgtg 4800
gtggtgatcc tgtctattgt gggaactgtg ctctccgata tcatccagaa atacttcttc 4860
tcccctaccc tctttagagt catccggctg gctagaattg gacggattct gaggctcatt 4920
cgaggcgcta agggaattcg aacactgctc tttgccctca tgatgtctct gcctgccctg 4980
ttcaatattg gcctgctgct ctttctcgtg atgttcatct actccatctt cggcatggcc 5040
aatttcgctt acgtgaaatg ggaggctgga atcgacgaca tgttcaactt ccagaccttc 5100
gccaactcta tgctgtgtct gtttcagatc actactagtg ctggctggga cggactgctg 5160
tctcctatcc tcaataccgg acccccttac tgtgacccta cactgcccaa ctcaaacggc 5220
tctagaggcg attgtgggag tcccgctgtg gggattctct tctttacaac ctacattatc 5280
atctcattcc tcatcgtggt gaacatgtac attgccatca tcctggaaaa tttctccgtg 5340
gctactgagg agtcaactga gcccctctcc gaggacgact tcgacatgtt ttacgagatc 5400
tgggaaaaat tcgaccctga ggccacacag tttatcgagt actccgtcct gagcgatttc 5460
gccgatgctc tgtccgaacc actccgaatt gctaaaccaa atcagatttc cctcatcaat 5520
atggatctgc ccatggtgag tggcgataga attcactgta tggacatcct gttcgccttc 5580
actaaacgag tgctcgggga gagtggggaa atggatgccc tgaaaatcca gatggaagag 5640
aagtttatgg ccgccaaccc ttctaaaatc tcctacgaac caatcacaac aacactgagg 5700
cggaaacacg aagaagtgag cgccatggtc attcagagag cctttaggcg acatctgctc 5760
cagagatccc tcaaacacgc ttcctttctc ttccggcagc aggctggatc tggactgtct 5820
gaggaggatg ctcccgaacg agagggactc attgcttacg tcatgtccga gaactttagt 5880
aggccactgg gaccaccctc atcttcatca atctcatcaa cttcattccc cccatcctac 5940
gattctgtga ctagggccac tagcgacaat ctccaggtcc ggggatccga ttactcacat 6000
tccgaggacc tcgccgattt cccaccttct cccgatcggg atcgagagtc tattgtgtga 6060
tgatgagcgg ccgc 6074
<210>6
<211>2590
<212>DNA
＜213〉the fragment NaV15_6AhH1-A of people's sodium-ion channel albumen humanNaV15_6AhH1 gene
<400>6
gctagcgcca ccatggcaaa cttcctcctc cctcggggca catcttcttt tcggcggttc 60
actagagagt cactggctgc tatcgagaaa cggatggctg agaaacaggc tagaggctcc 120
acaacactcc aggagtctag agagggcctg cctgaggagg aggcccctag acctcagctg 180
gatctccagg cctcaaaaaa actgcccgac ctgtacggaa acccaccaca ggaactcatt 240
ggcgaacctc tcgaggatct ggaccctttc tactctaccc agaaaacctt catcgtgctg 300
aacaagggca aaaccatctt tcggttctcc gctaccaacg ctctgtacgt gctgtctcca 360
ttccacccca ttaggagagc tgccgtcaaa attctggtcc actccctgtt caatatgctc 420
atcatgtgta ctatcctcac aaactgtgtg ttcatggccc agcatgatcc acctccatgg 480
acaaaatacg tggagtacac tttcaccgcc atctacacat ttgagtccct ggtgaaaatt 540
ctcgctcggg gattctgtct ccatgccttc acctttctcc gggatccttg gaattggctg 600
gacttctccg tcattattat ggcctacacc accgaatttg tcgatctcgg caacgtgtct 660
gctctgagaa cattccgagt gctgagagcc ctgaaaacaa tctccgtgat ctccgggctg 720
aaaacaattg tcggcgccct gattcagagt gtgaaaaaac tcgccgatgt gatggtgctc 780
accgtgttct gcctgtctgt gtttgctctc attggactcc agctcttcat gggcaacctg 840
agacacaagt gtgtccggaa tttcactgcc ctcaatggca ccaatggatc tgtcgaggcc 900
gatggactgg tctgggaatc tctggatctg tacctgagcg atcctgaaaa ttacctgctg 960
aaaaacggaa catccgacgt cctgctgtgt ggcaactctt ccgatgccgg aacttgtcct 1020
gagggatacc ggtgtctgaa agccggggaa aatcctgacc acggctacac ctcattcgat 1080
tctttcgctt gggcattcct ggctctgttt cggctcatga cacaggactg ttgggaacgg 1140
ctgtaccagc agactctgag gagtgctggc aaaatctaca tgattttctt tatgctcgtg 1200
atcttcctgg gatctttcta cctcgtgaat ctcattctgg ctgtcgtggc tatggcttac 1260
gaggaacaga atcaggccac aattgccgaa actgaggaaa aggagaaacg gttccaggaa 1320
gccatggaaa tgctcaaaaa ggagcatgag gcactcacca ttagaggagt cgatactgtg 1380
agtcggtcat cactggaaat gagccctctg gctcctgtga attcccacga acgacggtct 1440
aaacggcgaa aacgaatgtc atctgggacc gaggaatgtg gagaggatcg actgcccaaa 1500
tccgatagcg aggacggacc tcgagcaatg aatcacctgt ccctcacccg gggactgtct 1560
cgaacttcta tgaaacctcg gagtagtagg ggatcaatct tcactttccg acggcgggac 1620
ctgggctctg aggccgactt tgccgatgac gaaaactcta ctgccggcga atctgagtct 1680
catcatacta gcctgctggt gccttggcca ctgaggcgaa catccgccca ggggcagcct 1740
agtcccggca ctagtgctcc cggacatgcc ctccacggca aaaaaaactc caccgtggac 1800
tgtaatggag tcgtgtcact gctgggagct ggcgatcccg aggcaacttc ccctggatct 1860
catctgctga ggcccgtgat gctggagcat cctcccgata caacaacccc atccgaggag 1920
cctggcggac cacagatgct cacatctcag gccccatgtg tggacggctt tgaggaaccc 1980
ggcgctcgcc agagagcact ctctgctgtc tccgtgctca cttctgctct ggaggaactc 2040
gaagaaagca gacataagtg ccctccatgt tggaatcgac tggctcagag atacctcatt 2100
tgggaatgct gtcctctgtg gatgtccatc aaacagggcg tcaaactggt ggtgatggat 2160
ccttttaccg acctcaccat taccatgtgt atcgtcctca acaccctctt tatggccctc 2220
gaacactaca atatgactag cgaatttgag gagatgctcc aggtcgggaa tctggtgttt 2280
accggaatct ttaccgctga aatgaccttc aaaatcattg ccctggaccc atactactac 2340
ttccagcagg gctggaacat tttcgactct atcatcgtga tcctgtcact catggaactg 2400
ggcctgtcac ggatgagtaa tctgtctgtg ctgaggagct ttagactgct ccgagtgttc 2460
aaactggcca aatcttggcc taccctgaat accctcatca aaatcatcgg gaactccgtg 2520
ggggctctgg gaaatctcac actggtgctg gccattatcg tcttcatctt tgccgtggtc 2580
ggaatgcagc 2590
<210>7
<211>2122
<212>DNA
＜213〉the fragment NaV15_6AhH1-B of people's sodium-ion channel albumen humanNaV15_6AhH1 gene
<400>7
actggtgctg gccattatcg tcttcatctt tgccgtggtc ggaatgcagc tgtttggaaa 60
aaactactct gaactccggg atagcgattc tggactgctc cctcggtggc atatgatgga 120
tttcttccac gccttcctca tcattttccg gatcctgtgt ggcgaatgga tcgagacaat 180
gtgggactgt atggaggtgt ccggacagtc tctgtgtctg ctggtgtttc tcctggtcat 240
ggtgattggg aacctggtcg tgctgaacct gtttctggct ctgctcctct cttctttctc 300
tgccgacaac ctcactgctc ccgacgagga tagagagatg aataacctcc agctcgccct 360
ggctagaatc cagaggggac tccgattcgt caaacgaaca acttgggact tctgctgtgg 420
gctgctgaga cagcgacctc agaaacctgc tgctctggcc gctcagggac agctcccatc 480
ttgtattgcc actccctact caccccctcc acctgaaacc gaaaaagtgc ccccaacacg 540
aaaggaaact cgctttgagg agggcgaaca gcctggacag ggaacacctg gagatcctga 600
acctgtgtgt gtgcctattg ctgtggctga atccgatacc gatgatcagg aggaggacga 660
ggagaattct ctgggcactg aggaggaatc ctctaaacag gagtcacagc ctgtctctgg 720
gggacctgaa gctccacccg atagtagaac atggtcccag gtgtccgcta ctgcttcttc 780
cgaggctgag gcttctgcct ctcaggccga ttggaggcag cagtggaaag ccgaaccaca 840
ggcccctgga tgtggggaaa ctcctgagga ctcttgctct gagggatcaa ctgccgatat 900
gacaaacacc gccgaactgc tggagcagat tcccgatctc ggccaggacg tgaaagatcc 960
tgaggattgc ttcactgagg gctgtgtgcg gcggtgccct tgctgcgctg tcgataccac 1020
tcaggcaccc gggaaagtgt ggtggcgact gagaaaaact tgctaccata ttgtggaaca 1080
ctcatggttt gagactttca tcatcttcat gattctgctg agttctggag cactggcctt 1140
cgaggacatc tacctggagg aacggaaaac aatcaaagtc ctgctcgagt acgccgacaa 1200
aatgttcacc tacgtctttg tgctggaaat gctgctgaaa tgggtggcct acggcttcaa 1260
aaaatacttc accaacgcct ggtgctggct cgatttcctc atcgtggatg tgtctctcgt 1320
gtcactggtg gccaatactc tgggatttgc cgaaatgggc cccatcaaat cactccgaac 1380
actgagggct ctccggcctc tccgggctct gtcacgcttt gagggcatga gagtggtggt 1440
gaatgctctc gtgggcgcta ttccttctat tatgaacgtg ctgctggtct gtctcatctt 1500
ttggctcatc tttagcatca tgggcgtgaa tctcttcgct gggaaatttg ggcgctgtat 1560
caaccagact gagggagatc tgccactgaa ttacaccatc gtgaataaca aatcacagtg 1620
tgaatccctc aatctcaccg gagaactgta ctggaccaaa gtcaaagtga acttcgacaa 1680
tgtcggagcc ggctacctgg ctctgctcca ggtggcaacc tttaagggat ggatggatat 1740
catgtacgcc gctgtggata gtcgaggcta cgaggaacag ccacagtggg agtacaatct 1800
ctacatgtac atctacttcg tcattttcat cattttcgga tctttcttca ccctcaacct 1860
cttcattggc gtcatcatcg acaacttcaa ccagcagaaa aaaaagctgg gaggccagga 1920
catctttatg accgaggaac agaaaaaata ctacaatgcc atgaaaaaac tcggctccaa 1980
aaaaccccag aaacccatcc ctagacccct gaacaaatac cagggcttca ttttcgacat 2040
cgtgaccaaa caggccttcg acgtgactat catgtttctc atctgcctga atatggtgac 2100
catgatggtg gaaaccgacg at 2122
<210>8
<211>1462
<212>DNA
＜213〉the fragment NaV15_6AhH1-C of people's sodium-ion channel albumen humanNaV15_6AhH1 gene
<400>8
tgtttctcat ctgcctgaat atggtgacca tgatggtgga aaccgacgat cagtctcctg 60
aaaaaatcaa catcctcgcc aaaatcaatc tgctcttcgt ggccattttt accggcgagt 120
gtattgtgaa actggctgct ctgagacact actactttac caactcttgg aacatcttcg 180
actttgtggt ggtgatcctg tctattgtgg gaactgtgct ctccgatatc atccagaaat 240
acttcttctc ccctaccctc tttagagtca tccggctggc tagaattgga cggattctga 300
ggctcattcg aggcgctaag ggaattcgaa cactgctctt tgccctcatg atgtctctgc 360
ctgccctgtt caatattggc ctgctgctct ttctcgtgat gttcatctac tccatcttcg 420
gcatggccaa tttcgcttac gtgaaatggg aggctggaat cgacgacatg ttcaacttcc 480
agaccttcgc caactctatg ctgtgtctgt ttcagatcac tactagtgct ggctgggacg 540
gactgctgtc tcctatcctc aataccggac ccccttactg tgaccctaca ctgcccaact 600
caaacggctc tagaggcgat tgtgggagtc ccgctgtggg gattctcttc tttacaacct 660
acattatcat ctcattcctc atcgtggtga acatgtacat tgccatcatc ctggaaaatt 720
tctccgtggc tactgaggag tcaactgagc ccctctccga ggacgacttc gacatgtttt 780
acgagatctg ggaaaaattc gaccctgagg ccacacagtt tatcgagtac tccgtcctga 840
gcgatttcgc cgatgctctg tccgaaccac tccgaattgc taaaccaaat cagatttccc 900
tcatcaatat ggatctgccc atggtgagtg gcgatagaat tcactgtatg gacatcctgt 960
tcgccttcac taaacgagtg ctcggggaga gtggggaaat ggatgccctg aaaatccaga 1020
tggaagagaa gtttatggcc gccaaccctt ctaaaatctc ctacgaacca atcacaacaa 1080
cactgaggcg gaaacacgaa gaagtgagcg ccatggtcat tcagagagcc tttaggcgac 1140
atctgctcca gagatccctc aaacacgctt cctttctctt ccggcagcag gctggatctg 1200
gactgtctga ggaggatgct cccgaacgag agggactcat tgcttacgtc atgtccgaga 1260
actttagtag gccactggga ccaccctcat cttcatcaat ctcatcaact tcattccccc 1320
catcctacga ttctgtgact agggccacta gcgacaatct ccaggtccgg ggatccgatt 1380
actcacattc cgaggacctc gccgatttcc caccttctcc cgatcgggat cgagagtcta 1440
ttgtgtgatg atgagcggcc gc 1462
<210>9
<211>543
<212>DNA
＜213〉the A34R gene of vaccinia bacterial strain WR (Western Reserve)
<400>9
ggaacgcggc cgcgccacca tgaagtccct caacaggcag accgtgtcca ggttcaagaa 60
gctcagcgtc cccgccgcca tcatgatgat tctgagcacc atcatcagcg gcatcggcac 120
cttcctgcac tacaaagagg agctgatgcc cagcgcctgc gctaacggct ggatccagta 180
cgacaagcac tgctacctgg acaccaacat caagatgagc acagacaacg ccgtctacca 240
gtgtaggaag ctgagggcca gactccctag gcccgacaca aggcacctga gggtgctgtt 300
cagcatcttc tacaaggact actgggtgag cctgaagaag accaacaaca aatggctcga 360
catcaacaac gacaaagaca tcgacatcag caaactgacc aacttcaagc agctcaacag 420
caccaccgac gccgaggcct gctacatcta caagtccggc aagctggtgg agaccgtgtg 480
caaatccacc cagagcgtgc tctgtgtgaa gaagttctac aaatgatgat gaagatctgt 540
tcc 543
Claims (7)
1. industrialized method for synthesizing gene is characterized in that comprising the following steps:
Step 1: DNA sequence dna to be synthesized is analyzed and optimized, obtain and design consistent target dna sequence;
Step 2: according to target dna sequence described in step 1, be designed for the oligonucleotide chain of extension, the annealing temperature of described oligonucleotide chain is between 30 ℃～70 ℃;
Step 3: the described oligonucleotide chain of design in synthetic also purification step two;
Step 4: the described oligonucleotide chain that obtains in step 3 is spliced, form DNA fragmentation;
Step 5: the described DNA fragmentation that obtains in step 4 is cloned into the plasmid recombinant that carrier obtains described target dna sequence and carrier;
Step 6: described plasmid recombinant is carried out sequencing analysis;
Step 7: correct described plasmid recombinant carries out quality verification to checking order;
The step that is designed for the oligonucleotide chain of extension in wherein said step 2 is:
One, described target dna sequence is designated as normal chain, the complementary strand of normal chain is designated as minus strand, is segmented into end to end DNA fragmentation, and the length of every segment DNA fragment is between 200～20000 base pairs;
two, every segment DNA fragment is divided into again a plurality of oligonucleotide chains, the length of each oligonucleotide chain is between 20～60 bases, the oligonucleotide chain that each oligonucleotide chain is adjacent with its left and right has the overlapping complementary sequence of head and the tail, the length of the overlapping complementary sequence between the oligonucleotide chain that each oligonucleotide chain is adjacent is between 20～50 bases, from 5 of described DNA fragmentation '-end begin oligonucleotide chain is numbered in order, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, the quantity of the oligonucleotide chain in described DNA fragmentation is all even number,
Three, 5 of described target dna sequence '-oligonucleotide chain of last numbering of first DNA fragmentation of end 5 '-oligonucleotide chain of first numbering of second DNA fragmentation holding and be adjacent 5 '-end has overlapping complementary sequence, the like, between every two adjacent DNA fragmentations, overlapping complementary sequence is arranged;
Four, be positioned at target dna sequence 5 '-oligonucleotide chain of end 5 '-end add one section with carrier on the overlapping sequence of the upstream sequence of target dna sequence insertion point, described overlapping sequence is the DNA sequence dna of length between 0～100 base;
Five, be positioned at target dna sequence 3 '-oligonucleotide chain of end 5 '-end add one section with carrier on the sequence of the overlapping complementation of downstream sequence of target dna sequence insertion point, the sequence of described overlapping complementation is the DNA sequence dna of length between 0～100 base;
The joining method of the described oligonucleotide chain in wherein said step 4 is any one in connection enzyme process and PCR method;
Described connection enzyme process comprises the following steps:
(1) be designed for the oligonucleotide chain of extension, make the overlapping complementation of the adjacent oligonucleotide chain in every oligonucleotide chain and left and right, from 5 of DNA fragmentation '-end begin oligonucleotide chain is numbered, wherein the oligonucleotide chain of odd number is normal chain, the oligonucleotide chain of even number is minus strand, and the quantity of the oligonucleotide chain of every DNA fragmentation is all even number;
5 of each oligonucleotide chain that (2) will synthesize '-end carries out phosphorylation, make on the oligonucleotide chain band 5 '-phosphate group;
(3) synthetic oligonucleotide chain is according to number order, in the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide chain, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide, described normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add resistant to elevated temperatures Taq DNA ligase or T4 DNA ligase to carry out splicing reaction, reaction conditions is as follows:
94 ℃～96 ℃ sex change 2min～5min, the 30min that slowly anneals drops to 30 ℃～60 ℃ to temperature, hatches 30min～60min for 40 ℃～60 ℃;
(4) get recovery product in step (3) as template, add the oligonucleotide chain at head and the tail two ends in DNA fragmentation as primer, add archaeal dna polymerase to carry out pcr amplification, finally obtain a large amount of DNA fragmentations; The reaction conditions of described pcr amplification is as follows:
94 ℃～96 ℃ denaturation 2min～5min carry out 1 circulation; Afterwards, 95 ℃ of sex change 15s～30s, the 15s～30s that anneals under the annealing temperature Tm of oligonucleotide chain, 72 ℃ of extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 18～25 circulations; At last, 72 ℃ are extended 1min～7min;
Described PCR method comprises the following steps:
(1) describedly has the oligonucleotide chain of overlapping complementary sequence according to number order with synthetic, in the described oligonucleotide chain that refers to be blended in same system according to number order first of number order be lowest number be that odd number is the normal chain oligonucleotide, last in number order namely maximum numbering be that even number is the minus strand oligonucleotide, described normal chain oligonucleotide and minus strand oligonucleotide are blended in reaction system, add archaeal dna polymerase to increase;
(2) reaction conditions of PCR method amplification is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, 5s～90s anneals under the annealing temperature Tm of oligonucleotide chain, 70 ℃～75 ℃ extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min; Can obtain target dna sequence;
The product of the pcr amplification for the first time that (3) obtains with described step (2) reclaims as template, adds the oligonucleotide chain as head and the tail two ends in the DNA fragmentation of primer, and adds archaeal dna polymerase to carry out pcr amplification for the second time, finally obtains DNA fragmentation; The reaction conditions of described pcr amplification for the second time is as follows:
94 ℃～96 ℃ denaturation 0～10min carry out 1 circulation; Afterwards, 95 ℃ of sex change 1s～60s, 5s～90s anneals under the annealing temperature Tm of oligonucleotide chain, 70 ℃～75 ℃ extensions, the extension time is 1min/3kb～1min/4kb, carries out altogether 10～40 circulations, and wherein the annealing temperature of each circulation reduces by 0 ℃～2 ℃ than last circulation; At last, 72 ℃ are extended 1min～10min.
2. industrialized method for synthesizing gene according to claim 1, it is characterized in that: in described step 3, the method for synthetic oligonucleotide chain is any one in phosphodiester method, phosphotriester method, tris phosphite method, solid-phase synthesis, automatization method and gene chips.
3. industrialized method for synthesizing gene according to claim 2; it is characterized in that: described solid-phase synthesis be 3 of the oligonucleotide chain that will will synthesize '-end first with 3 '-OH is connected with a solid phase carrier; then successively from 3 '-5 ' direction will protect the nucleotide monomer of active function groups to add up; form at last with 3 ', 5 '-oligonucleotide fragment that phosphodiester bond couples together.
4. industrialized method for synthesizing gene according to claim 1, it is characterized in that: in described step 3, the method for purification of oligonucleotides chain is any one in C18 post, OPC post, PAGE and HPLC.
5. industrialized method for synthesizing gene according to claim 1, it is characterized in that: described archaeal dna polymerase is the high temperature-resisting DNA polymerase of high-fidelity.
6. industrialized method for synthesizing gene according to claim 1 is characterized in that: it is any one in connection method, PCR method and homologous recombination method that described DNA fragmentation is cloned into method that carrier obtains plasmid recombinant.
7. industrialized method for synthesizing gene according to claim 6 is characterized in that: described homologous recombination method is any one in the restructuring splicing method of the restructuring splicing method of single fragment and carrier and multi-disc section and carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110249829 CN102321612B (en) | 2011-08-29 | 2011-08-29 | Industrialized gene synthesis method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110249829 CN102321612B (en) | 2011-08-29 | 2011-08-29 | Industrialized gene synthesis method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102321612A CN102321612A (en) | 2012-01-18 |
| CN102321612B true CN102321612B (en) | 2013-05-15 |
Family
ID=45449448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110249829 Active CN102321612B (en) | 2011-08-29 | 2011-08-29 | Industrialized gene synthesis method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102321612B (en) |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634534A (en) * | 2012-03-30 | 2012-08-15 | 深圳市中联生物科技开发有限公司 | Nucleic acid molecular cloning method and related kit based on homologous recombination |
| CN102978199A (en) * | 2012-12-04 | 2013-03-20 | 苏州大学 | Synthesis method of HIV-1 (human immunodeficiency virus-1) drug-resistant wild-type gene |
| CN103952396B (en) * | 2014-03-06 | 2016-08-24 | 湖北大学 | A kind of method for synthesizing gene without primer based on plasmid storehouse |
| US9745611B2 (en) * | 2014-05-06 | 2017-08-29 | Genewiz Inc. | Methods and kits for identifying microorganisms in a sample |
| CN105200035B (en) * | 2014-06-17 | 2019-02-22 | 中国科学院上海生命科学研究院 | The assembled in vitro method of high GC content large fragment DNA and application |
| CN105462958A (en) * | 2015-09-23 | 2016-04-06 | 苏州泓迅生物科技有限公司 | Artificial synthesis method of double-stranded DNA |
| CN105274088A (en) * | 2015-11-05 | 2016-01-27 | 苏州泓迅生物科技有限公司 | Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid) |
| CN105238777A (en) * | 2015-11-05 | 2016-01-13 | 苏州泓迅生物科技有限公司 | Method for high flux synthesis of nucleotide pool and assembling of double-stranded DNA from semiconductor chips |
| CN106282269B (en) * | 2016-08-16 | 2022-10-18 | 苏州泓迅生物科技股份有限公司 | Synthesis and assembly method of repetitive DNA and application thereof |
| CN107760742B (en) * | 2016-08-23 | 2022-10-11 | 南京金斯瑞生物科技有限公司 | Synthesis method of gene rich in AT or GC |
| CN107974448B (en) * | 2016-10-21 | 2023-04-14 | 南京金斯瑞生物科技有限公司 | Synthesis method of sequence complex gene |
| CN107287190A (en) * | 2017-06-21 | 2017-10-24 | 上海恩即斯生物科技有限公司 | Efficiently synthesize the method and its application of fusion |
| CN107828778A (en) * | 2017-10-12 | 2018-03-23 | 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） | A kind of full genome synthetic method |
| CN111378645B (en) * | 2018-12-27 | 2020-12-01 | 江苏金斯瑞生物科技有限公司 | Gene synthesis method |
| CN112175940A (en) * | 2019-07-03 | 2021-01-05 | 华大青兰生物科技(无锡)有限公司 | Exonuclease-based oligonucleotide purification method |
| CN110551802A (en) * | 2019-10-10 | 2019-12-10 | 周口师范学院 | Method for rapidly synthesizing whole gene sequence and application thereof |
| CN115605590A (en) * | 2021-02-10 | 2023-01-13 | 清华大学（Cn） | Method for preparing site-directed modified long-chain DNA |
| CN117070597B (en) * | 2023-10-17 | 2024-01-05 | 天津中合基因科技有限公司 | Method for synthesizing DNA sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1908167A (en) * | 2006-07-13 | 2007-02-07 | 上海交通大学 | Method for synthesizing isothermal unidirectional growth gene |
-
2011
- 2011-08-29 CN CN 201110249829 patent/CN102321612B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1908167A (en) * | 2006-07-13 | 2007-02-07 | 上海交通大学 | Method for synthesizing isothermal unidirectional growth gene |
Non-Patent Citations (6)
| Title |
|---|
| Krishna Jayaraman et al..Polymerase chain reaction-mediated gene synthesis of a gene coding for isozyme c of horseradish peroxidase.《Biochemisty》.1991,第88卷摘要，第4048页右栏第3-4段. |
| Polymerase chain reaction-mediated gene synthesis of a gene coding for isozyme c of horseradish peroxidase;Krishna Jayaraman et al.;《Biochemisty》;19910531;第88卷;摘要，第4048页右栏第3-4段 * |
| 合成人降钙素基因实验研究的初步报告;王秀利等;《河南医学研究》;20041231;第13卷(第4期);第294页左栏第2段，最后1段，右栏第4段 * |
| 应用PCR-酶切连接法合成全长sFat1基因;朱贵明等;《遗传》;20061231;第28卷(第9期);第1124页左栏第3段-右栏第4段 * |
| 朱贵明等.应用PCR-酶切连接法合成全长sFat1基因.《遗传》.2006,第28卷(第9期),第1124页左栏第3段-右栏第4段. |
| 王秀利等.合成人降钙素基因实验研究的初步报告.《河南医学研究》.2004,第13卷(第4期),第294页左栏第2段，最后1段，右栏第4段. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102321612A (en) | 2012-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102321612B (en) | Industrialized gene synthesis method | |
| JP6165789B2 (en) | Methods for in vitro linking and combinatorial assembly of nucleic acid molecules | |
| CN104114702B (en) | Template switch is used for the purposes of DNA synthesis | |
| EP3828277B1 (en) | Compositions, methods and apparatus for oligonucleotides synthesis | |
| US8367335B2 (en) | Programmable oligonucleotide synthesis | |
| CN104685116A (en) | Methods for nucleic acid assembly and high throughput sequencing | |
| CN105543266A (en) | CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat sequences)-Cas (CRISPR-associated proteins) system in Streptomyces virginiae IBL14 and method for carrying out gene editing by using CRISPR-Cas system | |
| CN104603286A (en) | Methods for sorting nucleic acids and multiplexed preparative in vitro cloning | |
| WO2006127423A2 (en) | Methods of producing polynucleotide libraries using scarless ligation | |
| JP2022548062A (en) | Modified bacterial retroelements with enhanced DNA production | |
| CN113564164B (en) | Carrier and method for improving pilot editing efficiency | |
| El-Sagheer et al. | Single tube gene synthesis by phosphoramidate chemical ligation | |
| EP2733208B1 (en) | Method for large-scale synthesis of long-chain nucleic acid molecule | |
| CN108026525A (en) | The composition and method of polynucleotides assembling | |
| CN113166741A (en) | Multiple deterministic assembly of DNA libraries | |
| CN104109683A (en) | Primer-free gene synthesis method | |
| CN108486140A (en) | A kind of cloning vector preparation method and kit based on seamless clone technology | |
| Graf et al. | Rationales of gene design and de novo gene construction | |
| US9944966B2 (en) | Method for production of single-stranded macronucleotides | |
| US20220162687A1 (en) | Novel systems, methods and compositions for the direct synthesis of sticky ended polynucleotides | |
| Tan et al. | Research Progress on the Assembly of Large DNA Fragments | |
| TW201336992A (en) | New actinomycete integrative and conjugative element from Actinoplanes sp. SE50/110 as plasmid for genetic transformation of related actinobacteria | |
| Koch | Recombinant DNA and Biotechnology | |
| CN116615547A (en) | System and method for transposing nucleotide sequences of cargo | |
| CN115605590A (en) | Method for preparing site-directed modified long-chain DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |