CN102309758B - Medicinal composition for treating diseases caused by enterovirus infections - Google Patents
Medicinal composition for treating diseases caused by enterovirus infections Download PDFInfo
- Publication number
- CN102309758B CN102309758B CN 201010215943 CN201010215943A CN102309758B CN 102309758 B CN102309758 B CN 102309758B CN 201010215943 CN201010215943 CN 201010215943 CN 201010215943 A CN201010215943 A CN 201010215943A CN 102309758 B CN102309758 B CN 102309758B
- Authority
- CN
- China
- Prior art keywords
- virus
- interferon
- group
- cell
- agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to a medicinal composition, which particularly consists of a first agent of an antiviral medicament and a second agent of an immunomodulator, wherein the first agent, which is prepared by blocking virus messenger ribose nucleic acid (mRNA) translation and inhibiting the synthesis of virus nucleic acid in a cell. The medicinal composition can be used for treating organic pathological changes caused by enterovirus infections, such as a hand, foot and mouth disease.
Description
Technical field
The present invention relates to a kind of pharmaceutical composition for the treatment of the disease that enterovirus infection causes, be specifically related to be included in blocking-up virus mRNA translation in the cell, suppress the first synthetic agent of viral nucleic acid and by regulating immune response with the Pharmaceutical composition that the second agent that obtains cellular immunization forms, belong to field of biological pharmacy.
Background technology
Hand-foot-mouth disease (Hand-food-mouth disease, HFMD) is global infectious disease, and whole world most areas all has the popular bibliographical information of this disease.Nineteen fifty-seven, New Zealand's reported first should disease, isolates COxsackie (coxsackie, Cox) virus from this disease.The HFMD pathogen of finding is mainly Cox A 16 types, and the U.S. in 1972 confirms that the HFMD pathogen is enterovirus (enteric virus, EV) 71.After this, EV71 infects with CoxA16 and infects alternately appearance, becomes the main pathogens of HFMD.The epidemiological study of HFMD is shown ball popular interval is 2-3, the later stage nineties 20th century, EV71 begins in the East Asia Region popular, wherein, it was higher to merge the central nervous system symptom incidence rate at Malaysia and the HFMD in the Taiwan outburst in 1998 in 1997.The HFMD infectiousness is strong, the route of transmission is complicated, epidemic strength is large, propagation is fast, but large tracts of land is popular in the short time, the HFMD source of infection is virus, a large amount of viruses are present in the patient and healthy person is pharyngeal, in feces and the bleb liquid, by water and the food of the spittle, saliva, feces, pollution, through respiratory tract and alimentary infection.The HFMD acute stage,, virus continues survival 3-5 week in pharyngeal sustainable survival 1-2 week in the feces, the longlyest reaches for 11 weeks, usually with after falling ill 1 week interior infectiousness the strongest.Though each age group all can infect HFMD, cause Outbreak in the infant of being everlasting, multiplely be born in children's below 5 years old, and the sickness rate of baby below 3 years old is the highest.The HFMD clinical symptoms that EV71 infects, often CoxA16 infects finally, but the clinical manifestation that EV71 infects changes greatly, and the lighter can be without obvious General Symptoms (about 71%), severe patient die (about 0.05%) that can cause death, wherein, when HFMD merged pulmonary edema, mortality rate was the highest, and it is relevant that clinical prognosis and EV71 virus virulence, virus load and meter are put forward immunologic function, think that at present HFMD is irrelevant with the genotype of virus.EV71 infects and causes meter to propose infringement, cell immune response but not humoral immune reaction, studies show that, merge in the HFMD infant of pulmonary edema, cytokine helper T lymphocyte (the helper T lymphocyte of reflection cell immune response, TH) (gamma interferon, interleukin 1, interleukin-6 and tumor necrosis factor) etc., be starkly lower than HFMD infant (the Chang LY without pulmonary edema, Hsiung CA, Lu CY, et al.Status of cellular rather than humoral immunity is correlated with clinical outcome of enterovirus 71.Pediat r Res, 2006,60 (4): 466-471).Cellular immune function is low, can postpone virus sweep, cause the virus diffusion, cause lasting confirmatory reaction, cause at last pulmonary edema, body's immunity also plays a significant role, in cellular immunization is grown still jejune HFMD infant, if self cellular immunization is weaker than humoral immunization, infecting gets along with behind the EV71 is the tendency of serious symptom HFMD.
The t lymphocyte subset group is the important cells that consists of the immunity of organism anti-epidemic system, comprises helper T cell CD in the T lymphocyte
4+With suppressor T lymphocyte CD
8+2 main subgroups, this 2 class cell mutually changes, regulates, and can keep the immunologic balance in the body.CD
4+Has the effect of regulating immune response activity, auxiliary B cell generation antibody, secrete cytokines; And CD
8+Immunosuppressant and Cytotoxic effect are arranged.CD
4+, CD
8+Become respectively the receptor of mhc class ii molecule and I quasi-molecule, CD
4+, CD
8+Appear at respectively the T cell surface with difference in functionality subgroup.Only express at same T cell surface wherein excessively a kind of, CD
4+With CD
8+Suitable ratio is to keep body with anti-key factor, and CD
4+With CD
8+Ratio is the foundation of an important assessment immune status.CD
4+/ CD
8+It is the important indicator of imianyi defective that ratio reduces.
HFMD is self-limited disease to the light disease infant of the overwhelming majority, at present, the treatment of HFMD is mainly supported as main to suit the medicine to the illness, viral dna polymerase inhibitor ganciclovir, acyclovir, ribavirin also are usually used in HFMD patient's treatment, also obtained certain curative effect, but produce easily drug resistance, make its clinical being restricted.According to infant blood pressure, circulation change, also can select milrinone to strengthen myocardial contraction, reduce afterload, thereby reduce the HFMD mortality rate.
In addition, the effectively always generation of inflammation of intravenous injection of immunoglobulin (IG), the central nervous system infection that EV71 is caused has certain curative effect.Report in the recent period a kind of new drug Pleconaril (Pleconaril) abroad, its oral absorption is good, virus to school RNA viruses section, particularly meningitis of causing of enterovirus etc. has preferably curative effect, but relief of symptoms, shorten the course of disease persistent period (Romero JR.Pleconaril:a novel antipicornaviral drug[J] .Exper opin Investing Drugs, 2001,10 (2): 369-379), the Pleconaril mechanism of action may be by stoping the virus and host cell receptor in conjunction with suppressing virus replication.
Interferon is as a kind of effective anti-virus formulation, has been widely used in clinically, and capacity is used the cellular immunity that IFN can improve body, reaches to suppress virus, promote the physical recovery purpose.Interferon local skin external energy direct effect territory is by the target cell of virus attack, the rapidly development of control erythra, herpesvirus infection had obvious therapeutic effect, at present clinical commonly used be rIFN α-1b ointment formulation, current research shows, rIFN α-1b Chitosan film has preferably therapeutic effect (Chen Yong to the guinea pig skin herpesvirus infection, Chen Yan. recombinantinterferonα-1b Chitosan film is to the therapeutical effect of guinea pig skin herpesvirus infection. Chinese pharmacists, 2006,9 (10): 901-902).Arya (Arya SC.Antiviral therapy for neurological manifestations of enterovirus 71infection[J] .Clin Infect Dis, 2000,30:988-992) attempt treating the central nervous system infection that EV71 causes with IFN-α, the result shows, uses in early days reversible virus to neural damage.
Because hand-foot-mouth disease often causes Cellular Immunity reaction infringement, the interferon of capacity uses the cellular immunity that can improve body, the various cell functions of known disturbances element impact, be included in dna replication dna and RNA and protein synthesis in normal and the abnormal cell, thereby the cytotoxic effect of interferon is not limited to virus infected cell and also is presented in the cell of normal health, therefore, during interferon therapy, when especially needing high dose, can produce the side effect of not expecting.Use interferon can cause bone marrow depression, so that reduce erythrocyte, leukocyte and platelet levels, more the interferon of high dose causes influenza-like symptom, gastrointestinal dysfunction, dizziness and cough usually.
Summary of the invention
The object of the present invention is to provide a kind of pharmaceutical composition for the treatment of hand-foot-mouth disease, the pharmaceutical composition for the treatment of hand-foot-mouth disease of the present invention comprises that a class has the first agent of antivirus action, and a class has the second agent of regulating the immunity of organism effect.
A class has the first agent of antivirus action among the present invention, can be the viral dna polymerase inhibitor, such as ucleosides Aciclovir, ganciclovir or ribavirin, also can be the viral dna polymerase inhibitor of other class.
Perhaps, the first agent with antivirus action among the present invention also can be blocking virus mRNA translation, suppress the synthetic agent of viral nucleic acid, as being interferon, such as I type interferon (Interferon α1 b, Interferon α1 b, interferon beta, interferon ω).
Among the present invention, described have regulate immune response to obtain the second agent of organism immune response, can be to reply by improving humoral immunity of organism, obtaining the immunity of organism intensified response, as can being bacterin preparation, or plasmid.
Among the present invention, described have the immune response of adjusting to obtain the second agent of organism immune response, is a kind of by stimulating immune response to obtain the agent of Cellular Immunity reaction.
Cellular immunization is after the T cell is subject to antigenic stimulus, to break up, breed, be converted into sensitized T cell, when same antigen enters body again, and the Synergistic killing effect of the lymphokine that sensitized T cell discharges directly upper effect and the sensitized T cell of antigen.
Such as, this obtaining stimulates immune response to obtain the agent of Cellular Immunity reaction, such as can be a kind of SCIF, promote in vivo increment and the differentiation such as B cell, T cell, natural killer cell and lymphocyte activation killer cell
This agent can be the collaborative APC of stimulation and T cell activation, promotes B cell proliferation and secretory antibody to regulate to produce cellular immunization, such as interleukin 1; Also can make and pass through activating T cell, promote cytokine to produce, stimulate the NK cell proliferation, strengthen the agent of NK killing activity and produce cytokine, induce the LAK cell to produce, and promote the agent that B cell proliferation and secretory antibody, activating macrophage are adjusted to obtain cellular immunization, and such as interleukin II, interleukin 15; Or by activating and strengthening the generation that IFN-is induced in the agent of NK cell killing activity, promote Th0 to the Th1 cell differentiation, and strengthen the CD8+CTL cell killing activity, induce the LAK cell to produce to obtain the agent that cellular immunization is adjusted, such as interleukin 12.Also can be to obtain cellular immunization by other approach to regulate the interleukin cytokine.
Among the present invention, the second agent is except the cytokine of these some row of interleukin, can also be that other has the cytokine of regulating the Cellular Immunity activity, such as IFN-γ, IFN-γ is by increasing the expression of cell surface MHC II quasi-molecule, regulate the relation between macrophage, T cell, the B cell, strengthen the immunne response ability.
Among the present invention, preferred the first agent is IFN-a1b, IFN-a2b, IFN-; IFN-a2b more preferably.Preferred the second agent is IFN-γ or interleukin 15.
Among the present invention, by the first agent I type interferon is combined with the second agent cytokine with immunoregulation effect, when the disease that the treatment viral infection causes, can reduce the consumption of I type interferon, alleviate owing to needing high dose to use I type interferon with the risk of the series of side effects that obtains antiviral effect preferably and produce.
Among the present invention, described the second agent of replying to obtain cellular immunization by enhancing human body immunity, it can also be plant extract, extract (comprising lentinan, ganoderan, astragalus polysaccharides etc.) such as some polysaccharides, perhaps obviously point out the natural plants with immunoregulation effect, such as Radix Ginseng, the Radix Astragali, Ganoderma etc.; Or by the mycelium (such as the Pleurotus eryngii mycelium) that obtains of fermentation, or the effective ingredient with immunoregulation effect of marine algae, deep-sea animal-plant kind.
Among the present invention, the disease that described enterovirus causes comprises hand-foot-mouth disease, and wherein enterovirus is Coxsackie virus or intestinal EV71 virus.
Specific embodiment
The present invention further illustrates by following embodiment, but any embodiment or its combination not should be understood to the restriction to scope of the present invention or embodiment.Scope of the present invention is limited by appended claims, and in conjunction with the general general knowledge of this description and this area, those of ordinary skills can clearly understand claims limited range.Under prerequisite without departing from the spirit and scope of the present invention, those skilled in the art can carry out any modification or change to technical scheme of the present invention, and this modification and change are also contained in the scope of the present invention.
Embodiment one virus multiplication
With 1X10
5The EV71 virus inoculation of PFU adds maintenance medium and puts and cultivate the pathological changes that occurs behind the 72h more than 90% in 37 ℃, 5%CO2 incubator on monolayer human rhabdomyosarcoma cells (RD cell), blow and beat after the freeze thawing 3 times centrifugal, quantitative separating ,-80 ℃ of refrigerators are frozen for subsequent use.
With 1X10
5The CoxA16 virus inoculation of PFU is cultivated the pathological changes that occurs behind the 72h more than 90% in 37 ℃, 5%CO2 incubator in monolayer cervical cancer cell (Hela cell) culture bottle, blow and beat after the freeze thawing 3 times centrifugal, quantitative separating ,-80 ℃ of refrigerators are frozen for subsequent use
Embodiment two toxicity tests
Respectively EV71 virus for subsequent use and CoxA16 virus are done 10 multiple proportions serial dilutions with maintenance medium (containing 2% newborn hyclone), vertically repeat 3 holes, laterally be seeded in respectively on the monolayer RD cell in 96 orifice plates and on the monolayer Hela cell in 96 orifice plates, 37 ℃, 5%CO2 cultivates, observe pathological changes every day, behind the 96h liquid suction in the plate hole is abandoned, add 1% dimethyl diaminophenazine chloride, 100 μ l and put 37 ℃ of dyeing 2h, abandon dye liquor, with the abundant eluting of excess dyestuff, add destaining solution 100 μ l with washing liquid, room temperature decolouring 10min, measuring the OD value with microplate reader at the 540nm wavelength, is 10-5.2 by calculating EV71 virus TCID50, and CoxA16 virus TCID50 is 10-4.8.
Embodiment three viruses detect
Use the Trizol method to extract viral RNA, and in time packing is stored in-80 ℃, with RT-PCR amplicon virus VP1 genetic fragment, agarose gel electrophoresis detects RT-PCR result.Complete genome sequence according to the international standard strain, and the strains gene order with reference to the Asia, utilize software DNASTAR and the following primer of Primer premier 5.0 designs: the forward primer of EV71 virus: GCA GCC CAA AAG AAC TTC, downstream primer: ATT TCAGCA GCT TGG AGTG, purpose fragment 226bp.The forward primer CCTATTGCAGACATGATTGAC of CoxA16 virus, downstream primer TGTTGTTATCTTGTCTCTAC, purpose fragment 900bp.
Embodiment four interferon a2b suppress the test of EV71 virus multiplication
1ml interferon a2b (1X108IU/mg) is diluted for behind 1X107IU/ml, 1X105IU/ml, the 1X103IU/ml, vertically repeat respectively 3 holes, the RD cell monolayer of horizontal 96 orifice plate EV71 infection adds 10 μ l interferon a2b successively, establishes simultaneously negative control.Pathological changes is observed in 37 ℃, 5%CO2 cultivation every day, stops afterwards in 5 days.The result shows that the cell CPE of interferon a2b processed group is 31.2 ± 2.1%, significantly is lower than negative control cell group 69.1 ± 5.1%, illustrates that interferon a2b can effectively suppress cytopathy and apoptosis that EV71 virus causes.
Embodiment five sets up the hand-foot-mouth disease mouse model
Carry out respectively lumbar injection EV71 and CoxA16 virus by the Balb/C mice of giving Mus age on the 7th, set up EV71 and CoxA16 animal model, EV71 virus and CoxA16 Viral infection dosage TCID50 are 1X107, after inoculating for 1 week, it is depressed that lethargy appears in mice, the movable minimizing, the back of a bow, inappetence, the symptoms such as bradykinesia, randomly draw part mice euthanasia, get respectively blood, muscle, brain, intestinal carries out RT-PCR and detects, the result shows, lumbar injection is after 1 week of virus, the model group mice is at blood, all can detect virus in muscle and the intestinal, but do not detect the existence of virus in brain, preliminary assessment has been set up the experimental animal model of hand-foot-mouth disease.
Suppress viral effect in the body of embodiment six interferon a2b and interferon a2b+ interleukin-22
Get the experimental model mice of 40 EV71 viruses, be divided into 4 groups:
The negative processed group of B:pBS; C: interferon a2b processed group 1X10
5IU; C:1X10
4IU interleukin-22 processed group; D:1X10
5IU interferon a2b+1X10
4IU interleukin-22 processed group, administration every day 1 time, in continuous 2 weeks, other establishes the Normal group A Balb/C Mus of virus inoculation (not 10), gives the pBS solution of equivalent.
1, virus exists situation to detect in the tissue
After 2 weeks of administration, blood, muscle, brain, intestinal tissue are got respectively in the mice sudden death, and-70 ℃ are freezing for subsequent use, then carry out RT-PCR and detect, and detect each tissue of administration processed group mice and control group mice and intraorganic EV71 virus and have situation, the results are shown in Table 1:
Each model group mouse tissue of table 1, intraorganic viral detection case
From table, respectively find out, Normal group does not detect enterovirus, the negative group of virus is at mouse blood, muscle, brain, all detect enterovirus in the intestinal tissue, enterovirus is all positive in each administration processed group blood, interferon a2b group does not detect virus in brain and intestinal, the interleukin-22 group only in cerebral tissue enterovirus detect and to be negative, but interferon a2b associating interleukin-22 group is at muscle, brain, all do not detect virus in the intestinal, illustrate that interferon a2b associating interleukin-22 has good inhibition for the body inner virus of hand-foot-mouth disease animal pattern, because separately with interferon a2b or use separately interleukin-22.
2, CD4
+, CD8
+Measure
The preparation of mouse boosting cell suspension: aseptic taking-up mouse spleen places the plate that fills 10ml Hank ' s liquid and spleen is shredded, grind the rear centrifugal 6min of 1300rpm/min with 200 order net syringe nook closing members, in precipitation, add the 4ml lysate, the 5min cracking, it is centrifugal to 10ml to add Hank ' s liquid again, uses 500 μ lPBS (to contain 0.1%BSA and 0.1%NaN after then using Hank ' s liquid to wash 2 times again
3) dissolving, to inhale at last a small amount of suspension and do 20 times of dilutions, the Trypan Blue counting cells makes cell concentration reach 10
6About individual/ml.
Draw 100 μ l splenocytes and put into centrifuge tube, then the CD4-PE and the CD8-FITC antibody lucifuge that add 1 μ l are hatched 30min, wash rear centrifugal with PBS, adding the PBS500 μ l that contains 1% paraformaldehyde fixes, at last by BD FACSlibar flow cytometer (U.S. company BD) and supporting original-pack BD test test kit, detect CD4, CD8 positive expression rate, see Table 2.
Table 2IFNa2b+IL-2 is on the impact of T cell subsets counting in the enterovirus EV 71 mouse thymus tissue
Compare with Normal group,
#P＜0.05,
##P＜0.01; Compare with negative control group,
*P＜0.05,
*P＜0.01
It can be seen from the table, the CD4 average of each virus group all will be lower than Normal group, and wherein PBS negative control group difference has extremely significance (P＜0.01); Each virus treated group is compared with the PBS negative control group, and CD4 is remarkable rising trend.The result can find out from CD4/CD8 ratio, the CD4/CD8 value of each administration group all will be higher than the negative group of PBS, difference has significance, illustrate that each administration group can improve the Cellular Immunity of enterovirus EV 71 infecting mouse, wherein IFN-a2b and IL-2 unite use, its raising to the mouse cell immunity obviously is better than separately with IFN-a2b or uses separately IL-2, illustrates that IFN-a2b and IL-2 unite use, has the collaborative effect that strengthens cellular immunization.
3, the spleens cell number of secretion interferon gamma detects
The mice sudden death, the separating mouse splenocyte, with the splenocyte that contains in right amount the resuspended separation of 5%FCS-1640 complete culture solution, platform expects that every mice of blue dyeing counting separates lymphocyte living cells sum, adjusts cell density to 3 * 105/ml, 37 ℃, cultivate in the 5%CO2 incubator, then stimulate with the peptide section, strictly press the test kit operation instructions method operation of BD company, detect the spleens cell number of secretion interferon gamma, as a result table 3.
Table 3 is on the impact of the splenocyte number of secretion interferon gamma
Compare with the negative group of PBS,
*P＜0.01
It can be seen from the table, the Elispot value of the enterovirus model mice after administration is processed all is significantly higher than the negative group of PBS, illustrate that interferon a2b and interleukin-22 immunity have stronger immune effect for the hand-foot-mouth disease animal pattern, and the effect of associating IFN-a2b and IL-2 is better than using separately IFN-a2b or uses separately the IL-2 group.
Suppress viral effect in the body of embodiment seven interferon a2b and interferon a2b+II type interferon gamma
Get the experimental model mice of 50 CoxA16 viruses, be divided into 5 groups:
The negative processed group of B:pBS; C: interferon a2b processed group 1X10
5IU; D:1X10
4IU interferon gamma processed group; E:1X10
5IU interferon a2b+1X10
4IU interferon gamma processed group, other establishes the Normal group A Balb/C Mus of virus inoculation (not 10), gives the pBS solution of equivalent.Administration every day 1 time, continuous 2 weeks.
1, each model group mouse tissue, intraorganic viral detection case
After 2 weeks of administration, blood, muscle, brain, intestinal tissue are got respectively in the mice sudden death, and-70 ℃ are freezing for subsequent use, then carry out RT-PCR and detect, and detect the situation that exists of each tissue of administration processed group mice and control group mice and intraorganic CoxA16 virus, the results are shown in Table 4:
Each model group mouse tissue of table 4, intraorganic viral detection case
From table, find out that respectively IFN-a2b and IFN-γ unite use, in blood, muscle, brain and intestinal, all do not detect virus, illustrate that interferon a2b associating interferon gamma has good inhibition for the body inner virus of CoxA16 hand-foot-mouth disease animal pattern.
2, CD4
+, CD8
+Measure
The preparation of mouse boosting cell suspension: aseptic taking-up mouse spleen places the plate that fills 10ml Hank ' s liquid and spleen is shredded, grind the rear centrifugal 6min of 1300rpm/min with 200 order net syringe nook closing members, in precipitation, add the 4ml lysate, the 5min cracking, it is centrifugal to 10ml to add Hank ' s liquid again, uses 500 μ lPBS (to contain 0.1%BSA and 0.1%NaN after then using Hank ' s liquid to wash 2 times again
3) dissolving, to inhale at last a small amount of suspension and do 20 times of dilutions, the Trypan Blue counting cells makes cell concentration reach 10
6About individual/ml.
Draw 100 μ l splenocytes and put into centrifuge tube, then the CD4-PE and the CD8-FITC antibody lucifuge that add 1 μ l are hatched 30min, wash rear centrifugal with PBS, adding the PBS500 μ l that contains 1% paraformaldehyde fixes, at last by BD FACSlibar flow cytometer (U.S. company BD) and supporting original-pack BD test test kit, detect CD4, CD8 positive expression rate, see Table 2.
Table 5IFNa2b+IFN-γ is on the impact of T cell subsets counting in the COXA16 virus mouse thymus tissue
Compare with Normal group,
#P＜0.05,
##P＜0.01; Compare with negative control group,
*P＜0.05,
*P＜0.01
It can be seen from the table, the CD4 average of each virus group all will be lower than Normal group, and wherein PBS negative control group difference has extremely significance (P＜0.01); Each virus treated group is compared with the PBS negative control group, and CD4 is remarkable rising trend.The result can find out from CD4/CD8 ratio, the CD4/CD8 value of each administration group all will be higher than the negative group of PBS, difference has significance, illustrate that each administration group can improve the Cellular Immunity ability of COX A 16 virus infected mices, wherein IFN-a2b and IFN-γ unite use, its raising to the mouse cell immunity obviously is better than separately with IFN-a2b or uses separately IFN-γ, illustrates that IFN-a2b and IFN-γ unite use, has the collaborative effect that strengthens cellular immunization.
Suppress viral effect in the body of embodiment eight interferon a2b and interferon a2b+ interleukin 15
Get the experimental model mice of 40 EV71 viruses, be divided into 4 groups:
The negative processed group of B:pBS; C: interferon a2b processed group 1X10
5IU; C:1X10
4IU interleukin 15 processed group; D:1X10
5IU interferon a2b+1X10
4IU interleukin 15 processed group, administration every day 1 time, in continuous 2 weeks, other establishes the Normal group A Balb/C Mus of virus inoculation (not 10), gives the pBS solution of equivalent.
1, virus exists situation to detect in the tissue
After 2 weeks of administration, blood, muscle, brain, intestinal tissue are got respectively in the mice sudden death, and-70 ℃ are freezing for subsequent use, then carry out RT-PCR and detect, and detect each tissue of administration processed group mice and control group mice and intraorganic EV71 virus and have situation, the results are shown in Table 6:
Each model group mouse tissue of table 6, intraorganic viral detection case
From table, respectively find out, Normal group does not detect enterovirus, the negative group of virus is at mouse blood, muscle, brain, all detect enterovirus in the intestinal tissue, enterovirus is all positive in each administration processed group blood, interferon a2b group does not detect virus in brain and intestinal, the interleukin 15 group only in cerebral tissue enterovirus detect and to be negative, but interferon a2b associating interleukin 15 group is at muscle, brain, all do not detect virus in the intestinal, illustrate that interferon a2b associating interleukin 15 has good inhibition for the body inner virus of hand-foot-mouth disease animal pattern, because separately with interferon a2b or use separately interleukin 15.
2, CD4
+, CD8
+Measure
The preparation of mouse boosting cell suspension: aseptic taking-up mouse spleen places the plate that fills 10ml Hank ' s liquid and spleen is shredded, grind the rear centrifugal 6min of 1300rpm/min with 200 order net syringe nook closing members, in precipitation, add the 4ml lysate, the 5min cracking, it is centrifugal to 10ml to add Hank ' s liquid again, uses 500 μ lPBS (to contain 0.1%BSA and 0.1%NaN after then using Hank ' s liquid to wash 2 times again
3) dissolving, to inhale at last a small amount of suspension and do 20 times of dilutions, the Trypan Blue counting cells makes cell concentration reach 10
6About individual/ml.
Draw 100 μ l splenocytes and put into centrifuge tube, then the CD4-PE and the CD8-FITC antibody lucifuge that add 1 μ l are hatched 30min, wash rear centrifugal with PBS, adding the PBS500 μ l that contains 1% paraformaldehyde fixes, at last by BD FACSlibar flow cytometer (U.S. company BD) and supporting original-pack BD test test kit, detect CD4, CD8 positive expression rate, see Table 7.
Table 7IFNa2b+IL-15 is on the impact of T cell subsets counting in the enterovirus EV 71 mouse thymus tissue
Compare with Normal group,
#P＜0.05,
##P＜0.01; Compare with negative control group,
*P＜0.05,
*P＜0.01;
Compare with the IFN-a2b group,
﹠amp;P＜0.05.
It can be seen from the table, CD4 average and the CD4/CD8 of the negative group of PBS, IFN-a2b group, IL-15 group all will be lower than Normal group, and IFN-a2b and IL-15 drug combination group, its CD4 and CD4/CD8 ratio will be a little more than Normal groups, apparently higher than other infection group and viral infection group, wherein the PBS negative control group is compared with Normal group, and difference has extremely significance (P＜0.01); To each virus infected mice group, compare with the PBS negative control group, CD4 is remarkable rising trend.The result can find out from CD4/CD8 ratio, the CD4/CD8 value of each administration group all will be higher than the negative group of PBS, difference has significance, illustrate that each administration group can improve the Cellular Immunity of enterovirus EV 71 infecting mouse, wherein IFN-a2b and IL-15 unite use, its raising to the mouse cell immunity obviously is better than separately with IFN-a2b or uses separately IL-2, compare with independent use IFN-a2b group, the rising of its CD4/CD8 has significance (P＜0.05), illustrate that IFN-a2b and IL-15 unite use, have the collaborative effect that strengthens cellular immunization.
Claims (3)
1. be included in blocking-up virus mRNA translation in the cell, suppress the first synthetic agent of viral nucleic acid and by regulating immune response with the application of compositions in the medicine of the disease that causes for the preparation of the treatment enterovirus infection of the second agent of obtaining cellular immunization, wherein said the first agent is interferon-alpha, and described the second agent is interleukin 15 or interferon gamma.
2. the application of compositions according to claim 1 in the medicine of the disease that causes for the preparation of the treatment enterovirus infection, wherein said interferon-alpha is Interferon α1 b or α 2b.
3. the application of compositions according to claim 1 in the medicine of the disease that causes for the preparation of the treatment enterovirus infection is characterized in that described enterovirus is Coxsackie virus or intestinal EV71 virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010215943 CN102309758B (en) | 2010-07-02 | 2010-07-02 | Medicinal composition for treating diseases caused by enterovirus infections |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010215943 CN102309758B (en) | 2010-07-02 | 2010-07-02 | Medicinal composition for treating diseases caused by enterovirus infections |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102309758A CN102309758A (en) | 2012-01-11 |
| CN102309758B true CN102309758B (en) | 2013-02-20 |
Family
ID=45423566
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010215943 Active CN102309758B (en) | 2010-07-02 | 2010-07-02 | Medicinal composition for treating diseases caused by enterovirus infections |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102309758B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104721201B (en) * | 2015-03-26 | 2017-09-15 | 中山大学 | The application of tetracycline antibiotics or its pharmaceutical salts in anti-enteropathy cytotoxic drug is prepared |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1218408A (en) * | 1996-05-09 | 1999-06-02 | 太平洋制药控股公司 | Method of treatment |
| CN1269725A (en) * | 1997-08-04 | 2000-10-11 | 科学研究与运用咨询公司 | Product comprising at least double stranded RNA combined with at least an antiviral agent |
| CN1178694C (en) * | 1996-05-13 | 2004-12-08 | 霍夫曼-拉罗奇有限公司 | Use of IL-12 and IFN-'alpha' for treatment of infections diseases |
| CN1935256A (en) * | 2005-09-22 | 2007-03-28 | 北京远策药业有限责任公司 | Technology for preparing compound human inter feron spray agent capable of preventing polytypic influenza |
-
2010
- 2010-07-02 CN CN 201010215943 patent/CN102309758B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1218408A (en) * | 1996-05-09 | 1999-06-02 | 太平洋制药控股公司 | Method of treatment |
| CN1178694C (en) * | 1996-05-13 | 2004-12-08 | 霍夫曼-拉罗奇有限公司 | Use of IL-12 and IFN-'alpha' for treatment of infections diseases |
| CN1269725A (en) * | 1997-08-04 | 2000-10-11 | 科学研究与运用咨询公司 | Product comprising at least double stranded RNA combined with at least an antiviral agent |
| CN1935256A (en) * | 2005-09-22 | 2007-03-28 | 北京远策药业有限责任公司 | Technology for preparing compound human inter feron spray agent capable of preventing polytypic influenza |
Non-Patent Citations (2)
| Title |
|---|
| 候宁 等.手足口病的药物治疗.《药物流行病学杂志》.2008,第17卷(第1期),第10-12页. |
| 手足口病的药物治疗;候宁 等;《药物流行病学杂志》;20081231;第17卷(第1期);第10-12页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102309758A (en) | 2012-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2314830C2 (en) | Method for introducing therapeutic viruses | |
| CN108261426B (en) | Pharmaceutical composition and its application in the drug for the treatment of tumour and/or cancer | |
| CN111588721B (en) | New application of compound ZL0580 in preparation of drugs for preventing or treating African swine fever | |
| CN103550244B (en) | A kind of Chinese herbal medicine compound polysaccharide and application with collaboration enhancing body fluid and immunization of cell | |
| Kara et al. | Characterisation of putative immunomodulatory gene knockouts of lumpy skin disease virus in cattle towards an improved vaccine | |
| CN113082049B (en) | New application of potassium iodide or composition containing potassium iodide in preparation of drugs for treating African swine fever | |
| CN103834618A (en) | Coxsackie A16 type virus mutant strain capable of effectively infecting mice | |
| CN103110939A (en) | Vaccine for inducing specific immunity of tumor and application thereof | |
| CN105308178A (en) | Porcine reproductive and respiratory syndrome virus compositions and uses thereof | |
| CN102309758B (en) | Medicinal composition for treating diseases caused by enterovirus infections | |
| CN103272230A (en) | Triple vaccine special for Muscovy duck | |
| CN117106731A (en) | Coxsackie virus A6 type CVA6-KM-J33 and application thereof | |
| CN111939262B (en) | Pharmaceutical composition for treating tumor or cancer and application thereof | |
| CN111588725B (en) | New application of compound ARV-825 in preparation of drug for preventing or treating African swine fever | |
| CN104906080A (en) | Application of metformin in preparation of medicine for treating viral myocarditis caused by Coxsackie virus B3 | |
| CN111686107B (en) | New application of compound PLX51107 in preparation of drug for preventing or treating African swine fever | |
| CN102847147A (en) | Combined live vaccine for muscovy duck parvovirus disease and muscovy duck reovirus disease | |
| CN112915215A (en) | Method for testing efficacy of inactivated vaccine against A-type Sendai virus disease by using mice | |
| CN106540253A (en) | The application of cGAMP and its derivant in anti-tumor vaccine is prepared | |
| CN101336896A (en) | New use of sodium houttutfonate injection in aspect of enhancing poultry immunity | |
| CN1690212A (en) | Anti-tumor recombinant live-vector vaccine | |
| ES2869575T3 (en) | Pharmaceutical composition for the treatment and / or prevention of hepatitis C | |
| CN103874510A (en) | Use of the PACAP as a molecular adjuvant for vaccines | |
| CN103834617A (en) | Human enterovirus 71-type C4-subtype lethal strain SD095 and its application | |
| CN102727503A (en) | Application of Geraniin extracted from Geranium sibiricum Linne in preparation of anti-herpes virus medicaments |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Free format text: FORMER OWNER: BEIJING FURUI TIANCHENG BIOLOGICAL TECHNOLOGY CO., LTD. Effective date: 20150211 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 3 building, No. 6, Jingdong street, Beijing economic and Technological Development Zone, 100176 Patentee after: BEIJING KAWIN TECHNOLOGY SHARE-HOLDING Co.,Ltd. Patentee after: Beijing Furui Tiancheng Biotechnology Co.,Ltd. Address before: 3 building, No. 6, Jingdong street, Beijing economic and Technological Development Zone, 100176 Patentee before: BEIJING KAWIN TECHNOLOGY SHARE-HOLDING Co.,Ltd. Patentee before: BEIJING KAWIN BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20150211 Address after: 3 building, No. 6, Jingdong street, Beijing economic and Technological Development Zone, 100176 Patentee after: BEIJING KAWIN TECHNOLOGY SHARE-HOLDING Co.,Ltd. Address before: 3 building, No. 6, Jingdong street, Beijing economic and Technological Development Zone, 100176 Patentee before: BEIJING KAWIN TECHNOLOGY SHARE-HOLDING Co.,Ltd. Patentee before: Beijing Furui Tiancheng Biotechnology Co.,Ltd. |