CN102317772A - Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase - Google Patents
Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase Download PDFInfo
- Publication number
- CN102317772A CN102317772A CN2008800157636A CN200880015763A CN102317772A CN 102317772 A CN102317772 A CN 102317772A CN 2008800157636 A CN2008800157636 A CN 2008800157636A CN 200880015763 A CN200880015763 A CN 200880015763A CN 102317772 A CN102317772 A CN 102317772A
- Authority
- CN
- China
- Prior art keywords
- gene
- ras
- patient
- aml
- treatment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57426—Specifically defined cancers leukemia
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B26—HAND CUTTING TOOLS; CUTTING; SEVERING
- B26F—PERFORATING; PUNCHING; CUTTING-OUT; STAMPING-OUT; SEVERING BY MEANS OTHER THAN CUTTING
- B26F1/00—Perforating; Punching; Cutting-out; Stamping-out; Apparatus therefor
- B26F1/18—Perforating by slitting, i.e. forming cuts closed at their ends without removal of material
- B26F1/20—Perforating by slitting, i.e. forming cuts closed at their ends without removal of material with tools carried by a rotating drum or similar support
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B21—MECHANICAL METAL-WORKING WITHOUT ESSENTIALLY REMOVING MATERIAL; PUNCHING METAL
- B21D—WORKING OR PROCESSING OF SHEET METAL OR METAL TUBES, RODS OR PROFILES WITHOUT ESSENTIALLY REMOVING MATERIAL; PUNCHING METAL
- B21D28/00—Shaping by press-cutting; Perforating
- B21D28/02—Punching blanks or articles with or without obtaining scrap; Notching
- B21D28/14—Dies
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B21—MECHANICAL METAL-WORKING WITHOUT ESSENTIALLY REMOVING MATERIAL; PUNCHING METAL
- B21D—WORKING OR PROCESSING OF SHEET METAL OR METAL TUBES, RODS OR PROFILES WITHOUT ESSENTIALLY REMOVING MATERIAL; PUNCHING METAL
- B21D37/00—Tools as parts of machines covered by this subclass
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Hematology (AREA)
- Mechanical Engineering (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Forests & Forestry (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Shaping Metal By Deep-Drawing, Or The Like (AREA)
Abstract
A simple two gene expression assay, RASGRPI:APTX, with utility in diagnosing a population of acute myeloid leukemia (AML) patients who are more likely to respond to farbesyltransferase inhibition with tipifamib (RI15777. ZARNESTRA).
Description
Background of invention
There is not the reaction of available method prediction at present to farnesyl transferase inhibitor.Zarnestra (Tipifarnib) is that first is by the farnesyl transferase inhibitor of clinical testing (FTI).Rowinsky etc. (2006).It shows significant activity in the blood disease that comprises AML, MM, MDS and CML, the complete reaction rate in AML and MDS is up to about 15%.Mesa etc. (2006); Lancet etc. (2007); Fenaux etc. (2007); And Harousseau etc. (2007).FTI partly adds a lot of signal of interest molecules that comprise Ras to and works through suppress farnesyl competitively.(2002) such as Rowinsky etc. (2006) and Cox.
In order to interact with the inner leaflet of cytoplasma membrane and to participate in various signal transduction paths, must carry out farnesylation with farnesyl transferase to some molecules relevant such as Ras with cancer.Ras is not unique cancer GAP-associated protein GAP with prenyl CAAX frame.Farnesyl transferase inhibitor (FTI) is the covalently bound therapeutic agent of C-end CAAX die body that suppresses carbon farnesyl part and various albumen.They have treatment cancer and proliferative diseases such as leukemic effect.(acute myelogenous leukemia is that available FTI handles one of the disease of (address) the most valuably AML) to acute myelocytic leukemia.
As the truth that is reflected in many therapeutic schemes, some patient reacts to FTI treatment and other are quite different.Giving to write a prescription to the patient that treatment reacts is not what the phase needed.Therefore, usefully, at first understanding the patient before the administration will have reaction how to such treatment expection, so that non-reactor needn't be accepted treatment in rain, and make those patients that have an opportunity to benefit from those medicines most obtain suitable treatment and monitoring.In addition, among those patients that treatment is reacted, possibly there is the extent of reaction that has nothing in common with each other.For those FTI is not had reaction or possibly be useful with the treatment of the treatment of non-FTI therapeutic agent or FTI coupling therapeutic agent the patient that the reaction of independent FTI is lower than expection.
All the time, the sudden change situation of ras gene is considered to the candidate biological marker of patient to the FTI reaction.This theory based on following clinical before evidence: FTI can block the Ras cell transformed and at the constitutively activate of inner specified point sudden change the causing Ras approach in many cancers of ras gene.(1989) such as End etc. (2001) Reuter etc. (2000) and Bos.Because general receivedly be: tumour seriously relies on the activation (" oncogene insertions " hypothesis) of one or two approach, and what said hypothesis was followed is that the medicine that promotes the patient of its tumour to tackle this approach of inhibition by particular approach reacts.Weinstein etc. (2006).Yet, by way of can being activated, and have found that Ras can be by incremental adjustments under the activation that does not exist the Ras sudden change by a plurality of incidents.Ehmann etc. (2006).In addition, in clinical research, prove: do not have relevance in the ras sudden change with between to the FTI reaction.Karp etc. (2001); With 2007004878.When several early stage clinical researches concentrated on the cancer that shows high-frequency ras sudden change, reaction rate was disappointingly low really in those tests.Mesa (2006); Rao etc. (2004); With (2004) such as Van Cutwem.
Summary of the invention
We are according to the suddenly change quantitative PCR (qPCR) of situation, total gene expression and/or specific gene of N-Ras; Analyzed marrow from 67 patients; Said patient is to Zarnestra (R115777;
) suppress the second phase research of farnesyl transferase; (acute myeloid leukemia AML) carries out among the low-risk the elderly at prior untreated acute myeloid leukaemia in said research.Microarray profile analysis (microarray profiling) has confirmed that two kinds of expression of gene are than (RASGRP1: APTX), it provides and has been used to predict the maximum accuracy to the reaction of Zarnestra.We proved this classification thing (classifier) measurable in from the independent groups of recurrence or 54 samples of intractable AML to the reaction of Zarnestra, NPV and PPV are respectively 92% and 28% (odds ratio is 4.4).Therefore, in the AML and recurrence or intractable AML of new diagnosis, this classification thing makes the overall reaction rate improve about 50% and keeps high NPV simultaneously, and significantly improves total survival period of patient.In 30 AML samples from identical clinical research; This two gene classification thing is also verified by qPCR; Show negative predictive value (negative predictive value; NPV) and positive predictive value (positive predictivevalue PPV) is respectively 81% and 50% (odds ratio 4.3).These data show that easy two gene expression mensuration can be applicable to diagnosis more maybe be to the aitiogenic AML patient crowd of Zarnestra.
Microarray technology has been applied to identified gene and has expressed overview (gene expressionprofile), through in the measurable various cancers of this gene expression overview to a lot of different therapeutic modalities reaction and the resistance of (comprising breast cancer, dispersivity large B cell lymphoid tumor and leukemic chemotherapy or endocrinotherapy).Ma etc. (2004); (2005) such as Chang etc. (2003) Jansen; Potti etc. (2006); Shipp etc. (2002); Rosenwald etc. (2002); Lossos etc. (2004); (2004) such as Yeoh etc. (2002) and Holleman.We have used the gene expression profile analysis to confirm in recurrence or intractable AML the molecule prediction thing (molecular predictor) to the reaction of Zarnestra in advance.20070048782。We expand to this work on the AML of diagnosis newly at this, and this has facilitated the two gene expression ratio (RASGRP1: evaluation APTX) of measurable clinical effectiveness.We further shown this classification thing can with qPCR analyze and the recurrence or intractable AML in forecasting power is arranged.
The accompanying drawing summary
Fig. 1 has described in AML as the performance to the RASGRP1 gene of the prediction thing of Zarnestra reaction.In the AML that newly makes a definite diagnosis, use accuracy rate (A) and Kapp orchid-Meyer (Kaplan-Meier) survival curve (B) of RASGRP1 gene classification thing.
Fig. 2 has described in AML the RASGRP1 as prediction thing that should be anti-to Zarnestra: the performance of APTX gene pairs.Described with the AML patient who newly makes a definite diagnosis (A) of 2-gene classification thing layering (stratify) and total survival period of recurrence/intractable AML patient (C) through Kapp orchid-Meyer analysis mapping.The accuracy rate that has shown the 2-gene classification thing in AML that newly makes a definite diagnosis (B) and recurrence/intractable AML (D).
Fig. 3 has described the performance of RASGRP1:APTX gene classification thing through qPCR.(A) 20 reactors and 10 normalized RASGRP1 of PD patient: APTX Ct value.20 independent sample and 10 training samples that on microarray, move have been shown respectively.Whippletree has shown cell mean.(B) shown the accuracy rate of newly making a definite diagnosis the RASGRP1 genes classification thing among the AML patient at all 30, with 0 brachymemma value with patient's layering.(C) with the relevant total survival period mapping of Kapp orchid-Meyer analysis to the layering patient.
Fig. 4 has described in recurrence and intractable AML the performance as the RASGRP1 gene of the prediction thing that Zarnestra is reacted.In recurrence/intractable AML, use the accuracy rate (A) and the kaplan-Meier survival curve (B) of RASGRP1 gene classification thing.
Fig. 5 has described and used RASGRP1: APTX gene expression is than total survival period of the AML patient of the non-FTI treatment of layering.Three cDNA probes that are used for RASGRP1 and APTX are present in the active data group.We at first calculate the mean value of every kind of gene, calculate the RASGRP1 of these values then: the APTX ratio.Ratio classifies as progress person the patient more than 1, and those ratios are lower than 1 patient and classify as reactor.Carry out Kapp orchid-Meyer analysis then.
Fig. 6 has described Affymetrix and qPCR correlation of data.9 RNA samples that carried out analysis simultaneously with Affymetrix genetic chip and qPCR have been compared through linear regression analysis.
Detailed Description Of The Invention
The therapeutic agent that in this instructions, relates to is FTI.They present various ways, but the total basic inhibit feature that disturbs or weaken the farnesylation of cancer and proliferative diseases GAP-associated protein GAP.Preferably those are applicable to the FTI of treatment leukaemia such as AML to FTI.The patient that FTI is reacted is meant that those surpass the patient that 50% mother cell descends with back in marrow, can the seeing of FTI treatment.
Multiple FTI is included in 5,976,851 within the scope of the invention; 5,972,984; 5,972,966; 5,968,965; 5,968,952; 6,187,786; 6,169,096; 6,037,350; 6,177,432; 5,965,578; 5,965,539; 5,958,939; 5,939,557; 5,936,097; 5,891,889; 5,889,053; 5,880,140; 5,872,135; 5,869,682; 5,861,529; 5,859,015; 5,856,439; 5,856,326; 5,852,010; 5,843,941; 5,807,852; 5,780,492; 5,773,455; 5,767,274; 5,756,528; 5,750,567; 5,721,236; 5,700,806; 5,661,161; 5,602,098; 5,585,359; 5,578,629; 5,534,537; 5,532,359; 5,523,430; 5,504,212; 5,491,164; 5,420,245; With 5,238, those that describe in 922.Preferred non-peptide class i.e. the therapeutic agent of " micromolecule ".More preferably FTI is for example following quinoline or quinoline:
7-(3-chlorphenyl)-9-[(4-chlorphenyl)-1H-imidazoles-1-ylmethyl]-2,3-dihydro-1H, 5H-benzo [ij] quinolizine-5-ketone,
7-(3-chlorphenyl)-9-[(4-chlorphenyl)-1H-imidazoles-1-ylmethyl]-1,2-dihydro-4H-pyrrolo-[3,2,1-ij] quinoline-4-ketone,
8-[amino (4-chlorphenyl) (1-methyl isophthalic acid H-imidazoles-5-yl), methyl]-6-(3-chlorphenyl)-1,2-dihydro-4H-pyrrolo-[3,2,1-ij] quinoline-4-ketone and
8-[amino (4-chlorphenyl) (1-methyl isophthalic acid H-imidazoles-5-yl) methyl]-6-(3-chlorphenyl)-2,3-dihydro-1H, 5H-benzo [ij] quinolizine-5-ketone.Most preferred FTI is (B)-6-[amino (4-chlorphenyl) (1-methyl isophthalic acid H-imidazoles-5-yl) methyl]-4-(3-chlorphenyl)-1-methyl-2 (1H)-quinolinone).
Comprise aspect FTI and other therapeutic agent treatment leukaemia in the present invention; The therapeutic agent that in this instructions, relates to be through the leukaemia the gene expression analysis explanation to influential those therapeutic agents of biological approach, said leukaemia accepted the treatment based on the FTI of quinolinone (quinilone).
Just in genome, have the nucleotide sequence (" gene ") of marking protein or polypeptide potentiality, can not determine whether protein or polypeptide express in set cell.Even have, can marking protein or whether the set gene of polypeptide expresses and such expression takes place also to depend on a lot of complicated factors to degree how.No matter the difficulty of understanding and estimating these factors how, can provide about useful information the cell effect of set stimulation (as introducing medicine or other therapeutic agent) to the analysis of gene expression.Gene relative indication active or inactive degree can be found in the gene expression overview.Gene expression overview of the present invention is used for identifying and treating the patient that possibly benefit from set therapy, perhaps gets rid of the patient and accepts this patient and may produce the less set therapy that does not even produce useful reaction to medicine or therapy.
The method for optimizing (comprising that those are used for drawing the method for associated biomolecule approach explanation) of setting up the gene expression overview comprises RNA that gene the produced amount of mensuration by codified protein or polypeptide.This accomplishes through following method: reverse transcription PCR (RT-PCR), competitive RT-PCR, real-time RT-PCR, differential RT-PCR, rna blot analysis and other correlation test.Though can use each other PCR to react these technology of implementing, preferably amplify the copy DNA that amplification produces by mRNA (copy DNA, cDNA) or copy RNA (copy RNA cRNA) and through microarray analyzes it.A lot of different array structures and their working method have been well known to those skilled in the art and have been described in following in United States Patent (USP): for example U.S. Patent number 5,445, and 934; 5,532,128; 5,556,752; 5,242,974; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,436,327; 5,472,672; 5,527,681; 5,529,756; 5,545,531; 5,554,501; 5,561,071; 5,571,639; 5,593,839; 5,599,695; 5,624,711; 5,658,734; With 5,700,637.
Microarray technology makes it possible to carry out simultaneously the measurement of the steady-state mRNA level of thousands of genes, so it has represented a kind of strong tool, is used to identify the cell biology effect and the possible result of treatment of identifying based on the analysis of these effects of FTI.There are two kinds of microarray technologies to be widely used at present.First kind is the cDNA array, and second kind is oligonucleotide arrays.Although in the structure of these chips, there are differences, nearly all downstream data analysis is identical with output.The measurement result of the signal intensity that the result of these analyses normally receives from the probe of mark, this probe be used for detecting from sample with microarray on the cDNA sequence of nucleic acid array hybridizing of known location.Usually, signal intensity is directly proportional with the amount of cDNA, therefore also is directly proportional with the mRNA that in sample cell, expresses.A lot of such technology all are effective and useful.Can be 6,271,002; 6,218,122; 6,218,114; With 6,004, find the method for optimizing of measuring gene expression in 755.
Implement analysis through comparing these intensity to expression.Preferably the ratio value matrix (ratio matrix) of the gene expression intensity in control sample is accomplished through the gene expression intensity that generates in the sample.For example, can compare with the expression intensity of the tissue that results from identical not treated with medicaments coming from the gene expression intensity of the tissue of treated with medicaments.The multiple that the ratio of these expression intensities is presented at gene expression between sample and the control sample changes.
Can also multiple mode show the gene expression overview.The most frequently used method is that the ratio arranged is become dendrogram (graphical dendogram), and file is represented sample among this figure, and horizontally-arranged is represented gene.Data are so arranged so that to have a gene of similar expression overview near each other.Each expression of gene is than displaying through color.For example, the ratio less than 1 (show be decrement regulate) can be presented at the blue portion in the spectrum (spectrum), and greater than 1 ratio (showing it is incremental adjustments) can be in spectrum shown in red part.Commercial computer software program (comprising from " OMNIVIZ PRO " software of Batelle with from " TREE VIEW " software of Stanford) can be used to show this data.
Discrepant range gene is being regulated by incremental adjustments or decrement in the diseased cells of FTI treatment in the expression.It is relative term that incremental adjustments and decrement are regulated, and the meaning is in the gene expression amount for a certain baseline, to find detectable difference (removing Effects of Noise in the system that is being used for measuring).In this case, said baseline is exactly the measured gene expression in the untreated diseased cells.When using same measuring method, the target gene in the diseased cells of treatment is regulated by incremental adjustments or decrement with respect to baseline values.Preferably, the multiple of intensity measurements based on the micromatrix probe of hybridization changes the level of distinguishing the decrement adjusting.Preferably 1.5 times difference is used to carry out such differentiation.That is to say, when finding when the cell of treatment is higher than 1.5 times intensity at least or is lower than 1.5 times intensity at least than untreated cell generation, to think that then there is differential expression in gene between treatment and untreated diseased cells.More preferably 1.7 times difference in gene expression is measured, most preferably 2 or the bigger difference of multiple.
One cover gene (a portfolio of gene) be one group by gene with the classification of getting off: make the information of relevant this group gene that is obtained can be provided for making the basis of clinical correlated judgment (for example diagnosis, prognosis or treat selection).In this case, each overlaps the judgement that gene supports and comprises the leukemia treating with FTI.Many cover gene expression overviews can be made up of the assortment of genes.
Method of the present invention comprises: relatively the gene expression overview of range gene possibly react to the use of therapeutic agent to determine whether the individual.Set up the gene expression overview of distinguishing reactor and non-reactor, each one gene expression overview is installed on medium (computer-readable medium as described below).Obtain containing patient's sample of diseased cells (like the hemocytoblast under the AML situation).From disease patient cell, obtain sample RNA then and increase, preferably obtain gene expression overview about the gene in suitable many covers gene through microarray.Then the expression overview of sample and those overviews of before confirming as reactor and non-reactor are compared.If the sample expression pattern is consistent with the non-reaction table expression patterns of FTI, shows so and can use FTI to treat.Preferably, based on the consistance of confirming expression pattern according to the intensity measurements of the above-mentioned microarray that reads.
Can in the same way the gene expression profile analysis be used for the monitor treatment reaction.In the one side of this method, can aforesaid gene expression analysis be applied to the patient through the FTI treatment at whole course of treatment of different times.If gene expression pattern is consistent with reactor, then can continue patient's treatment.If inconsistent, then can patient's treatment be changed into and use other therapeutic agent such as tyrosine kinase inhibitor, change dosage, or get rid of the FTI treatment.Such analysis make can perceptible clinical marker (clinical indicia) during before or in the face of other indeterminate clinical marker to getting involved and treatment is regulated.
Might obtain following indefinite result: some of them gene expression overview is for be indicated as reactor is indicated as non-reactor in others record in some aspects.For example, overview can show: three genes are by incremental adjustments and consistent with reactor, but another gene is not the general situation for the respondent by incremental adjustments.In this case, available statistical algorithms confirms that the patient is to drug response or nonreactive possibility.Be applicable to that the statistical algorithms of this purpose is known and for available.
Goods of the present invention (article) have represented to be applicable to that treatment, diagnosis, prediction, staging and other estimate the gene expression overview of disease mode, and it is simplified (reduce) becomes for example computer-readable medium (magnetic medium, light medium or the like) of the medium that can read automatically.These goods also can be included in being used in this medium and estimate the instructions of gene expression overview.For example, these goods can comprise the CD ROM of the calculation instructions that contains the gene expression overview that is useful on more above-mentioned many cover genes.These goods also contain digitized record to central gene expression overview, so as available they with compare from the gene expression data of patient's sample.Perhaps, can different representative form write down overview.Graphic recording is with regard to a kind of such form.Fig. 1 has shown the instance of the graphic presentation of this record.Can participate in these visualization of data best such as above mentioned merging to " OMNIVIZ " and those clustering algorithms (clustering algorithm) in " TREE VIEW " computer program.
Other goods of the present invention are to be mounted the above-mentioned nucleic acid array (for example cDNA or oligonucleotide arrays) of distinguishing gene expression overview of the present invention.
Use cluster analysis (comprising algorithm mentioned above), can compare the expression of patient's sample, have the adjusting relation between the gene of certain statistics confidence level with foundation.Can make up dynamic figure based on such expression data.This science of heredity network chart is useful for drug discovery.For example, in case identify basic target gene, then find out a series of potential upstream regulation genes with this science of heredity network chart.Then determined gene or their expression product are carried out its analysis as the drug targets aspect.In some embodiments, the regulatory function of determined specific gene is used to confirm to be used to treat leukemic therapeutic agent.
Transcriptional regulatory, RNA processing and rna editing all are through being accomplished by their protein of coded by said gene.In addition, dna sequence dna can be implemented the Long-distance Control to other gene expression through position effect.Therefore, gene expression is often regulated by other expression of gene.With respect to gene that is conditioned or downstream gene, those regulatory gene are called as upstream gene.In a simple adjusting approach: A++>B-->C++>D, wherein: A, B, C, D are genes, ++ be last conciliation,--for decrement is regulated.Gene A is the upstream gene of gene B, and B is the upstream gene of C.What one skilled in the art will realize that is that network often becomes ring and inner linking to each other.In some instances, expression of gene is used as positive feedback or degenerative himself product is regulated.
Clustering methodology its expression gene that is mutually related that is used to classify.Clustering methodology is specified in Harfigan (1975) Clustering Algorithms, NY, John Wile and Sons, Inc and Everritt, the 2nd edition .London HeinemanEducational books of (1980) Cluster Analysis, Ltd.Path analysis (path analysis) is used to decompose the relation between the variable and is used to test the Causal model of hereditary network.In the leukaemia, a plurality of main target of medicine is accredited as the kind of one or more medicines that can be used for treating this cell.According to the present invention, medicine is any compound with any degree complicacy that disturbs the biology system.
The biological effect of medicine can be the result of the following variation of medicine mediation: one or more RNA transcribe or the speed of the speed of variation, one or more polypeptide translations or the processing of translation back of degradation rate or degree change, one or more protein degradations or degree change, one or more protein effects or active inhibition or variation of stimulation or the like.Except preferred FTI, the preferred medicine of the present invention is those medicines of regulating MAPK/ERK signal transduction pathway, TGF-β, WNT or apoptosis pathway.These medicines include but not limited to: tyrosine kinase inhibitor, MEK inhibitors of kinases, P13K inhibitors of kinases, map kinase inhibitor, apoptosis regulator and combination thereof.Most preferred illustrative drug is Novartis " GLEEVEC " tyrosine kinase inhibitor, U-0126MAP inhibitors of kinases, PD-098059MAP inhibitors of kinases, SB-203580MAP inhibitors of kinases, antisense strand (antisense), ribozyme and the anti-apoptosis agent of DNA enzyme Bcl-XL in these medicines.Other has the instance of medicament to include but not limited to 6,306,897 coumarin kind compound, 6,284,764 substituted bicyclic, 6,133,305 indoline and 6,271,210 ASON.
Like what write down, medicine of the present invention can be the therapeutic agent that relates to gene therapy or antisense therapy.The complementary oligonucleotides of sequence and mRNA sequence can be introduced into the translation of cell with blocking-up mRNA, thus the function of the gene of blocking-up coding mRNA.For example at Strachan and Read, Human Molecular Genetics has described the application of the oligonucleotides that blocking gene expresses in 1996.
These antisense molecules can be DNA, stable DNA derivant such as thiophosphate or methyl phosphorodithioate, RNA, stable RNA derivant as 2 '-O-alkyl RNA or other ASON analogies.Can encapsulate or the expression of carrier through comprising anti sense nucleotide sequence through microinjection, liposome, antisense nucleic acid molecule is introduced cell.
Under the situation of gene therapy, target gene can be connected in the viral vectors, and said viral vectors is through infecting the transfer that the acceptor host cell mediates therapeutic agent DNA.Suitable viral vectors comprises retrovirus, adenovirus, adeno-associated virus, herpesviral, vaccinia virus, poliovirus or the like.Perhaps, therapeutic agent DNA can be transferred to cell through non-virus technology and carry out gene therapy, and these technology comprise that the receptor-mediated target DNA that uses part DNA conjugate or adenovirus part DNA conjugate shifts, the lipofection film merges or directly microinjection.These methods and modification thereof are applicable to and exsomatize and the outer-gene treatment.The scheme of the molecular method of the gene therapy that these are fit to carry out with gene is by Paul D.Robbins, Human press, and Totowa NJ describes among the 1996 Gene Therapy Protocols (gene therapy scheme) that write to some extent.
The pharmaceutically useful composition that can comprise medicine of the present invention according to known method (for example through mixing) preparation with pharmaceutically useful carrier.The instance of this carrier and compound method can find in Remington ' s Pharmaceutical Sciences.In order to form the pharmaceutically acceptable composition that is applicable to effective administration, such composition will contain the medicine of effective dose.Effective amount of drug can change according to various factors for example individual illness, weight, sex and age.Other factors comprises the pattern of administration.Can like subcutaneous, local, oral and intramuscular pharmaceutical composition be offered individuality by all means.
Medicine of the present invention comprises the chemical derivative of medicine base molecule.That is to say that they can contain is not the other chemical part of a base molecule part usually.Such part can be improved dissolubility, half life period, absorption of base molecule etc.Perhaps, said part can weaken the undesirable spinoff of base molecule or reduce the toxicity of base molecule.The instance of such part is described in a lot of textbooks to some extent, for example Remington ' s PharmaceuticalSciences.
Can come to use separately by the determined appropriate dose of conventionally test according to the determined compound of this paper disclosed method,, any genotoxic potential minimized to obtain best inhibiting effect or activity.In addition, the co-administered of other medicament or sequential administration can need by a definite date.
Available multiple therapeutic agent formulation gives medicine of the present invention in the conventional excipients that is used for administration.For example; Can give medicine by peroral dosage form or through injection, peroral dosage form for example is tablet, capsule (each capsule comprises time selecting released prepn and extended release preparation), pill, powder, granule, elixir, tincture, solution, supensoid agent, syrup and emulsion.Equally, they also can be interior, subcutaneous through intravenous (injecting and infusion), peritonaeum, have or the part or the intramuscular form of non-blocking are carried out administration, and the form of all uses is all known by the those of ordinary skill of those pharmaceutical fields.Effective and nontoxic amount of required compound can be used as modulator.
The daily dose of goods changes in the relative broad range of 000mg at every patient 0.01-1 every day.For oral administration; Preferably with the tablet form that indentation is arranged or do not have an indentation composition is provided, said tablet contains the symptom that 0.01,0.05,0.1,0.5,1.0,2.5,5.0,10.0,15.0,25.0 and 50.0 milligram of effective constituent is used for being treated the patient regulates dosage.Usually the dosage level with the about 100mg/kg body weight of about 0.0001mg/kg-every day provides effective amount of drug.Scope is about 0.001-10mg/kg body weight every day more specifically.When the coupling medicament when reaching required effect, dosage is adjusted.On the other hand, the dosage of these different medicaments can optimised independently and coupling, and is to reach collaborative effect, bigger when wherein the reduction degree of symptom will be than the arbitrary reagent of independent use.
Advantageously, compound that uses in the present invention or correctives can be by single daily dose administrations, and perhaps total daily dose can be divided into every day 2,3 or 4 times individually dosedly carries out administration.In addition, use through the part that excipient perhaps is used for transdermal patch form well known to those of ordinary skill in the art through transdermal route with form in the nose in the suitable nose, compound of the present invention or correctives are carried out administration.As the administration of the form of releasing medicine through skin penetration system, the dosed administration that runs through whole dosage will naturally be continuous but not intermittently.
For using the therapeutic alliance (wherein activating agent is the discrete dosages preparation) that surpasses a kind of activating agent, activating agent can carry out administration simultaneously, and perhaps each time of staggering separately in them is carried out administration.
Utilize the dosage of compound of the present invention or correctives to select according to multiple factor, these factors comprise patient's type, kind, age, body weight, sex and medical condition; The severity of treatment condition; The approach of administration; Patient's hepatic and renal function; Employed concrete medicine.Common doctor or animal doctor can confirm and leave the required medicine that is used for preventing, preventing or stop the effective dose of illness progress at an easy rate.Drug concentration accurately and is best fixed on produce effect and in the avirulent scope, need be based on dynamic (dynamical) scheme to the drug effectiveness of target site.This relates to distribution, the balance to medicine and clearly considers.
Medicine of the present invention can form effective constituent; And mix with suitable pharmaceutical diluents, excipient or carrier (being called " carrier " material in this article in the lump) usually and carry out administration; Said carrier material is selected according to predetermined administering mode (being oral tablet, capsule, elixir, syrup or the like) suitably, and consistent with traditional pharmacy practice.
For example, for the oral administration with tablet or Capsule form, active medicine component can combine with nontoxic pharmaceutically acceptable oral inert carrier such as ethanol, glycerine, water or the like.In addition, as needs or when being necessary, suitable bonding, lubricant, disintegrant and colorant also can merge in the potpourri.Suitable bonding includes but not limited to: starch, gel, natural sugar (for example glucose or beta lactose), corn sweetener, natural and synthetic rubber such as gum arabic, tragacanth or mosanom, CMC, polyglycol, wax or the like.The lubricant that is used for these formulations includes but not limited to sodium oleate, odium stearate, dolomol, Sodium Benzoate, sodium acetate, sodium chloride or the like.Disintegrant includes but not limited to starch, methylcellulose, agar, bentonite, xanthans or the like.
For liquid form, active medicine component can combine with suspending agent or the spreading agent of suitably rectifying flavor, said suspending agent or spreading agent for example for synthesize with natural natural gum, for example Huang Shi glue, gum arabic, methylcellulose or the like.Other available spreading agent comprises glycerine or the like.For parenteral, aseptic supensoid agent and solution are to need the phase.When needs carry out intravenous administration, can use the grade that contains suitable antiseptic usually to ooze preparation.
Medicine of the present invention can also the liposome medicine-releasing system form carry out administration, for example little individual layer vesicle (unilamellar vesicle), big individual layer vesicle and multilamelar vesicles.Liposome can for example cholesterol, stearmide or phosphatid ylcholine constitute by multiple phosphatide.
Medicine of the present invention also can through use compound molecule with it the monoclonal antibody of phase coupling pass medicine as carrier separately.But medicine of the present invention also can carry out coupling with the soluble polymer as the pharmaceutical carrier of target.Such polymkeric substance can comprise polyvinylpyrrolidone, pyran co-polymer, gathers hydroxypropyl methyl acrylic amide phenol (polyhydroxypropylmethacryl-amidephenol), poly-hydroxyethyl asparagine phenol (polyhydroxy-ethylaspartamidephenol) or with the substituted oxirene of palmityl residue-lysine multipolymer (polyethyl-eneoxidepolylysine).In addition; Medicine of the present invention can with one type of biodegradable polymers coupling mutually that is used to implement medicine controlled releasing, said polymkeric substance for example for PLA, poly epsilon caprolactone lactone, poly butyric, poe, polyacetal, gather the inlay and break copolymer of the crosslinked or amphipathic molecule of dihydropyrane, polybutylcyanoacrylate and hydrogel.
For oral administration, medicine can capsule, tablet or bolus form are carried out administration, perhaps alternatively it is mixed with feed.Capsule, tablet or bolus are made up of the effective ingredient that combines with suitable carrier such as starch, talcum powder, dolomol or Dicalcium Phosphate.Through with the inert fraction (comprising thinning agent, filling agent, disintegrant and/or bonding agent) of effective constituent and suitable fine-powderization thus intimate admixture obtains the potpourri of homogeneous, prepare these unit dosage forms.Inert fraction is a kind of do not react with medicine and to by treatment animal avirulent composition.Suitable inert fraction comprises starch, lactose, talcum powder, dolomol, plant gum (vegetative gum) and wet goods etc.These preparations can contain activity and the non-active ingredient that great changes have taken place on amount, and this depends on that several factors is like the size of the animal species of being treated and the type and the seriousness of type and infection.Also can be through simply compound being mixed with feed perhaps through giving effective constituent with compound administration in the surface of food.
The preparation that compound or correctives can alternatively be made up of the effective constituent that is dissolved in the inert liquid carrier through injection carries out parenteral.Injection can be (intraluminal) injection in intramuscular injection, the tube chamber, intratracheal injection or hypodermic injection.Injectable preparation is made up of the effective ingredient of mixing with suitable inert liquid carrier.Acceptable liquid-carrier comprises: vegetable oil such as peanut oil, cottonseed oil, sesame oil or the like and organic solvent such as acetone contract glycerine (solketal), glyceroformol or the like.As alternative, also can use the parenteral aqueous formulation.Vegetable oil is preferred liquid-carrier.Make the effective ingredient that contains 0.005-10% weight in the final preparation through dissolving or suspension effective constituent in liquid-carrier, prepare said preparation.
All references that this paper quotes are attached among this paper by reference.Further specify the present invention through following non-limiting examples.
Material and method
Clinical evaluation
This research and utilization 67 marrow samples; It is collected from open label, multicenter, the research of non-2 comparative phases; Effect and the security that Zarnestra (R115777,
) suppresses farnesyl transferase studied in said research in 158 prior untreated excessive risk AML the elderlys.In other places clinical effectiveness is announced.Lancet etc. (2006).
Sample collection and processing
Before with the Zarnestra treatment, collect the marrow sample and handle monocyte on the spot from the patient who agrees.With PBS dilution bone marrow aspiration thing and with phenanthrene can-Diatrizoate (1.077g/ml) carries out centrifugal.With the leukaemia haemocyte of PBS washing enrichment 2 times, be suspended in again among the FBS with 10%DMSO, immediately in-70 ℃--80 ℃ of following freeze-drying.(Qiagen, Santa Clarita CA) extract total RNA from cell sample with the Trizol kit.Confirm the quality of RNA through the existence of estimating ribosomes swimming band on the Agilent biological analyser.The high sample of quality is for further processing is used for microarray analysis.(Qiagen, Santa Clarita CA), isolate DNA from the marrow sample that identical Trizol handled according to manufacturer specification.The qPCR (Fig. 1) of total gene expression of analytic sample, N-Ras sudden change and/or specific gene.
The N-Ras mutation status
Confirm the analysis that activation suddenlys change among the N-ras according to aforesaid PCR and rflp analysis.End etc. (2001).The exons 1 of N-ras gene and 2 is amplification simultaneously in single multiple reaction, and aliquot is used for second PCR that take turns.Second take turns in the amplicon restriction enzyme sites place cutting that natural restriction enzyme sites or primer are caused resistance show: exist and eliminated the said site mutation that is positioned on the locus of being analyzed.The restriction enzyme that is used for the analysis of specific gene seat is Bsl I (N-ras codon 12 and 13), Msc I (N-ras codon 61, position 1 and 2) and Bfa I (N-ras codon 61, position 3).Digestion reaction spends the night, and on the Agilent biological analyser, analyzes the PCR product.
Microarray analysis
(Santa Clara, scheme CA) is carried out the synthetic of cDNA and cRNA according to Affymetrix.Because yielding poorly of a lot of samples, thereby the two-wheeled linear amplification that carries out as described earlier.20070048782。For hybridizing, through 94 ℃ of following incubation 35min in 40mM Tris-acetate, pH 8.1,100mM potassium acetate, 30mM magnesium acetate, with the cRNA random fragmentation of 11 μ g.The cRNA and the U133A array of fragmentation were hybridized 16 hours down in 45 ℃ in being set to the baking oven of 60rpm.After the hybridization, (with the 6x SSPE and the 0.5x SSPE that contain Triton X-100 (0.005%)) washing array, and with streptavidin-phycoerythrin (SAPE; Molecular Probes, Eugene, OR) dyeing.(Agilent Technologies, Palo Alto is CA) to quantitative by the label probe that combined with Agilent G2500A GeneArray scanner.
The total fluorescence intensity of each array is zoomed to (scale) unified value 600.Signal through calculating signal to noise ratio (S/N ratio) (original average signal/noise) quantizes chip performance.As the signal to noise ratio (S/N ratio) of fruit chip be lower than 20 or as the concord of the existence on the fruit chip (present call) be lower than 30%, then do further analysis without them.Echoed to " existence " at least 10% chip like fruit gene, then only used it for further analysis.About 12,000 Affymetrix probe groups keep following this blocking.Through exceptional value and the normal distribution of passing through analyzing gene intensity, the further quality of confirming to analyze (Partek Pro V5.1) of controlling gene expression data based on key component.With the deposit data of microarray in NCBIs Gene Expression Omnibus (GEO,
Http:// www.ncbi.nlm.nih.gov/geo/) in and can obtain through GEO series registration number GSEXXXX.
The reaction definition
In clinical paper, reported the reaction to Zarnestra, it is defined as the patient that have complete reaction (CR), partial reaction (PR) or blood improve (HI), Lancet etc. (2006).In brief, HI be defined as any marrow blastocyte counting (bone marrow blast count) be lower than 5% or marrow blastocyte (bone marrow blast) be reduced by at least half the.PD (PD) is defined among marrow blastocyte or circulation blastocyte (circulating blast) % increases>50% than baseline, new circulation blastocyte (once continuous at least 2 times) perhaps occurs.Stable disease (SD) is defined as any reaction that does not meet CR, PR, HI or PD standard.
Statistical analysis
Check indivedual genes and/or the total predicted value of polygenes classification thing with experimenter's operating characteristic (ROC) analysis.Following gene filter criteria is used to identify at reactor and has between the patient of PD expresses discrepant gene: specificity>=40% of evaluation " reactor " sensitivity 100% under; T-test p value (the log2 data converted of band unequal variance)<0.05, multiple changes>2.Will be with AUC (ROC TG-AUC) through the gene graduation of these standards.
In order to set up the classification thing, with reacting score in order to calculate the chance of every patient to the Zarnestra therapeutic response.This score is defined as the linear combination of the t statistic of weighting expression signal and conduct power.From the ROC curve determination threshold value of training set (training set), to guarantee 100% sensitivity and the highest specificity.In order to confirm to comprise the how many kinds of gene in the prediction thing, carried out leaving-one method cross validation (LOOCV).Record is based on the reaction score of " staying outer (leaveout) " sample of different number genes.Based on the p value of the separation of the kaplan-Meier curve of the error rate of mis-classification, sensitivity, specificity, two prediction group of measurement, assess the performance of the prediction thing that contains different number genes.Thereby select best prediction thing.
People such as Geman (2004) at first introduce top score pairing (Top Scoring Pair, TSP) algorithm.Substantially, this algorithm is classified all gene pairss (gene i and j) based on the absolute difference (Dij) of event frequency, and wherein in the sample among rank C1-C2, gene i has higher expression values than gene j.Under the situation that has a plurality of top scores to (top scoring pair) (all total same Dij); It is right that we select top score through secondary classification score (secondary rank score), and said secondary classification score measurement producer expression in gene pairs is put upside down the size into another classification from a classification.The top score of absolute Dij highest frequency in all samples>2 times is right to being selected as the candidate.The evaluation candidate is right in independent test data set (independenttesting data set) then.
Concentrate at training data and to carry out leaving-one method cross validation (LOOCV), how to carry out to estimate this algorithm.Estimate the performance of prediction thing based on the error rate of maximum mis-classification.Use R (R develops core group (R Development Core Team), 2006) to accomplish all statistical analysis.
Real-time quantitative RT-PCR
For each sample, with High Capacity cDNA Transcription kit (Applied Biosystems, Foster City, CA) according to manufacturers instruction with the total RNA of 1 μ g (in OD
260Estimate) carry out reverse transcription.For making RNA carry out optimum transformation, sample is placed under 25 ℃ hatch 10min, hatch 30min under 37 ℃ then.(Applied Biosystems, Foster City CA) carry out QPCR, and all samples are with triplicate operation to use ABIPrism 7900HT sequence detection system.Each reaction contains: 5 μ l contain
Universal PCR Master Mix (Applied Biosystems of UNG; Foster City; CA), 4.5 μ l template cDNA, 0.5 μ l 20x Assay on Demand Gene ExpressionAssay Mix or 9pmol forward and reverse primer and 2.5pmol probe (AppliedBiosystems; Foster City; CA), total reaction volume is 10 μ l.The selection that all primers, probe groups have been done is owing to little amplicon size (less than 100 nucleotide), and used the FAM fluorescence probe.The primer and the probe that use are APTX (production number 4331182Applied Biosystems) and RASGRP1 (production number 4351372AppliedBiosystems).Through calculate RASGRP1 to get off: the APTX expression ratio: from sample sets, deduct average Ct and come regular original Ct value,, calculate the poor of the regular Ct value of every kind of gene (APTX-RASGRP1) then divided by standard deviation.Ma etc. (2004).
The result
The gene expression overview of the patient's who in 2 clinical trial phases of farnesyl transferase inhibitor Zarnestra, registers leukaemia marrow sample has been checked in this research, and said 2 clinical trial phases carry out in the gerontal patient who suffers from previous untreated low-risk acute myelocytic leukemia.Lancet etc. (2006).Before with the Zarnestra treatment, collected marrow from 67 patients, and can (Ficoll) Density Gradient Centrifugation enrichment leukaemia bone marrow cell (table 1) with phenanthrene.Will from 13 reactors (9CR, 4HI), 8 stable disease patients and 13 PD patients' the total RNA of high-quality increases, mark and hybridize with Affymetrix U133A genetic chip.30 samples are altogether estimated with the conclusive evidence specific gene with qPCR, the N-Ras mutation status of 32 samples is estimated.
Table 1. is through the patient's of profile analysis comparison
The CR=complete reaction; The PR=partial reaction; HI=blood improves, the SD=stable disease, and the PD=PD, NE=does not estimate; The PGx=pharmacogenomics
Ras mutation status and patient result
Examination 32 AML patients' the N-Ras activation sudden change ( codon 12,13,61) of marrow DNA.34% (11/32) patient shows the N-Ras sudden change, and a patient has sudden change (table 2) at a plurality of codons place.There is not the significant correlation property on the statistics at the N-Ras mutation status with between to Zarnestra reaction or total survival period.
Table 2.
The ND=undetermined; The WT=wild type; The CR=complete reaction; The PR=partial reaction; HI=blood improves, the SD=stable disease, and the PD=PD, OS=is all survived.
The make a fresh start AML crowd's that makes a definite diagnosis the evaluation of predicted gene
Our next step target is in the AML crowd who newly makes a definite diagnosis, to identify the gene that prediction reacts to Zarnestra.We have carried out the experiment of discovery property in the patient of 13 reactors (9CR and 4HI) and 13 PDs at last.These patients in current the analysis, do not have to adopt the patient who suffers from stable disease, because can not clearly be defined as reactor or non-reactor.We use and the identical method (20070048782) of mark that is used for identifying recurrence and intractable AML, have identified the probe set (corresponding with 38 kinds of unique genes) (table 3) of 45 prediction reactions.The choice criteria target is to identify following gene: under high sensitivity (about 100%), be the gene of twice at least with the 40% specificity prediction reactor that blocks and average gene expression difference.Experimenter's operating characteristic (ROC) based on training set is analyzed defined TG-AUC (AUC), comes gene is carried out classification.Under 1.0 the perfect classification of AUC indication, this value is represented total predicted value of gene.At first training every kind of gene of extensive experimentation with the LOOCV method.The top score gene is that the RAS guanylic acid discharges albumen 1 (RASGRP1), shows that AUC is 0.95.
We have checked that whether in the classification thing, increasing the gene number can improve its predicted value then.Use the LOOCV method,, find the independent top score gene predicted value (data not shown) that offers the best then to sensitivity, specificity and total error rate mapping of every kind of classification thing.Gene is joined the predicted value that can not improve it in the classification thing with linear mode.When using highly sensitive the blocking of deflection, LOOCV proof RASGRP1 expression of gene allows that NPV is 88.9%, PPV is 70.6%, total predictablity rate 76.9% (figure lA).In addition, Kapp orchid-Meyer analysis is presented at the significant difference (Figure 1B) between average total survival period (386 days) of reactor and the average total survival period (68 days) of PD patient.Therefore, the overexpression of this list kind gene is made a definite diagnosis among the AML newly and has been indicated the reaction to Zarnestra with high negative predictive value.
The evaluation of top score pairing classification thing
If other gene is joined in the classification thing, then do not improve the predicted value of RASGRP1 with linear method.Therefore, we adopt another kind of gene Selection algorithm to select the gene that improves independent RASGRP1 predicted value.We adopt top score pairing (TSP) algorithm to identify the best gene pairs that the maximum predicted accuracy rate can be provided at last.Geman etc. (2004).Use this method, seek the maximum differential expression between two kinds of genes, and when target being fixed on exploitation based on the qPCR of diagnostic analysis, this method comes in handy.From the TSP of training set be RASGRP1 and ataxia GFP (aprataxin, APTX).RASGRP1 and APTX are respectively that incremental adjustments is expressed and decrement is regulated expression in reactor.Effectively LOOCV shows that this top score provides 85.7% NPV and 91.7% PPV to (TSP) in the training set of sample, and total error rate has only 8% (Fig. 2 A).The reactor of prediction and the difference of the total survival period between the non-reactor are 357 days (Fig. 2 B).The correlation predictive error rate of these these modeling algorithms of digital proof is lower.
The conclusive evidence of RASGRP1: APTX classification thing in the independent groups of recurrence or intractable AML
We implement the outside conclusive evidence of TSP classification thing subsequently in by the independent microarray data group of 54 recurrence/intractable AML patient's samples.20070048782。Importantly, purpose is to predict that the diagnostic analysis to the treatment of cancer reaction should have high sensitivity (and negative predictive value), is important because catch potential reaction person as much as possible.Therefore, in order to limit suitable blocking with test TSP classification thing, we consider following needs: obtain the high sensitivity of prediction reactor, keep the specificity of acceptable level simultaneously.In training set, when sensitivity was set to 100%-80% respectively, the specificity horizontal extent that can reach was at about 30%-100%.Can predict reactor as much as possible for the thing of guaranteeing to classify, conservative blocking below we have tested: about 60% specific blocking is provided in training set.When this being blocked the independent experiment group that is applied to recurrence/intractable AML, RASGRP1: APTX gene classification thing with 92%NPV and 27.6%PPV (comparing) with 18.5% morbidity rate with reactor layering (Fig. 2 C).Related advantages ratio as reactor is 4.38.Though this predictablity rate with independent RASGRP1 is similar; But the application of TSP classification thing has proved that NPV is better; And shown between reactor and the progress person of prediction 98 days raising total survival period difference (Fig. 2 D), RASGRP1 only has 56 days (Fig. 4) by contrast.
RASGRP1: the QPCR conclusive evidence of APTX expression ratio
Two gene expressions are than making it possible to use clinically more relevant qPCR detection system.30 samples (20PD, 6CR, 3HI and 1PR) provide the enough total RNA that are used for qPCR.Therefore; At these 30 sample (10 reactors of making a fresh start and making a definite diagnosis the AML clinical research; 20 PD patients) in, with
qPCR to as RASGRP1 to the response prediction thing of Zarnestra: APTX gene expression ratio is estimated.9 samples to are wherein analyzed on the microarray platform, have 21 samples not have owing to RNA is of poor quality in seeking group (discovery set), to use.Therefore, such test group of 2/3rds is made up of sample fully independently.The evaluation of 9 samples is presented at has good RASGRP1 between two platforms: APTX expression ratio correlativity (r=0.74) (Fig. 6).When the section (cut point) that is used for 0, two gene classification thing is correctly predicted 20 people's among 30 patients result of treatment (Fig. 3) respectively with the NPV of 50% PPV and 81%.The total survival period of intermediate value of the resistant patients of prediction is 82 days, and those intermediate values that are categorized as the patient of reactor are 295 days (Fig. 3 C).RASGRP1: APTX classification thing is not independent of the prognosis effect of FTI treatment.
We have tested the two gene expression ratio in 116 independent microarray data groups with the AML patient of chemotherapy scheme treatment.Bullinger etc. (2004).When RASGRP1: APTX classification thing is applied to this group patient,, do not observe the remarkable separation on total survival period utilizing under the blocking similar with the crowd who treats about Zarnestra.When utilizing a series of other to block, do not observe significant survival period difference (table 4) yet.This has shown that RASGRP1: APTX classification thing carries out layering to the patient who treated with Zarnestra specifically, and irrelevant with non-FTI.On the other hand, when defined prognostic markers such as Bullinger (prognostic signature) are applied to us this group recurrence/intractable AML patient, aspect total survival period clearly layering is being arranged.
Table 4
The total survival period of OS=
In the Fig. 2 that replenishes, shown Kapp orchid-Meyer analysis discussion of blocking about (overstriking) stressed
In cancer patient's clinical treatment, patient crowd's layering is just being become more and more valuable with the predicted treatment reaction.For example; For Herceptin (the trastuzumab) (Herceptin that for example is used for metastatic breast cancer with targeted therapies; Genentech) and be used for Cetuximab (the cetuximab) (Erbitux of colorectal cancer; Merck) patient's of treatment layering needs common diagnosis (companion diagnostics).Seidman etc. (2001); With (2005) such as Moroni.The biomarker of prediction also is used for Imatinib (the imatinib) (Gleevec that uses at the stomach stromal tumor; Novartis), the Tarceva that in lung cancer, uses (erlotinib) (Tarceva; OSIPharmaceuticals) and the Gefitinib that in lung cancer, uses (gefitinib) (Iressa, Astra-Zeneca).Burger etc. (2005); Tsao etc. (2005); With (2004) such as Lynch.Current do not have available method with the reaction of any index prediction to FTI.In order to identify: the gene that Zarnestra interrelates with higher sensitivity and FTI; We have carried out the gene expression profile analysis to the leukaemia marrow sample from the research of 2 phases, and said 2 phases research is carried out in the low-risk AML gerontal patient who treats in advance.Lancet etc. (2006).Importantly, target is to predict that the analysis to the reaction of oncology therapy should have high NPV, is very important because catch potential reactor as much as possible.So, using the standard of identifying with the mark of high sensitivity prediction reaction, we have identified 45 kinds of genes in the AML marrow sample of newly making a definite diagnosis, said gene is variant in expression between reactor and the non-reactor.
Though we find that the baseline phosphorylation state of N-Ras sudden change or ERK or AKT and reaction to Zarnestra do not have significant correlativity (Lancet etc. (2006)); But we have identified the gene that relate to Ras activation of prediction to the Zarnestra reaction; Said gene comprises that PTPN6 is regulated by decrement by the Protein-tyrosine-phosphatase of farnesylation and in reactor), CD3D, TRAT1, LTB, TNFRSF17, TNFSF13 and RASGRP1.Chen etc. (2005); Stone (2006); And Delgado (2000).The activation of known Ras approach can be caused by other incident outside the structure activation of Ras albumen itself.Illmer etc. (2005); With Solit and (2006).Really, do not exist the activation sudden change down, in AML, identify the N-Ras and the K-Ras of its state of activation.Ehmann etc. (2006).Therefore still reasonable is, no matter Ras sudden change situation how, making the Ras imbalance is the important goal of Zarnestra in AML.Ehmann etc. (2006).What support this viewpoint is that Feldkamp etc. (2001) prove the special Ras.GTP level of homotype with relevant to the reaction of FTI SCH66336, and irrelevant with the activation sudden change of Ras.
RASGRP1 is that the term single gene presentation markup is used in the most powerful prediction, and its total predictablity rate in the training set of cross validation is 77%.RASGRP1 is the guanine nucleotide exchange factor (GEF) that specificity activates Ras.Stone(2006)。In brain, T cell, monocytic series and original hemopoietic forebody cell (primitive hematopoietic precursor), found the expression of RASGRP1.(1998) such as Kawasaki etc. (1998) Ebinu; With (1998) such as Tognon.What is interesting is; Another kind of RASGRP (RASGRP4) before had been accredited as the potential oncogene (Reuther etc. (2002)) among the AML; Yet; Our data check first and have proved that RASGRP1 expresses in the AML cell, also related to this gene in addition to the importance in the reaction of FTI.
We find that the polygenes classification thing that is combined as of RASGRP1 and APTX provides the most powerful predictablity rate (about 89%).APTX participates in the DNA excision and repairs, and is found in the reactor and is regulated by decrement.Ahel etc. (2006) etc.When carrying out cross validation, this two gene classification thing demonstrates forecasting power seeking of the AML that newly makes a definite diagnosis in the group, and identification reaction person's NPV and PPV are respectively 86% and 92%.Yet cross validation only provides performance model, has therefore carried out the test to the independent data group, so that the true and accurate rate of response prediction to be provided.At last, we have also checked the microarray data from the independent groups of recurrence/intractable AML, and the independent sample of the AML clinical research of making a definite diagnosis making a fresh start has been carried out qPCR.
Owing to have the ability to measure the inferior quality clinical sample that existing microarray technology institute can not carry out profile analysis, thereby than gene expression microarray effectiveness more widely arranged clinically based on the simple diagnosis mensuration of qPCR.In 30 samples (wherein 20 have been passed through the microarray profile analysis) of one group of AML crowd that makes a definite diagnosis that makes a fresh start, we proved RASGRP1: APTX expression ratio can with qPCR detect reliably and no matter the quality of sample how.The clear NPV of classification material evidence is respectively 81% and 50% with PPV, and for being that those patients of reactor provide significantly survival period advantage always by prediction.In research in the future, bigger data set is carried out profile analysis be undoubtedly important with the purposes that further conclusive evidence two gene qPCR measures.
Do not have bigger newly making a definite diagnosis under the AML sample independent groups, we have also utilized recurrence or the intractable AML sample of 54 researchs before us as independent experiment group (20070048782).Beyond thoughtly be, though said sample from biologically different AML patient crowds, two gene classification thing has still shown the good layering of reactor and non-reactor, NPV is 92% and PPV is 28%.Because the morbidity rate of reactor is 18% in this data set, thereby on behalf of overall reaction, this improved about 50%.In addition, the intermediate value survival period of the prediction reactor of layering has the patient of resistance approximately to reach 3 times than prediction to Zarnestra.Importantly, we find no any contact between the prognosis of patients in two gene classification thing and AML patient's (through the chemotherapy treatment) independent groups.This shows that classification thing of the present invention predicts the reaction to Zarnestra treatment specifically.Still need do further work, to illustrate RASGRP1: whether the APTX expression ratio is useful to the FTI of other kind.
Is it how to cause the susceptibility to FTI that the RASGRP1 that increases expresses? Shown that RASGRP1 can activate H-RAS and N-Ras in single-minded ground (exclusively) on golgiosome, but do not activated K-Ras.Bivona etc. (2003); With (2004) such as Perez de Castro.In addition, after farnesyl transferase was suppressed, K-Ras and N-Ras were alternatively by the busy ox baseization of busy ox base.Whyte etc. (1997).On the other hand, H-Ras only can be by farnesylation, and this has just explained following observations: the tumour with H-Ras transforms is more responsive than the tumour that transforms with N-Ras or K-Ras.End etc. (2001); With (2006) such as Lubet.The unconventionality expression of RASGRP1 in AML causes the activation of N-Ras and H-Ras approach but blocked the H-Ras that causes anti-tumorigenesis effect is possible.Therefore, though in AML, do not identify H-Ras activation sudden change, possibly remain the target of FTI in some tumour to the specificity activation of H-Ras approach through other means (like Ras-specificity GEF).
We had identified before that AKAP13 can predict the resistance to Zarnestra in recurrence/intractable AML.200700448782。What is interesting is that AKAP13 also is GEF, but activate the Rho approach.Sterpetti etc. (1999)., though in recurrence or intractable AML, demonstrate effectiveness, being expressed in of AKAP13 do not show forecasting power among the AML that newly makes a definite diagnosis.This possibly be because the leukaemia crowd of overexpression AKAP13 is not present in the new diagnosed disease, and only breeds among the AML late.Does this other problem that causes is: why the overexpression of RASGRP1GEF increase the susceptibility of Zarnestra and the overexpression of AKAP13GEF increases the resistance to Zarnestra? Have been found that Rho GEF drives cell transformation with the mode that does not rely on Ras.Reuther etc. (2001); With (2002) such as Sahai.Therefore, a kind of hypothesis is the downstream compensation approach that AKAP13 has activated RhoA, is the clear and definite target of FTI and RAGRP1 has activated Ras.Need do more biochemical analysis and study this model.Yet, the importance of this type Small GTPases activator in the treatment of FTI mediation has been given prominence in the evaluation of two kinds of GEF of counterproductive in the reaction of FTI.Also given prominence to the needs to multiple mark, said mark is used to predict the reaction of target being crossed over the treatment of large-scale disease and disease subtypes.Along with GEF becomes the medicine target of being paid close attention to day by day, also can receive publicity to the research of the combination treatment of FTI and GEF specific inhibitor.
In a word, we have identified and have proved conclusively the two gene expression ratio that available simple and easy qPCR analyzes.This classification thing has a forecasting power simultaneously in the AML that newly makes a definite diagnosis and recurrence/intractable AML, and makes the overall reaction rate improve about 50% and keep high NPV.In addition, prolonged total survival period of patient significantly with this classification thing layering.Our data advantageously with FDA approval the application of target on cancer treatment like the common diagnosis of Trastuzumab (Herceptin) compared.For example; Verified is; When using HercepTest or PathVysion when check respectively, make overall reaction rate be increased to 69% or 75% from about 59% to Trastuzumab and taxol (paclitaxel) therapeutic alliance to the metastatic breast cancer patient's of Her2/Neu overexpression layering.Seidman etc. (2001).Therefore, our data show: easy two gene is expressed to measure and can be used for diagnosing more the AML patient crowd that possibly react to Zarnestra.
List of references
Ahel etc. (2006) The neurodegenerative disease protein aprataxinresolves abortive DNA ligation intermediates (nerve degenerative diseases albumen: the ataxia GFP decomposes the intermediate that interrupts the DNA connection) Nature 443:713-716
Bivona etc. (2003) Phospholipase Cgamma activates Ras on the Golgiapparatus by means of RasGRP1 (phospholipase C γ activates Ras through RasGRP1 on golgiosome) Nature 424:694-698
Bos (1989) the ras oncogenes in human cancer:a review (oncogene in the human cancer: summary) Cancer Res 49:4682-4689
Bullinger etc. (2004) Use of gene-expression profiling to identifyprognostic subclasses in adult acute myeloid leukemia (the gene expression overview is used for identifying the prognosis subclass at adult's acute myeloid leukaemia) N Engl J Med350:1605-1616
Burger etc.; (2005) Activating mutations in c-KIT and PDGFRalpha areexclusively found in gastrointestinal stromal tumors and not in othertumors overexpressing these imatinib mesylate target genes; (only in the stomach and intestine mesenchymal neoplasm and do not find in the tumour of these imatinib mesylate target genes of other overexpressions that the activation in c-KIT and PDGFR α suddenlys change) Cancer Biol Ther4:1270-1274
Chang etc. (2003) Gene expression profiling for the prediction oftherapeutic response to docetaxel in patients with breast cancer (the gene expression profile analysis is used to predict the therapeutic response of patient with breast cancer to docetaxel) Lancet362:362-369
Chen etc. (2005) FLT3/ITD mutation signaling includes suppression ofSHP-1 (comprising the FLT3/ITD jump signal transduction of preventing SHP-1) J Biol Chem280:5361-5369
Cox etc. (2002) Farnesyltransferase inhibitors:promises and realities (farnesyl transferase inhibitor: prospect and present situation) Curr Opin Pharmacol 2:388-393
Ebinu etc. (1998) RasGRP, a Ras guanyl nucleotide-releasing proteinwith calcium-and diacylglycerol-binding motifs (calcic and diacylglycerol combine the Ras guanylic acid of die body to discharge albumen) Science 280:1082-1086
Ehmann etc. (2006) Detection of N-RAS and K-RAS in their activeGTP-bound form in acute myeloid leukemia without activating RASmutations (N-RAS and the K-RAS of detection of active GTP combining form in the acute myeloid leukaemia that does not have RAS activation sudden change) Leuk Lymphoma 47:1387-1391
End etc. (2001) Characterization of the antitumor effects of theselective farnesyl protein transferase inhibitor R115777 in vivo and invitro (the interior and vitro characterization of the body of the antitumor action of selectivity farnesyl protein transferase inhibitors R115777) Cancer Res 61:131-137
Feldkamp etc. (2001) Isotype-specific RasGTP-levels predict theefficacy of farnesyl transferase inhibitors against human astrocytomasregardless of Ras mutational status (special-shaped specificity RasGTP horizontal forecast is directed against the effect of the farnesyl transferase inhibitor of people's astrocytoma, and is irrelevant with the mutation status of Ras) Cancer Res 61:4425-4431
Geman etc. (2004) Classifying gene expression profiles from pairwisemRNA comparisons (from paired mRNA relatively classification gene expression overview) StatAppl Genet Mol Biol 3:30
Holleman etc. (2004) Gene-expression patterns in drug-resistant acutelymphoblastic leukemia cells and response to treatment (graphic and the reaction of the gene expression in the acute lymphoblastic leukaemia of drug resistance) NEngl J Med 351:533-542 to treating
Illmer etc. (2005) Activation of the RAS pathway is predictive for achemosensitive phenotype of acute myelogenous leukemia blasts (activation of RAS approach is the genotypic index of the paotoblastic chemical-sensitive type of acute myelocytic leukemia) Clin Cancer Res 11:3217-322
Jansen etc. (2005) Molecular classification of tamoxifen-resistantbreast carcinomas by gene expression profiling (through the molecular classification to TAM resistance breast cancer of gene expression profile analysis) J Clin Oncol 23:732-740
Karp etc.; (2001) Clinical and biologic activity of thefarnesyltransferase inhibitor R 115777 in adults with refractory andrelapsed acute leukemias:a phase 1 clinical-laboratory correlative trial; (clinical activity and the biologically active of farnesyl transferase inhibitor R115777 in refractory and recurrent acute leukemia adult patient: Blood 97:3361-3369 1 phase clinical labororatory's correlation test)
Kawasaki etc. (1998) A Rap guanine nucleotide exchange factorenriched highly in the basal ganglia (the Rap guanine nucleotide exchange factor that highly is rich in the basal ganglion) Proc Natl Acad Sci 95:13278-13283
Lancet etc. (2006) A phase II study of the farnesyltransferase inhibitortipifarnib in poor-risk and elderly patients with previously untreated acutemyelogenous leukemia farnesyl transferase inhibitor Zarnestra is not formerly accepted the II phase clinical research Blood2:2 among the low-risk gerontal patient of acute myelocytic leukemia treatment
Lossos etc. (2004) Prediction of survival in diffuse large-B-celllymphoma based on the expression of six genes (based on the prediction of the survival period of the diffuse large B cell lymphoma of 6 kinds of gene expressions) N Engl J Med 350:1828-1837
Lubet etc. (2006) Effects of the farnesyl transferase inhibitor R115777 (Zarnestra) on mammary carcinogenesis:prevention; Therapy, (farnesyl transferase inhibitor R115777 (Zarnestra) is to the effect of mammary gland carcinogenesis: the effect of prevention, treatment and HaRas sudden change) Mol Cancer Ther5:1073-1078 for and role ofHaRas mutations
Lynch etc. (2004) Activating mutations in the epidermal growth factorreceptor underlying responsiveness of non-small-cell lung cancer togefitinib (the activation sudden change of EGF-R ELISA is as the reactive basis of non-small cell lung cancer to gefitinib) N Engl J Med 350:2129-2139
Ma etc. (2004) A two-gene expression ratio predicts clinical outcomein breast cancer patients treated with tamoxifen (the two gene expression ratio is predicted the patient with breast cancer's who treated with TAM clinical effectiveness) Cancer Cell 5:607-616
Mesa et al (2006) Tipifarnib:farnesyl transferase inhibition at acrossroads (Zarnestra: face the choice farnesyl transferase inhibitor at moment) ExpertRev Anticancer Ther 6:313-319
Moroni etc. (2005) Gene copy number for epidermal growth factorreceptor (EGFR) the and clinical response to antiEGFR treatment in colorectalcancer:a cohort study (gene copy number of EGF-R ELISA (EGFR) and to the clinical response of the anti-EGFR treatment of colorectal cancer: colony's research) Lancet Oncol6:279-286
(2004) A Ras activation in Jurkat T cells followinglow-grade stimulation of the T-cell receptor is specific to N-Ras andoccurs only on the Golgi apparatus such as Perez de Castro (minuent of TXi Baoshouti stimulates the Ras activation in the Jurkat T cell of back that N-Ras is had specificity and only in golgiosome, takes place) MolCell Biol 24:3485-3496
Potti etc. (2006) Genomic signatures to guide the use ofchemotherapeutics (instructing the genome mark of the use of chemotherapeutant) Nat Med12:1294-1300
Rao etc. (2004) Phase III Double-Blind Placebo-Controlled Study ofFarnesyl Transferase Inhibitor R 115777 in Patients With RefractoryAdvanced Colorectal Cancer (in the patient of recurrence type advanced colorectal cancer to farnesyl transferase inhibitor R115777 III phase double blinding placebo-comparative study) J ClinOncol 22:3950-3957
Reuter etc. (2000) Targeting the Ras signaling pathway:a rational, mechanism-based treatment for hematologic malignancies? Is (target of Ras signal transduction pathway the rational therapy based on mechanism to hematologic malignancies?) Blood 96:1655-1669
Reuther etc. (2001) Leukemia-associated Rho guanine nucleotideexchange factor; A Dbl family protein found mutated in leukemia, causestransformation by activation of RhoA (the Rho guanine nucleotide exchange factor that leukaemia is relevant: be found in the Dbl family protein of undergoing mutation in the leukaemia and cause conversion) J Biol Chem 276:27145-27151 by the RhoA activation
Reuther etc. (2002) RasGRP4 is a novel Ras activator isolated fromacute myeloid leukemia (RasGRP4 is the novel Ras activator that separates from acute myeloid leukaemia) J Biol Chem 277:30508-30514
Rosenwald etc. (2002) The use of molecular profiling to predictsurvival after chemotherapy for diffuse large-B-cell lymphoma (application in the survival period of molecule profile analysis after the chemotherapy of prediction diffuse large B cell lymphoma) N Engl J Med 346:1937-1947
Rowinsky etc. (1999) Ras protein farnesyltransferase:A strategic targetfor anticancer therapeutic development (Ras protein method farnesyl transferase enzyme: the J Clin Oncol 17:3631-3652 tactic target that is used for the cancer therapy drug exploitation)
Sahai etc. (2002) RHO-GTPases and cancer (RHO-GTP enzyme and cancer) NatRev Cancer 2:133-142
Seidman etc. (2001) Weekly trastuzumab and paclitaxel therapy formetastatic breast cancer with analysis of efficacy by HER2immunophenotype and gene amplification (being used for the Herceptin weekly of metastatic breast cancer and the effect of paclitaxel therapy) J Clin Oncol 19:2587-2595 through HER2 immunophenotype and gene amplification analysis
Ship etc. (2002) Diffuse large B-cell lymphoma outcome prediction bygene-expression profiling and supervised machine learning (predicting the result of diffuse large B cell lymphoma through the research of gene expression profile analysis and monitoring machine) NatMed 8:68-74
Solit etc. (2006) BRAF mutation predicts sensitivity to MEK inhibition (susceptibility that the BRAF mutation forecasting suppresses MEK) Nature 439:358-362
Sterpetti etc. (1999) Activation of the Lbc Rho exchange factorproto-oncogene by truncation of an extended C terminus that regulatestransformation and targeting (transforming and the C end that stretches out of deciding target comes activation Lbc Rho exchange factor proto-oncogene) Mol Cell Biol 19:1334-1345 through truncate adjusting
Stone (2006) Regulation of Ras in lymphocytes:get a GRP (adjusting of Ras in lymphocyte: obtain GRP) Biochem Soc Trans 34:858-861
Tognon etc. (1998) Regulation of RasGRP via a phorbolester-responsive C1 domain (regulating RasGRP) Mol Cell Biol 18:6995-7008 through the reactive C1 domain of Buddhist ripple ester
Tsao etc. (2005) Erlotinib in lung cancer-molecular and clinicalpredictors of outcome (molecule of the Tarceva-effect in the lung cancer and dlinial prediction thing) N Engl J Med 353:133-144
(2004) Phase III trial of gemcitabine plus tipifarnibcompared with gemcitabine plus placebo in advanced pancreatic cancer such as Van Cutsem (gemcitabine adds that the III phase that Zarnestra and gemcitabine add that placebo is compared tests in the cancer of pancreas late) J Clin Oncol 22:1430-1438
Waters etc. (2006) Developing gene expression signatures of pathwayderegulation in tumors (the gene expression mark of the development of approach imbalance in the tumour) MolCancer Ther 5:2444-2449
Weinstein etc. (2006) Mechanisms of disease:Oncogene addiction--arationale for molecular targeting in cancer therapy (disease mechanisms: molecular targeted principle in oncogene habituation-treatment of cancer) Nat Clin Pract Oncol 3:448-457
White etc. (1997) K-and N-Ras are geranylgeranylated in cells treatedwith farnesyl protein transferase inhibitors (the busy ox baseization of the busy ox base of K-and N-Ras quilt in the cell of farnesyl protein transferase inhibitors treatment) J Biol Chem272:14459-14464
Yeoh etc. (2002) Classification; Subtype discovery, and predictionof outcome in pediatric acute lymphoblastic leukemia by geneexpression profiling (finding and the leukemic curative effect of the prediction acute lymphoblast of paediatrics) Cancer Cell 1:133-143 through the classification of gene expression profile analysis, hypotype
Sequence
The probe sets number of compiling in collaboration with
205590_at
ggattcaaaaggtgtcacagtccacttaattagtcaaattagcaatggctaaacagtatcaagtactgcagaatttatcactgaaatg
gataagaggaaatagtttagtcacaggtttttacagtccagcaagggccaaagaggtatagtatacaagttaatagtatttgtgttga
gcaacatggggctagtgggatcacagaaatctggaaaaaaaaaaaaaaaggctttggcttatcaagcctagtgtaaatttctgcat
ctcacacgactttagtttggccaggtatttatctgccaaaacaaggacaaatcttgttgtattaacagcagggtcacttctcattttcttt
gctgacttacctttttactgaccgttgtgaatttctgtctcaaa
217028_at
attgatgtgtgtctaggcaggacctgtggccaagttcttagttgctgtatgtctcgtggtaggactgtagaaaagggaactgaacat
tccagagcgtgtagtgaatcacgtaaagctagaaatgatccccagctgtttatgcatagataatctctccattcccgtggaacgtttt
tcctgttcttaagacgtgattttgctgtagaagatggcacttataaccaaagcccaaagtggtatagaaatgctggtttttcagttttca
ggagtgggttgatttcagcacc
206687_s_at
gggcctggactgtgacattgacatccagaagaccatccagatggtgcgggcgcagcgctcgggcatggtgcagacggaggc
gcagtacaagttcatctacgtggccatcgcccagttcattgaaaccactaagaagaagctggaggtcctgcagtcgcagaaggg
ccaggagtcggagtacgggaacatcacctatcccccagccatgaagaatgcccatgccaaggcctcccgcacctcgtccaaa
cacaaggaggatgtgtatgagaacctgcacactaagaacaagagggaggagaaagtgaagaagcagcggtcagcagacaa
ggagaagagcaagggttccctcaagaggaagtgagcggtgctgtcctcaggtggccatgcctcagccctgaccctgtggaag
catttcgcgatggacagactcacaacctgaacctaggagtgcccc
210439_at
gcttctgaagcagccaatgtcgatgcaacaacatttgtaactttaggtaaactgggattatgttgtagtttaacattttgtaactgtgtg
cttatagtttacaagtgagacccgatatgtcattatgcatacttatattatcttaagcatgtgtaatgctggatgtgtacagtacagtact
taacttgtaatttgaatctagtatggtgttctgttttcagctgacttggacaacctgactggctttgcacaggtgttccctgagttgtttg
caggtttctgtgtgtggggtggggtatggggaggagaaccttcatggtggcccacctggcctggttgtccaagctgtgcctcgac
acatcctcatcccaagcatgggacacctcaagatgaataataattcacaaaatttctgtgaaatcaaatccagttttaagaggagcc
acttatcaaagagat
206641_at
atttctttggcagttttcgtgctaatgtttttgctaaggaagataagctctgaaccattaaaggacgagtttaaaaacacaggatcagg
tctcctgggcatggctaacattgacctggaaaagagcaggactggtgatgaaattattcttccgagaggcctcgagtacacggtg
gaagaatgcacctgtgaagactgcatcaagagcaaaccgaaggtcgactctgaccattgctttccactcccagctatggaggaa
ggcgcaaccattcttgtcaccacgaaaacgaatgactattgcaagagcctgccagctgctttgagtgctacggagatagagaaat
caatttctgctaggtaattaaccatttcgactcgagcagtgccactttaaaaatcttttgtcagaatagatgatgtgtcagatctctttag
gatgactgtatttttcagttgccgatacagctttttgtcctctaactg
213539_at
gggaacactgctctcagacattacaagactggacctgggaaaacgcatcctggacccacgaggaatatataggtgtaatggga
cagatatatacaaggacaaagaatctaccgtgcaagttcattatcgaatgtgccagagctgtgtggagctggatccagccaccgt
ggctggcatcattgtcactgatgtcattgccactctgctccttgctttgggagtcttctgctttgctggacatgagactggaaggctgt
ctggggctgccgacacacaagctctgttgaggaatgaccaggtctatcagcccctccgagatcgagatgatgctcagtacagcc
accttggaggaaactgggctcggaacaagtgaacctgagactggtggcttctagaagcagccattaccaactgtacct
208018_s_at
gctgatggagatcgtcacctacggccggatcccttacccagggatgtcaaaccctgaagtgatccgagctctggagcgtggata
ccggatgcctcgcccagagaact?gcccagaggagctctacaacatcatgatgcgctgctggaaaaaccgtccggaggagcgg
ccgaccttcgaatacatccagagtgtgctggatgacttctacacggccacagagagccagtaccaacagcagccatgataggg
aggaccagggcagggcagggggtgcccaggtggtggctcgaaggtggctccagcaccatccgccagggcccacaccccct
tcctactcccagacacccaccctcgcttcagccacagtttcctcatctgtccagtgggtaggttggactggaaaatctctttttgact
cttgcaatccacaatctgacattctcaggaagcccccaagttgatatttctatt
203063_at
ctcagaatcccagaggcagtcccagcctcagaacccaggataggaaatgggtgtgtttagtggggaaagggacggggtgcag
acggcagggccagtatggggccccctccctctcctctcctctcctatggtgagcccagcgtgggcaccgggccgtctcagccg
tgttcccagggctgggaggacagctctggcccttcttaggcctagcctcgtcccaagctaaatgtaagccagttgggctgtgttaa
aggaagcagtgtttttggtttgattctgcctctgtagctcaaggggggcagcccccagagtcctgtgcattctgccaaggctccat
agctttgccaaatgcacggagctctgccattccggtgcagtgcaggccttgcgaagggtttatctgcgttcgtctcggtgggcttct
cctgcatgggagttgtgttcctgtgcaagggggagctttgctcaggacaggatgactgtcttccctattcttagggacaagtccca
agatgccagaaaggcagtctcccaagga
208130_s_at
tatggccaggcctttgactgtggatgagattgtgggccaggccttcatcttcctcatcgctggctatgaaatcatcaccaacacact
ttcttttgccacctacctactggccaccaaccctgactgccaagagaagcttctgagagaggtagacgtttttaaggagaaacaca
tggcccctgagttctgcagcctcgaggaaggcctgccctatctggacatggtgattgcagagacgctgaggatgtacccgccag
ctttcagattcacacgggaggcagctcaggactgcgaggtgctggggcagcgcatccccgcaggcgctgtgctagagatggc
cgtgggtgccctgcaccatgaccctgagcactggccaagcccggagaccttcaaccctgaaaggtaccgctgcagctagaatc
caaatctgccctaggtccaaaaaatggtgtctatatcaagatcgtatcccgctgacacagaaggctgccgg
216834_at
atgaaactgattacaacaggctgtaagaatcaaagtcaactgacatctatgctacatattattatatagtttgtactgagctattgaagt
cccattaacttaaagtatatgttttcaaattgccattgctactattgcttgtcggtgtattttattttattgtttttgactttggaagagatgaa
ctgtgtatttaacttaagctattgctcttaaaaccagggatcagaatatatttgtaagttaaatcattggtgctaataataaatgtggattt
tgtattaaaatatatagaagcaatttctgtttacatgtccttgctacttttaaaaacttgcatttattcctcagatttt
213388_at
cctctttctcaatctataacctttgtaggcatgcatttataccagcatgttttataaattatgagtttctatctgtgtccatgaagtcttacta
gttttcacttaaacttttgtgggttgttaagaagaattaaagtgattcataacttcacgcttgaacctgggaggtggaggttgcagtga
gccgagatcatgccattgcactccagcctgggcaacaagagtgaaactctgtcttaaataaataaataaagtggttcataacatca
gatgaagaaggaggtgagtgatatgttaaatgatcagaaacttggcattacattatttccaggaccatttccctaccaaagctgtgt
atttttcatttcttcatggcactgtgctgttaatttctgtta
38487_at
acagttgtggttagccgtatcattgtgtgggacatcatggccttcaatggcatcatccatgctctggccagccccctcctggcaccc
ccacagcccnagncagtgntggcgcctgaagccccacctgtggcggcaggcgnnnnnnnnnnnnnnnnnnnnnnnnc
actgcttggcttggtggccggagctctctacctccgtgcccgaggcaagcccangggctttggcttctctgccttccaggcggaa
nnnnnnnnnnnnnnnnnnnnnnnnnnnnngcaagaagggaccaaccccaccctggtctctgtccccaaccctgtctttg
gcagcgacaccttttgtgaacccttcgatgactcactgctggaggaggacttccctgacacccagaggatcctcacagtcaagt
210982_s_at
gaaggagacggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtgga
caaagccaacttggaaatcatgacaaagcgctccaactatactccgatcaccaatgacaagttcaccccaccagtggtcaatgtc
acgtggcttcgaaatggaaaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttccgcaag
ttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtggagcactggggcttggatgagcctcttctcaa
gcactgggagtttgatgctccaagccctctcccagagactacagagaacgtggtgtgtgccctgggcctgactgtgggtctggt
gggcatcattattgggaccatc
210321_at
gccaagtggaccacagctgtgcggcctctcaggctacctagcagcaaggcccaggtgaagccagggcagctgtgcagtgtg
gctggctggggttatgtctcaatgagcactttagcaaccacactgcaggaagtgttgctgacagtgcagaaggactgccagtgtg
aacgtctcttccatggcaattacagcagagccactgagatttgtgtgggggatccaaagaagacacagaccggtttcaaggggg
actccggggggcccctcgtgtgtaaggacgtagcccaaggtattctctcctatggaaataaaaaagggacacctccaggagtct
acatcaaggtctcacacttcctgccctggataaagagaacaatgaagcgcctctaacagcaggcatgagactaaccttcctctgg
gcctgaccatctctgggacagaggcaagaatccccaagggtg
217147_s_at
tctcctttctcaccaat?gggcaatagcccataattgaaataaatttctgattgaaaggtataggaaacattaaaatgcattactaagag
aagtaatataattttcttacaaagtatttttcccaaagatagctttactatttcaaaaattgtcaaattaatgcatgctccttacaacaaac
aaatatcaaaaagagtttaggaattctactagccagagatagtcacttggagaaactttctatatatccttctaaatatttttctgggca
tgctcatgtatgtacatcagttgtttctttttattttgaaccaaaaatgtggtttcttttgtacacattacttaaactttctttccagtcaacaa
tatattgtggatttattttcactgttatatttaactatatataaatacgcatatattgtaattttaatgtctgcttagcaccccactgataacc
aaatcacag
206298_at
aagctgcggaactctgaacgggcgcgggaggatgcggagaggaggaaccagctgttgcagagggaaatggaggagttttttt
cgaccctaggaagcttgactgttggggcaaaaggtgccagggccccaaagtaaaaggaatggcagagctcacttctgtaccac
gtctgctggtctccagccttgtatggagttagaagcgtctgtatctctggagcagccaggcgctctggagccagctggagagag
agagatcctgatacctctgtggggactgtggggacttttgggaccccacacactccaggtgggatcagatgctgctccaaccatg
cagttcctggtgagggtcagaaggggacggtaccaagagcagcgcttagcccttacccaggaaatatccttcatggccacaga
aatggagggcgcccaggatccaggcagccaccgggaacagtcagctttcttta
202990_at
agagcagatttccactgcaggcaccgaagcctcggggacaggcaatatgaagttcatgctaaatggggccctaactatcggga
ccatggatggggccaatgtggaaatggcagaagaagctggggaagagaacctgttcatctttggcatgaggatagatgatgtg
gctgctttggacaagaaagggtacgaggcaaacgaatactatgaggcacttccagagctgaagctggtcattgatcaaattgac
aatggctttttttctcccaagcagcctgacctcttcaaagatatcatcaacatgctattttatcatgacaggtttaaagtctttgcagact
acgaagcctatgtcaagtgtcaagataaagtgagtcagctgtacatgaatccaaaggcctggaacacaatggtactcaaaaacat
agctgcctcggggaaattctccagtgaccgaacaattaaagaatatgcccaaaacatctggaacgtggaaccttcagatctaaa
221671_x_at
caacaccgtgacaattggcctccgggggccactttcggcggagggaccaaggtggagatcaaacgaactgtggctgcaccat
ctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagag
gccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaggacagcaaggac
agcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcaccc
atcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgttagagggagaagtgcccccacctgctcctcagt
tccagcctgaccccctcccatcctttggcctctgaccctttttccacaggggacctacccctattgcggtcctccagctcatctttca
cctcacccccctcctcctccttggctttaattatgc
221651_x_at
gttatcctgtcacttttggccaggggaccaagctggagatcaaacgaactgtggctgcaccatctgtcttcatcttcccgccatctg
atgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtg
gataacgccctccaatcgggtaactcccaggagagtgtcacagagcaggacagcaaggacagcacctacagcctcagcagc
accctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccg
tcacaaagagcttcaacaggggagagtgttagagggagaagtgcccccacctgctcctcagttccagcctgaccccctcccatc
ctttggcctctgaccctttttccacaggggacctacccctattgcggtcctccagctcatctttcacctcacccccctcctcctccttg
gctttaattatgc
207651_at
ttgccttgtaattcgacagctctacagaaacaaagataatgaaaattacccaaatgtgaaaaaggctctcatcaacatacttttagtg
accacgggctacatcatatgctttgttccttaccacattgtccgaatcccgtataccctcagccagacagaagtcataactgattgct
caaccaggatttcactcttcaaagccaaagaggctacactgctcctggctgtgtcgaacctgtgctttgatcctatcctgtactatca
cctctcaaaagcattccgctcaaaggtcactgagacttttgcctcacctaaagagaccaaggctcagaaagaaaaattaagatgt
gaaaataatgcataaaagacaggattttttgtgctaccaattctggccttactgga
202988_s_at
gtgaacagcttggccttttttgggtgtcttgacaggccaagaagaacaaatgactcagaaccggattaacatgaaagttatccagg
cgcagagttgaagaagcataagcaagcaagacaaaaacagagagaccgcaaggaggaagatctgtggtactgtcataaaaaa
cagtggagctctgtattagaaaagcccctcagaactgggaaggccaggtaactctagttacacagaaactggtactaaagtctat
caaactgattacacagactgtaagaattcaaagtcaactgacatctatgctacatatattatatagtttgtacttgactatgagccatta
acttaaagcatatgtttcaaatagccattgctactattccttgtccggtgtaattttattttattgtttttactttggaagagatgaactgtgt
atttaacttaagctattgctcttaaaaccaggg
213418_at
ggttcatgaagccgagcagtacaaggctgaggatgaggcccagagggacagagtggctgccaaaaactcgctggaggccca
tgtcttccatgtgaaaggttctttgcaagaggaaagccttagggacaagattcccgaagaggacaggcgcaaaatgcaagacaa
gtgtcgggaagtccttgcctggctggagcacaaccagctggcagagaaggaggagtatgagcatcagaagagggagctgga
gcaaatctgtcgccccatcttctccaggctctatggggggcctggtgtccctgggggcagcagttgtngcnctcaagcccncca
gggggaccccagcaccggccccatcattgaggaggttgattgaatggcccttcgtgataagtcagctgtgactgtcagggctat
gctatgggccttctagactgtcttctatgatcctgcccttcagagatga
209901_x_at
ccagcatctgctgagctatgagccaaaccagggatttacagggaggaaaagctttcggactgctgaaggcccagcaggaaga
gaggctggatgagatcaacaagcaattcctagacgatcccaaatatagcagtgatgaggatctgccctccaaactggaaggctt
caaagagaaatacatggagtttgaccttaatggaaatggcgatattgatatcatgtccctgaaacgaatgctggagaaacttggag
tccccaagactcacctagagctaaagaaattaattggagaggtgtccagtggctccggggagacgttcagctaccctgactttct
caggatgatgctgggcaagagatctgccatcctaaaaatgatcctgatgtatgaggaaaaagcgagagaaaaggaaaagccaa
caggccccccagccaagaaagctatctct
205488_at
cagccacacgcgaaggtgaccttaaacttttacagctgacggaaaaagcaaaaattaacaaatatgtgactatccttcatctacct
aaaaagggggatgatgtgaaaccaggaaccatgtgccaagttgcagggtgggggaggactcacaatagtgcatcttggtccga
tactctgagagaagtcaatatcaccatcatagacagaaaagtctgcaatgatcgaaatcactataattttaaccctgtgattggaatg
aatatggtttgtgctggaagcctccgaggtggaagagactcgtgcaatggagattctggaagccctttgttgtgcgagggtgttttc
cgaggggtcacttcctttggccttgaaaataaatgcggagaccctcgtgggcctggtgtctatattcttctctcaaagaaacacctc
aactgga
217022_s_at
tcaagtgggaagagcgctgttcaaggaccacctgagcgtgacctctgtggctgctacagcgtgttccagtgtcctgccgggctgt
gccgagccatggaaccatggggagaccttcacttgcactgctgcccaccccgagttgaagaccccactaaccgccaacatcac
aaaatccggaaacacattccggcccgaggtccacctgctgccgccgccgtcggaggagctggccctgaacgagctggtgac
gctgacgtgcctggcacgtggcttcagcccaaggatgtgctggttcgctggctgcaggggtcacaggagctgccccgcgaga
agtacctgacttgggcatcccggcaggagcccagccagggcaccaccaccttcgctgtgaccagcatactgcgcgtggcagc
cgaggactggaagaagggggacaccttctcctgcatggtgggccacgaggccctgccgctggccttcacacagaagaccatc
gaccgcttggcgggtaaacccacccatgtcaatgtgtctgttgtcatggcgga
207339_s_at
gcaggggctaggctgggagacgacgaaggaacaggcgtttctgacgagcgggacgcagttctcggacgccgaggggctgg
cgctcccgcaggacggcctctattacctctactgtctcgtcggctaccggggccgggcgccccctggcggcggggaccccca
gggccgctcggtcacgctgcgcagctctctgtaccgggcggggggcgcctacgggccgggcactcccgagctgctgctcga
gggcgccgagacggtgactccagtgctggacccggccaggagacaagggtacgggcctctctggtacacgagcgtggggtt
cggcggcctggtgcagctccggaggggcgagagggtgtacgtcaacatcagtcaccccgatatggtggacttcgcgagagg
gaagaccttctttggggccgtgatggtggggtgagggaatatgagtgcgtggtgcgagtgcgtgaatattgggggcccggac
206337_at
gtgggagtggcctgaagagtcctctgaatgaaccttctggcctcccacagactcaaatgctcagaccagctcttccgaaaacca
ggccttatctccaagaccagagatagtggggagacttcttggcttggtgaggaaaagcggacatcagctggtcaaacaaactct
ctgaacccctccctccatcgttttcttcactgtcctccaagccagcgggaatggcagctgccacgccgccctaaaagcacactca
tcccctcacttgccgcgtcgccctcccaggctctcaacaggggagagtgtggtgtttcctgcaggccaggccagctgcctccgc
gtgatcaaagccacactctgggctccagagtggggatgacatgcactcagctcttggctccactgggatgggaggagaggaca
agggaaatgtcaggggcggggagggtgacagtggccgcccaaggccacgagcttgttctttgttctttgtcacagggactgaa
aacctctcctcatgttctgctttcgattcgttaagagagcaacattttacccacaca
208894_at
cgatcaccaatgtacctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctcatctgtttcat
agacaagttcacccca
39729_at
acacaattaggctggctaacggatagtgagcttgtgcccctgcctaggtngcctgtgctgggtgtccancctgtgcccccancct
gggtgcccnnnnnnnnnnnnnnnnnnnggccagacctgcccctccaaactccacagtatgggaccctggagggntannn
nnnnnnnnnnnnatgcctccacctagaagntgaatagtgacgccctcccccaagcccacccagccgcacacaggcctaga
ggtaaccaataaagt
209500_x_at
catggagctccgaattcttgcgtgtgtgtagatgaggggcgggggacgggcgccaggcattgttcagacctggtcggggccca
ctggaagcatccagaacagcaccaccatctagcggccgctcgagggaagcacccgccggttggccgaagtccacgaagccg
ccctctgctagggaaaacccctggttctccatgccacacctctctccaggtgccctctgcctcttcaccccacaagaagccttatc
ctacgtccttctctccatctatcggaccccagtttccatcactatctccagagatgtagctattatgcgcccgtctacagggggtgcc
cgacgatgacggtgccttcgcagtcaaattactcttcgggtcccaaggtttggctttcacgcgctccattgccccggcgtggcag
gccattccaagcccttccgggctggaactggtgtcggaggagcctcgggtgtatcgtacgccctggtgttggtgttgcctcactc
ctctgagctcttctttctgatcaagcc
214677_x_at
tcataagtgacttctacccgggagccgtgacagtggcctggaaggcagatagcagccccgtcaaggcgggagtggagaccac
cacaccctccaaacaaagcaacaacaagtacgcggccagcagctatctgagcctgacgcctgagcagtggaagtcccacaga
agctacagctgccaggtcacgcatgaagggagcaccgtggagaagacagtggcccctacagaatgttcataggttctcaaccc
tcac
210314_x_at
catggagctccgaattcttgcgtgtgtgtagatgaggggcgggggacgggcgccaggcattgttcagacctggtcggggccca
ctggaagcatccagaacagcaccaccatctagcggccgctcgagggaagcacccgccggttggccgaagtccacgaagccg
ccctctgctagggaaaacccctggttctccatgccacacctctctccaggtgccctctgcctcttcaccccacaagaagccttatc
ctacgtccttctctccatctatcggaccccagtttccatcactatctccagagatgtagctattatgcgcccgtctacagggggtgcc
cgacgatgacggtgccttcgcagtcaatttactcttcgggtcccaaggtttggctttcacgcgctccattgccccggcgtggcagg
ccattccaaggccttccgggctggaactggtgtcggaggagcctcgggtgtatcgtacgccctggtgttggtgttgcctcactcct
ctgagctcttctttctgatcaagcc
209138_x_at
tctctgggctccaggctgaggacgaggctgattattactgctgctcatatgcaggtagttacactgtggttttcggcggagggacc
aaactgaccgtcctaggtcagcccaaggctgccccctcggtcactctgttcccgccctcctctgaggagcttcaagccaacaag
gccacactggtgtgtctcataagtgacttctacccgggagccgtgacagtggcctggaaggcagatagcagccccgtcaaggc
gggagtggagaccaccacaccctccaaacaaagcaacaacaagtacgcggccagcagctatctgagcctgacgcctgagca
gtggaagtcccacagaagctacagctgccaggtcacgcatgaagggagcaccgtggagaagacagtggcccctacagaatg
tt
207831_x_at
tgaggactggctgatgcccattctggaccagatggtgatggagcagaacacagagggtgtaaagtggacgccttctaagatgat
cgcccggctgggcaaggagatcaacaacccagagtccgtgtattactgggcccagaagaaccacatccctgtgtttagtcccg
cacttacagacggctcgctgggcgacatgatcttcttccattcctacaagaacccgggcctggtcctggacatcgttgagggtgc
ccgaccagacgaggctgtctcctggggcaagatccgggtggatgcacagcccgtcaaggtctatgctgacgcctccctggtctt
ccccctgcttgtggctgaaacctttgcccagaagatggatgccttcatgcatgagaagaacgaggactgagcggctgcggtccc
aggaaggtcttaccccctcttctatttattaatttgcagacccagcccctcccctactttttggtcagctacgtctctagaa
215121_x_at
aagccaacaaggccacactggtgtgtctcataagtgacttctacccgggagccgtgacagtggcctggaaggcagatagcagc
cccgtcaaggcgggagtggagaccaccacaccctccaaacaaagcaacaacaagtacgcggccagcagctanctgagcctg
acgcctgagcagtggaagtcccacanaagctacagctgccaggtcacgcatgaagggagcaccgtggagaagacagtggcc
cctacagaatgttcataggttctn?nanccctcancccccnnccacgggagactagagctgcaggatcccaggggaggggtct
ctcctcccaccccaaggcatcaagcccttctccctgcactcnataaacccncaataaatatnctcattngntcaancagaaannn
nnnnnnannnnattttttttctcacataaattgctagcctccccggggttctcagtgtggggtacagggaattctgcacccagtgt
gaaaatcacccaagggagaggctcacagcctccctgagtcatctcaccagaggg
215946_x_at
gcaacatgcaggttcctgctccagcgnggctcctggactggcnccngntgctgnccnngggggtttcaatccaagcataattc
agtgaagcatgtgtttggcagngggacccagctcacngttttaggtcagcccaagncnaccccntcggtcantctgttcctgcc
gtcctntgaggagcnccaagccaacaaggccacactggtgtgtctcatgaatnacttnnnncngggaatcttganggtgacct
ggaaggcagatggtacccncatcacccagngcgtggagangaccacgccnctccaaacagagcaacancaagtacatggc
cagcagctacctgagcctgacgcccgagcagtggaggtcccgcagaagctacagctgccaggtcatgcatgaagggagcac
tgcagagaagacggtggcccctgcagaatgttcataggttcccagcccccaccccacccacaggggcctggagctgcaggat
cccaggggaggcgtc
204069_at
aagccttacagttatcctgcaagggacaggaaggtctgatttgcaggatttttagagcattaaaataactatcaggcagaagaatct
ttcttctcgcctaggatttcagccatgcgcgcgctctctctctttctctctcttttcctctctctccctctttctagcctggggcttgaattt
gcatgtctaattcatttactcaccatatttgaattggcctgaacagatgtaaatcgggaaggatgggaaaaactgcagtcatcaaca
atgattaatcagctgttgcaggcagtgtcttaaggagactggtaggaggaggcatggaaaccaaaaggccgtgtgtttagaagc
ctaattgtcacatcaagca?tcattgtccccatgcaacaaccaccaccttatacatcacttcctgttttaagcagctctaaaacatagac
tgaagatttatttttaatatgttgactttatttctgagcaaagcatcggtcatgtgtgtattttttcatagtcccaccttggagcatttatg
204698_at
caagttcatccggcctgagggagagatcaccgattacagaacccgggtcagcggggtcacccctcagcacatggtgggggcc
acaccatttgccgtggccaggctagagatcctgcagctcctgaaaggcaagctggtggtgggtcatgacctgaagcacgacttc
caggcactgaaagaggacatgagcggctacacaatctacgacacgtccactgacaggctgttgtggcgtgaggccaagctgg
accactgcaggcgtgtctccctgcgggtgctgagtgagcgcctcctgcacaagagcatccagaacagcctgcttggacacagc
tcggtggaagatgcgagggcaacgatggagctctatcaaatctcccagagaatccgagcccgccgagggctgccccgcctgg
ctgtgtcagactgaagccccatccagcccgttccgcagggactagaggctttcggctttttgggaca
209906at
gaaagcaaggcagtccattcagggaattctggaggcagccttcagtgaggagctcacacgttccacccactgtccctcaaacaa
tgtcatttcagaaagaaatagtacaactgtgtgaaaatgtggagcagccaacaagcaggggctcttaggcaatcacatagtgaaa
gtttataagaggatgaagtgatatggtgagcagcggacttcaaaaactgtcaaagaatcaatccagcggttctcaaacggtacac
agactattgacatcagcatcacctagaaacttgttagaaatgcaaattctcaagccgcatcccagacttgctgaatcggaatctctg
ggggttgggacccagcaagggcacttaacaaacccccgtttctgattaatgctaaatgtaagaatcattgtaaacattagttctattt
ctatcccaaactaagc
205608_s_at
agagcagcctgatcttacacggtgctgatttcagcactaaagatgctgataatgacaactgtatgtgcaaatgtgccctcatgttaa
caggaggatggtggtttgatgcttgtggcccctccaatctaaatggaatgttctatactgcgggacaaaaccatggaaaactgaat
gggataaagtggcactacttcaaagggcccagttactccttacgttccacaactatgatgattcgacctttagatttttgaaagcgca
atgtcagaagcgattatgaaagcaacaaagaaatccggagaagctgccaggtgagaaactgtttgaaaacttcagaagcaaac
aatattgtctcccttccagcaataagt?ggtagttatgtgaagtcaccaaggttcttgaccgtgaatctggagccgtttgagttcacaa
gagtctctacttggggtgacagtgctcacgtggctcgactatagaaaactccactgactgtcgggctttaaaaagggaagaaact
gctgagcttgctgtgcttcaaactactact
205927_s_at
tccacacacggccaggcctgtttatctacactgctgcccactcctctctccagctccacatgctgtacctggatcattctgaagcaa
attccgagcattacatcattttgtccataaatatttctaacatccttaaatatacaatcggaattcaagcatctcccattgtcccacaaat
gtttggctgtttttgtagttggattgtttgtattaggattcaagcaaggcccatatattgcatttatttgaaatgtctgtaagtctctttccat
ctacagagtttagcacatttgaacgttgctggttgaaatcccgaggtgtcatttgacatggttctctgaacttatctttcctataaaatg
gtagttagatctggaggtctgattttgtggcaaaaatacttcctaggtggtgctgggtacttcttgttgcatcctgtcaggaggcaga
taatgctggtgcctctctattggtaatgttaagactgctgggtgggtttggagttcttggc
215051_x_at
tgctgaaaaccctccagtcagcgcttatcccttctgctctctcccctcacccagagaaatacatggagtttgaccttaatggaaatg
gcgatattgatatcatgtccctgaaacgaatgctggagaaacttggagtccccaagactcacctagagctaaagaaattaattgga
gaggtgtccagtggctccggggagacgttcagctaccctgactttctcaggatgatgctgggcaagagatctgccatcctaaaaa
tgatcctgatgtatgaggaaaaagcgagagaaaaggaaaagccaacaggccccccagccaagaaagctatctctgagttgcc
ctgatttgaagggaaaagggatgatgggattgaaggggcttctaatgacccagatatgg
205609_at
gtttaccatcaagtcttttttatatttatgtgtctgtattctacccctttttgccttacaagtgatatttgcaggtattataccatttttctattctt
ggtggcttcttcatagcaggtaagcctctccttctaaaaacttctcaactgttttcatttaagggaaagaaaatgagtattttgtcctttt
gtgttcctacagacactttcttaaaccagtttttggataaagaatactatttccaaactcatattacaaaaacaaaataaaataataaaa
aaagaaagcatgatatttactgttttgttgtctgggtttgagaaatgaaatattgtttccaattatttataataaatcagtataaaatgtttt
atgattgttatgtgtattatgtaatacgtacatgtttatggcaatttaacatgtgtattcttttcatttaattgtttcagaataggataattagg
tattcgaattttgtctttaaaattcatgtggtttctatgcaaagttcttcatatcatcaca
202890_at
aatgatggaatgttgactgtgtttggcacacaggacacggaccttcatggaagtccttgctctgcgtggcatctgtcagcttttcac
ctttcattcttattcttcacttttgctgctgagcctagctgtacaaacttgcactttcatttgctaatataaattcagttttattttaccatttta
gagactactaatgattaaatgtagaaggagagggtgcacatgtttttatgtggagtgtttaaaagataaatttataccactgtaatgtg
cagcttttattaaaagagaaattggttgaactgctaggttgaatgagagacttcatctattggactattttttttaatccaggcatatggt
ctttagtaatggcttgtaatttgtgaaaacattaatttgggggttttccctgttttcagttgtccatgtacacatagtcattatattagaaaa
gaaagctgttcaacaaacttgtttaatttgtttaaatcaacatagcatgaaacaccaaat
203485_at
aagcagtcgaccgcacttatggtaatcagttttgtataacttaaaataattaaataaatgaataaatccaaaacaaacatgcagtactt
ttgttgtatgggattggtgggctgatttacatgtatggttactaaaaagtaccagcatgttaactttattacaatttgtattactttctctgt
agttcctaatggattcaattacggactctggatatttgcactt
Claims (2)
1. measure the method that acute myeloid leukaemia (AML) patient reacts Zarnestra for one kind, said method comprises the two gene expression ratio (RASGRP1: APTX) that measures among the said patient.
2. the process of claim 1 wherein that said AML is selected from AML, recurrence or the intractable AML that newly makes a definite diagnosis.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US89430807P | 2007-03-12 | 2007-03-12 | |
US60/894308 | 2007-03-12 | ||
PCT/US2008/056636 WO2008112749A1 (en) | 2007-03-12 | 2008-03-13 | Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase |
Publications (1)
Publication Number | Publication Date |
---|---|
CN102317772A true CN102317772A (en) | 2012-01-11 |
Family
ID=39759983
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2008800157636A Pending CN102317772A (en) | 2007-03-12 | 2008-03-13 | Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP2135073A4 (en) |
JP (1) | JP2011512785A (en) |
KR (1) | KR20090113972A (en) |
CN (1) | CN102317772A (en) |
AU (1) | AU2008225130A1 (en) |
BR (1) | BRPI0808872A2 (en) |
CA (1) | CA2680909A1 (en) |
MX (1) | MX2009009841A (en) |
WO (1) | WO2008112749A1 (en) |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ES2354922B1 (en) | 2009-09-02 | 2012-02-07 | Fundacion Institut De Recerca De L'hospital Universitari Vall D'hebron | MARKERS FOR THE SELECTION OF PERSONALIZED THERAPIES FOR THE TREATMENT OF THE C�? NCER. |
US11559540B2 (en) | 2010-07-28 | 2023-01-24 | Janssen Pharmaceutica Nv | Method of determining acute myeloid leukemia response to treatment with farnesyltransferase inhibitors |
EP3489680B1 (en) * | 2010-07-28 | 2024-07-03 | Janssen Pharmaceutica NV | Method of determining acute myeloid leukemia response to treatment with farnesyltransferase inhibitors |
CN108465728A (en) * | 2018-03-08 | 2018-08-31 | 佛山尘凡环保科技有限公司 | A kind of high damping copper alloy material equipment |
CN108294839A (en) * | 2018-03-08 | 2018-07-20 | 广州燃烧医疗技术开发有限公司 | A kind of dental implant equipment of stabilization |
CN108500113A (en) * | 2018-03-08 | 2018-09-07 | 广州峥航机械设备有限公司 | A kind of novel die design and fabrication technology equipment |
CN108339880A (en) * | 2018-03-08 | 2018-07-31 | 佛山尘凡环保科技有限公司 | A kind of high damping copper alloy material equipment of low cost |
CN108453165A (en) * | 2018-03-08 | 2018-08-28 | 广州峥航机械设备有限公司 | A kind of advanced mold design and manufacturing technology equipment |
CN108326118A (en) * | 2018-03-08 | 2018-07-27 | 佛山尘凡环保科技有限公司 | A kind of Novel high-damping copper alloy material equipment |
CN108500115A (en) * | 2018-03-08 | 2018-09-07 | 广州拓讯安防科技有限公司 | A kind of novel precise form fabrication device |
CN108481435A (en) * | 2018-03-08 | 2018-09-04 | 广州拓讯安防科技有限公司 | A kind of precision form manufacturing device |
CN108500114A (en) * | 2018-03-08 | 2018-09-07 | 广州峥航机械设备有限公司 | A kind of efficiently advanced mold design and manufacturing technology equipment |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2451168A1 (en) * | 2001-10-30 | 2003-05-08 | Ortho-Clinical Diagnostics, Inc. | Methods for assessing and treating leukemia |
US20050003422A1 (en) * | 2003-07-01 | 2005-01-06 | Mitch Reponi | Methods for assessing and treating cancer |
-
2008
- 2008-03-13 JP JP2009553739A patent/JP2011512785A/en not_active Abandoned
- 2008-03-13 EP EP08731984A patent/EP2135073A4/en not_active Withdrawn
- 2008-03-13 MX MX2009009841A patent/MX2009009841A/en not_active Application Discontinuation
- 2008-03-13 CA CA002680909A patent/CA2680909A1/en not_active Abandoned
- 2008-03-13 WO PCT/US2008/056636 patent/WO2008112749A1/en active Application Filing
- 2008-03-13 BR BRPI0808872-1A2A patent/BRPI0808872A2/en not_active IP Right Cessation
- 2008-03-13 CN CN2008800157636A patent/CN102317772A/en active Pending
- 2008-03-13 AU AU2008225130A patent/AU2008225130A1/en not_active Abandoned
- 2008-04-29 KR KR1020080039704A patent/KR20090113972A/en not_active Application Discontinuation
Also Published As
Publication number | Publication date |
---|---|
CA2680909A1 (en) | 2008-09-18 |
WO2008112749A1 (en) | 2008-09-18 |
BRPI0808872A2 (en) | 2014-11-11 |
EP2135073A4 (en) | 2011-09-21 |
KR20090113972A (en) | 2009-11-03 |
JP2011512785A (en) | 2011-04-28 |
EP2135073A1 (en) | 2009-12-23 |
AU2008225130A1 (en) | 2008-09-18 |
MX2009009841A (en) | 2009-09-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102317772A (en) | Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase | |
Swanton et al. | Consensus on precision medicine for metastatic cancers: a report from the MAP conference | |
Raponi et al. | A 2-gene classifier for predicting response to the farnesyltransferase inhibitor tipifarnib in acute myeloid leukemia | |
Prabhu et al. | Dopamine receptor D5 is a modulator of tumor response to dopamine receptor D2 antagonism | |
Jimeno et al. | Coordinated epidermal growth factor receptor pathway gene overexpression predicts epidermal growth factor receptor inhibitor sensitivity in pancreatic cancer | |
JP7055778B2 (en) | Assay to identify patients responding to farnesyltransferase inhibitors | |
AU2014227883B9 (en) | Classification and actionability indices for lung cancer | |
US20230270769A1 (en) | Method of Determining Acute Myeloid Leukemia Response to Treatment With Farnesyltransferase Inhibitors | |
US7932036B1 (en) | Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase | |
Dierlamm et al. | Gain of chromosome region 18q21 including the MALT1 gene is associated with the activated B-cell-like gene expression subtype and increased BCL2 gene dosage and protein expression in diffuse large B-cell lymphoma | |
Kishiki et al. | Impact of genetic profiles on the efficacy of anti-EGFR antibodies in metastatic colorectal cancer with KRAS mutation | |
CN102443626B (en) | Detection kit for lung cancer driving gene mutation | |
EP3257950B1 (en) | Methods and means for typing a sample comprising cancer cells based on oncogenic signal transduction pathways | |
US20240076742A1 (en) | Methods for improved cancer treatment | |
Piontek et al. | ETMR-11. Transcriptional changes upon knockdown of altered BCOR/BCORL1 transcripts in preclinical models of CNS embryonal tumors with BCOR-related alterations | |
Jian et al. | Identification of acute myeloid leukemia-driven genes by multi-dimensional approach | |
KR20100113972A (en) | Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase | |
Jackson | Molecular perspectives on the non-responder phenomenon | |
Klil-Drori et al. | Michel-Olivier Gratton2, Alexa Del Corpo3, Harold J. Olney4, Robert Delage5, Pierre Laneuville6, Luigina Mollica2, Lambert Busque2, Sarit E. Assouline3, On behalf of the Quebec CML Group | |
Rosell et al. | EGFR inhibitors: patient selections and clinical outcome |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120111 |