CN102286104A

CN102286104A - Gene for encoding HPV (human papilloma virus) 6-type L2N120E7E6 fusion protein, expression vectors, method, bacteria strain and application

Info

Publication number: CN102286104A
Application number: CN201010212177XA
Authority: CN
Inventors: 田厚文; 赵莉; 任皎; 庞正; 冯靖; 张忠献; 阮力; 谭文杰
Original assignee: National Institute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention
Current assignee: National Institute for Viral Disease Control and Prevention Chinese Center for Disease Control and Prevention
Priority date: 2010-06-21
Filing date: 2010-06-21
Publication date: 2011-12-21
Anticipated expiration: 2030-06-21
Also published as: CN102286104B

Abstract

The invention provides a gene for encoding HPV (human papilloma virus) 6-type L2N120E7E6 fusion protein, expression vectors, a method, a bacteria strain and an application. The invention is characterized in that prokaryotic expression vectors are utilized to fuse HPV 6-type L2N-end 120 amino acids, E7 proteins and E6 proteins, and constructing the encoded gene according to the amino acid of the fusion protein. In the invention, the gene for encoding the HPV 6-type L2N120E7E6 fusion proteins is successfully designed and the expression vectors and the transformation bacteria strain of the high-expression HPV 6-type L2N120E7E6 fusion proteins are successfully constructed; and in the fusion proteins, the immunogenicity is strong, the immunoreaction of specific T cells can be induced, the tumor forming time of mice can be obviously delayed, and the growth of the tumors of 20% mice is completely restrained. The invention can be used for preventing and treating HPV 6-type infection and relevant diseases, such as genital wart.

Description

HPV6 type L2N120E7E6 antigen-4 fusion protein gene, expression vector, method, bacterial strain and purposes

Technical field

The invention belongs to medical biotechnology field.Particularly, the present invention relates to gene, expression vector, method and immunotherapy and the preventive use of a kind of expressing human papilloma virus (HPV) 6 type L2N120E7E6 fusion roteins.

Background technology

(Genital Wart GW) is one of present sexually transmitted disease (STD) that sickness rate is very high in the world to Genital warts.Though GW generally can not cause death, can make the patient produce psychological shade, and bring expensive medical expense.The method of treatment GW mainly contains at present: anti-proliferative drugs, psychrotherapy, damage Sex therapy, immunomodulator etc., inadaptation that these methods cause and wart recurrence are very common, fundamentally do not make disease cured, this just needs to seek the method for more efficiently immunoprophylaxis and treatment GW.

GW and human papillomavirus (Human Papillomavirus, HPV) substantial connection of Gan Raning is clear and definite already, and it is its main virulence factor that HPV infects.HPV is one group of little double-stranded DNA virus of having a liking for epithelium, has found more than 100 type at present, wherein 50 kinds relevant with genital infection, the passability contact transmission.HPV has strict species specificity and tissue specificity, and only the skin of infected person and mucous epithelium cause that the hyperplasia of epithelium sexually revises.Clinically according to its pathogenic high-risk-type and low risk of being divided into, the former can bring out the not hyperplasia of prostate even the cervical carcinogenesis of cervical epithelial tissue, the latter can cause sexual organ weeks pointed condyloma and the papilloma of throat, wherein cause Genital warts based on HPV-6, HPV-11 type.

Evidence suggests that host's immunne response, especially cellullar immunologic response level are to influence the principal element that the HPV relative disease forms.The neutralizing antibody that humoral immunoresponse(HI) produces can suppress the infection of HPV and further diffusion, and cellullar immunologic response can be removed the cell of HPV infection and relevant tumour cell.

The life cycle of HPV determines its minimum degree that virus antigen is exposed to immune characteristic, so compare with other viruses, HPV infects the human immunity that excites and replys very weak.Find that in the GW treatment in the patient that most of immunologic functions perfect, after nature or iatrogenic factors caused the focus immunogen to be exposed to immunity system, contiguous wart body can disappear.The immunity system that this prompting can utilize vaccine to come excitating organism is to reach the purpose of prevention and treatment GW.

HPV is preventative just to begin development with therapeutic vaccine as far back as the early 1990s.Preventative vaccine has been obtained impressive progress at present, and its immunization strategy mainly concentrates on the high titre neutralizing antibody that how to induce at the HPV associated epitope and comes preventing infection.In this respect, with the HPV capsid protein L 1, L2 is that (virus-like particles VLPs), all shows the effect that good preventing HPV infects in experimentation on animals and clinical trial for the virus-like particle of target antigen.The wherein comparatively successful HPV16/18/6/11 tetravalent vaccine Gardasil that Merck company is arranged and the HPV16/18 bivalent vaccine Cervarix. of GSK company, the two was come into the market by drugs approved by FDA respectively at 2006 and 2008.

Therapeutic vaccine, the particularly research of low risk therapeutic vaccine are less, make progress also slowly relatively, and therapeutic vaccine mainly produces cellular immunization at virus antigen by bringing out body, thereby removes by the cell of virus infection and relevant focus.Because HPV early protein E6, E7 continue to exist in virus life cycle and associated tumor tissue, have become the target antigen that most therapeutic vaccines are selected.Various is that the therapeutic vaccine of target antigen all shows the good cell immune response in experimentation on animals with E6, E7 albumen.

The HPV6 type L2E7 therapeutic vaccine of GSK development confirms that the Genital warts (GW) of infection HPV6 type is had certain result of treatment in the II phase in clinical.This HPV6 type L2E7 albumen is HPV6 type L2 full-length gene and E7 gene fusion, the L2 full-length proteins can only be induced more weak humoral immunization and cell immune response, the L2 albumen of total length (459 amino acid) merges the structure that forms with E7 albumen may influence E7 albumen (98 amino acid) in intracellular hydrolysis, thereby has influence on effectively presenting of the proteic t cell epitope of E7.

Therefore, also need to develop the vaccine of new treatment that strong immune effect is arranged and prevention Genital warts.

Summary of the invention

Go through the preparation and the use of the various technical schemes of the present invention below, but should be appreciated that, the invention provides many suitable inventive concepts, it can be embodied on the various concrete aspects.

For helping to understand the present invention, some terms have been defined below.The term of this paper definition has the implication of those of ordinary skill in the related art's common sense of the present invention.The general category of the specific examples that term can be used for illustrating, but their use does not limit the present invention, in the claim institute generalized except.

Unless otherwise noted, " HPV " as herein described is meant human papillomavirus (Human papillomavirus);

Unless otherwise noted, " bp " as herein described is meant base pair (base pair);

Unless otherwise noted, " ELISPOT " as herein described is meant enzyme linked immunological spot (Enzyme-linked immunospot);

Unless otherwise noted, " ICS " as herein described is meant intracellular cytokine dyeing (Intracellular Cytokine Staining);

Unless otherwise noted, " IPTG " as herein described is meant isopropylthio-β-D galactoside (Isopropylthio-β-D-galactoside);

Unless otherwise noted, " SDS-PAGE " as herein described is meant sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Sodium dodecyl sulfate polyacrylamide gel electrophoresis);

Unless otherwise noted, " HRP " as herein described is meant horseradish peroxidase (Horseradishperoxidase);

Unless otherwise noted, " IFN-γ " as herein described is meant gamma-interferon (Interferon gamma);

Unless otherwise noted, " PBS " as herein described is meant phosphate buffered saline buffer (Phosphatebuffered saline);

The clinical research data of delivering in the recent period shows that the proteic T cell immunogenicity of E6 is better than E7 albumen in the human body.For the HPV6 type, because its activity of conversion is lower, virogene can not integrated, and its L1, L2 also can continuous expressions in tumour (wart) the formation phase; And L2 compares with L1, and it is less that the former brings out the space structure dependency of neutralizing antibody, thereby it has bigger gene capacity as leader protein.In addition, to discovering of multiple other types HPV, the linear neutralizing epitope of L2 mainly concentrates on preceding 120 amino acid sections.So in the present invention, in order to obtain high expressing quantity and strong immunogenicity, selection is melted three gene fragments of L2N (1-360bp), E7, E6 of HPV6 type to be incorporated in the prokaryotic expression system and is expressed, fusion rotein behind the purifying can bring out strong humoral immune reaction and E7 and the immune response of E6 specific T-cells, and has observed the restraining effect of fusion rotein to tumor growth in C57BL/6 mouse animal experiment.Be expected at and be used for the human clinical trial future and also can show strong immunogenicity.

The present invention aim to provide a kind of energy simple, economical, effectively prepare the gene nucleotide series of human papillomavirus HPV6L2N120E7E6 fusion rotein, this gene can obtain to efficiently express in intestinal bacteria, and expressing protein can be used for the prevention and the treatment of infection of HPV6 type and relative disease (as Genital warts).

Particularly, one object of the present invention is, provides a kind of human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins.Another object of the present invention is, a kind of dna sequence dna of aforesaid human papillomavirus (HPV) the 6 type L2N120E7E6 fusion roteins that are used to encode is provided.A further object of the present invention is, a kind of colibacillus expression plasmid carrier is provided.Another purpose of the present invention is, a kind of coli strain that is used to produce aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins is provided.Also purpose of the present invention is, a kind of method of preparation aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins is provided.

At the foregoing invention purpose, the invention provides following technical scheme:

On the one hand, the invention provides 120 amino acid of a kind of human papillomavirus (HPV) 6 type L2N end, E7 albumen, the proteic fusion rotein of E6, its aminoacid sequence is the sequence shown in the SQE.ID.NO.1.Among the application, represent this fusion rotein with " HPV6L2N120E7E6 " or " L2N120E7E6 ".

On the other hand, the invention provides a kind of dna sequence dna that is used for aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins, the nucleotides sequence of described dna sequence dna is classified the sequence shown in the SQE.ID.NO.2 as.

On the one hand, the invention provides a kind of aforementioned Expression of Fusion Protein carrier that is used to express again, described expression vector comprises aforesaid dna sequence dna; Preferably, described expression vector is protokaryon or carrier for expression of eukaryon; More preferably, described expression vector is an e. coli plasmid vector.

Preferably, described e. coli plasmid vector is that L2N120E7E6 antigen-4 fusion protein gene dna sequence dna by aforementioned HPV6 type is inserted between the BamH I site of plasmid pQE30 and makes up.

Preferably, in the described colibacillus expression plasmid carrier, described intestinal bacteria are selected from the bacterial strain of suitable expression such as JM109 and M15 pQE30.

Another aspect the invention provides a kind of bacterial strain that is used to produce the L2N120E7E6 fusion rotein of aforesaid human papillomavirus (HPV) 6 types, and described bacterial strain contains aforesaid expression vector; Preferably, described bacterial strain is intestinal bacteria; More preferably, described intestinal bacteria are selected from the bacterial strain of suitable expression such as JM109 and M15 pQE30.

Also on the one hand, the invention provides a kind of method of preparation aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins, said method comprising the steps of:

1) with the BamH I site of aforesaid HPV6L2N120E7E6 antigen-4 fusion protein gene dna sequence dna insertion coli expression carrier pQE30, constructs recombinant expression vector pQE30-HPV6L2N120E7E6;

2), obtain to contain the bacterial strain of this recombinant expression vector, inoculation culture, IPTG abduction delivering with the constructed recombinant expression vector transformed into escherichia coli of step 1);

3) with step 2) after the centrifugal cracking of resulting intestinal bacteria, the results inclusion body hang with 8M urea, and is centrifugal, gets supernatant usefulness nickel ion affinity chromatograph column purification expressing protein.

Preferably, prepare in the method for aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins in the present invention, described intestinal bacteria are selected from the bacterial strain of suitable expression such as JM109 and M15 pQE30.

On the other hand, the invention provides that a kind of preparation is used for the treatment of and prevention of human papillomavirus 6 types infect and the method for relative disease (as Genital warts) medicine.

In addition, the present invention also provides dna sequence dna, aforesaid prokaryotic expression carrier or the aforesaid coli strain of aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins, aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins to be used for the application of the medicine of prevention and 6 types infection of treatment human papillomavirus and relative disease (as Genital warts) thereof in preparation; Preferably, described medicine is a vaccine.

The present invention also provides a kind of vaccine that is used to prevent and treat Genital warts, and described vaccine comprises dna sequence dna, aforesaid prokaryotic expression carrier or the aforesaid coli strain of aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins, aforesaid human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins.

Below according to of the present invention one preferred embodiment, in conjunction with Figure of description technical scheme of the present invention is further described in detail:

Genetic engineering technique is adopted in this experiment, at first the pointed condyloma tissue DNA with the HPV6 type gene masculine that extracts is a template, pcr amplification goes out HPV6 L2 (1-360bp), E7, E6 gene respectively, amplifies the HPV6L2N120E7E6 antigen-4 fusion protein gene that contains 1107bp with overlapping PCR method again.The purpose fragment is inserted prokaryotic expression carrier pQE30, after digestion with restriction enzyme is identified correctly, send Beijing to hold up section's bio tech ltd order-checking.Obtained and the pQE30-HPV6L2N120E7E6 recombinant expression plasmid that conforms to of design gene order.Antigen-4 fusion protein gene obtains to efficiently express at prokaryotic expression system, and expression level accounts for 40% of full bacterium, and the immune C57BL/6 mouse in the purified back of expressing protein is with the immunogenicity of animal immune experimental evaluation target protein.

The method that the present invention produces human papillomavirus 6 type L2N120E7E6 fusion roteins may further comprise the steps:

The BamH I site that the HPV6L2N120E7E6 antigen-4 fusion protein gene fragment of design is inserted coli expression carrier pQE30 obtains to contain the bacterial strain of pQE30-HPV6L2N120E7E6, inoculation culture, IPTG abduction delivering with this plasmid transformation escherichia coli;

Express thalline after centrifugal cracking, the results inclusion body hangs with 8M urea, and is centrifugal, gets supernatant nickel ion affinity chromatograph column purification expressing protein.

Preferably, produce in the method for HPV6L2N120E7E6 fusion rotein in the present invention, described intestinal bacteria are JM109 (JM109 are the escherichia coli expression bacterial strains of using always, the general strongly expressed that carries out goal gene with the strongly expressed carrier that cooperates).

The coli strain that contains recombinant plasmid pQE30-HPV6L2N120E7E6 of the present invention can be used for the development treatment and prevention of human papillomavirus 6 types infect and the medicine that infects relative disease (as Genital warts) therewith.

This shows that the inventor is from strengthening the immunogenicity of vaccine, and can carry out development and design HPV6L2N120E7E6 amalgamation protein vaccine in intestinal bacteria aspect the high expression level two.The main purpose of considering L2 is that to induce humoral immunization be neutralizing antibody, improve the proteic expression of E7 as leader protein simultaneously, therefore the brachymemma of L2 albumen is only kept 120 amino acid of N end that contain the neutralizing antibody epi-position, be added in that immunogenicity is better than the proteic E6 albumen of E7 in the human body so that behind E7 albumen, merge again, after being merged, three target antigens can efficiently express that (general molecular weight is too big, expression level can be low), the structure of the brachymemma meeting of L2 change fusion rotein also might improve the immunogenicity of fusion rotein in addition.Add E6 antigen rear fusion protein vaccine and included more t cell epitope, more can be satisfied with therapeutic vaccine and be subjected to the polymorphic sex needs of HLA, thereby reach the effect that strengthens immune effect of vaccine.The protein expression level that in our experiment, has confirmed total length L2 gene and E7, E6 gene fusion very low (do not have on the SDS-PAGE glue and obviously express band), and the protein expression level of the L2 of brachymemma and E7, E6 gene fusion obviously improves, through scanning analysis, the target protein expression amount accounts for about 40% of full bacterium.

In sum, the inventor selects HPV6 type early protein E7 and E6 is white and 120 amino acid polypeptide sequences of late protein L2N end merge the nucleotide sequence that forms corresponding HPV6L2N120E7E6 fusion rotein, utilize PCR to obtain three proteic genes, using overlapping PCR method merges 3 gene fragments, construct the HPV6L2N120E7E6 fusion gene, be inserted into prokaryotic expression carrier pQE30, fusion gene obtains than high expression level, expression level accounts for 40% of full bacterium, and carried out this proteic purifying, behind the immunity C57BL/6 mouse, through the ELISA antibody test, show and brought out strong humoral immune reaction (comprising high neutralizing antibody and cross neutralization antibody titers).The mouse that ELISPOT detects after the immunity can produce at the strong specific T-cells immune response in HPV6 type E7 peptide storehouse and E6 peptide storehouse.In animal model for tumour, can be observed certain tumor growth and suppress effect.The present invention can be used for research and development prevention and therapeutic Genital warts vaccine.

Compared with prior art, the present invention has following obvious advantage:

Contain among the present invention and can bring out 120 amino acid of HPV6 type L2N end that produce neutralizing antibody and cross neutralization antibody, and contain the E7 and the E6 albumen that can cause cell immune response simultaneously, use gene of the present invention can obtain high expression, expression level accounts for 40% of full bacterium, the purified immune C57BL/6 mouse of expressing protein, show that this albumen has good immunogenicity, can produce by force at HPV6 type E7 and E6 protein-specific t cell immune response, the tumor growth experimentation on animals shows that protein immunization has certain restraining effect to growth of tumor.This shows that the HPV6L2N120E7E6 fusion protein prokaryotic expression system that this fusion gene is set up can be used for the HPV6 type to be infected and the prevention of relative disease, especially Genital warts and the new drug development of therapeutic vaccine.

Description of drawings

Below, describe embodiment of the present invention in conjunction with the accompanying drawings in detail, wherein:

Fig. 1 is an employed pQE30 plasmid vector structure collection of illustrative plates in the embodiment of the invention 3;

Fig. 2 is the structure diagram according to the reorganization prokaryotic expression plasmid pQE30-HPV6L2N120E7E6 of the method structure of the embodiment of the invention 3;

Fig. 3 is the high SDS-PAGE of HPV6L2N120E7E6 fusion protein prokaryotic expression, and electrophoresis result is specially the result at the SDS-PAGE of expression in escherichia coli gel analysis who carries out according to the embodiment of the invention 4; Wherein, M is low molecular weight protein Marker, and 1 is the empty carrier contrast, and 2 for inducing the back gene expression product;

Fig. 4 is the Western blot qualification result of HPV6L2N120E7E6 fusion rotein, be specially according to the embodiment of the invention 5 carry out at the proteic Western-blot qualification result of expression in escherichia coli; Wherein, M is low molecular weight protein Marker, and 1 is the empty carrier contrast, and 2 for inducing the back gene expression product;

Fig. 5 is the HPV6L2N120E7E6 fusion rotein SDS-PAGE purity check behind the purifying, be specially according to what the embodiment of the invention 6 was carried out and express the result of the SDS-PAGE gel analysis behind the nickel ion affinity chromatograph purifying at prokaryotic system, wherein, M is low molecular weight protein Marker, and 1 is the HPV6L2N120E7E6 albumen behind the purifying;

The humoral immune reaction that Fig. 6 brings out in C57BL/6 mouse body for the HPV6L2N120E7E6 fusion rotein, it is purified to be specially the expressing protein that carries out according to the embodiment of the invention 7, the result that the total antibody titers behind the immune mouse detects;

The humoral immune reaction that Fig. 7 brings out in C57BL/6 mouse body for the HPV6L2N120E7E6 fusion rotein, it is purified to be specially the expressing protein that carries out according to the embodiment of the invention 7, the result that neutralizing antibody behind the immune mouse and cross neutralization antibody titers detect;

The cell immune response that Fig. 8 brings out in C57BL/6 mouse body for the HPV6L2N120E7E6 fusion rotein, it is purified to be specially the expressing protein that carries out according to the embodiment of the invention 7, enzyme linked immunological spot (ELISPOT) detected result behind the immune mouse;

Determining of the effector T cell CD4+/CD8+ hypotype that Fig. 9 brings out in C57BL/6 mouse body for the HPV6L2N120E7E6 fusion rotein, it is purified to be specially the expressing protein that carries out according to the embodiment of the invention 7, extracting spleen cell uses the Flow cytometry analysis to determine through the method for intracellular cytokine dyeing (ICS) behind the immune mouse;

The tumor growth inhibited reaction that Figure 10 brings out in C57BL/6 mouse body for the HPV6L2N120E7E6 fusion rotein, it is purified to be specially the expressing protein that carries out according to the embodiment of the invention 7, and the mouse of back second day implanted tumor cells of immunity is observed the tumor growth situation.

Embodiment

Followingly the present invention is described with reference to specific embodiment.It will be appreciated by those skilled in the art that these embodiment only are used to illustrate the present invention, the scope that it does not limit the present invention in any way.

The experimental technique of unreceipted concrete experiment condition in the following example, usually according to normal condition, or the condition of advising according to manufacturer.

Embodiment 1: the gene order of HPV6L2N120E7E6 fusion rotein is expressed in design

According to NCBI GenBank HPV6 gene order (sequence number NC 001355) corresponding amino acid sequence, less important 120 amino acid of capsid protein sequence L2N end and early protein E7 and the fusion of E6 albumen full length amino acid sequence with the HPV6 C-type virus C, design obtains the specifically fusion rotein shown in SEQ ID NO:1 (fusion rotein is followed successively by L2N120, E7, E6, totally 368 amino acid from N → C end).

In order to prevent the possibility of homologous sequence gene recombination, with in the E7 protein gene with the nucleotide sequence transformation of E6 protein gene lap, according to the gene degeneracy, under the prerequisite that the product albumen aminoacid sequence of its coding remains unchanged, E7 gene 5 ' end 25bp sequence (this E7 protein gene 5 ' end 25bp gene is held overlapping with E6 protein gene 3 ') ATGCATGGAAGACATGTTACCCTAA is replaced with ATGCACGGTCGTCACGTGACACTGA, to enlarge the difference of this part overlap, remove the terminator codon of E7 gene simultaneously, the contriver is with this sequence called after HPV6L2N120E7E6, shown in its sequence SEQ ID specific as follows NO:2.

Embodiment 2: pcr amplification prepares the L2N120E7E6 target gene fragment

Present embodiment is that pcr amplification prepares the L2N120E7E6 target gene fragment, and details are as follows for detailed process.

According to related nucleotide sequences design PCR and the required primer P1/P2 of overlapping PCR (L2N120), P3/P4 (E7) and the P5/P6 (E6) of designed fusion rotein correspondence, use for amplification L2N120E7E6 fusion gene.The primer of design is as shown in table 1 in detail.Primer is synthetic to be held up Bioisystech Co., Ltd of section by Beijing and finishes.

The screening method of the acuteness condyloma tissue DNA of HPV6 type gene masculine is as follows: the pointed condyloma tissue that will take from hospital's gynecologic patient extracts total DNA according to the operation of DNA extraction test kit (available from Beijing Nuo Keao genetic engineering technique company limited) specification sheets.According to HPV PCR detection kit (available from the limited Nuo Keao of Beijing genetic engineering technique company) specification sheets, be template with the pointed condyloma tissue DNA that extracts, pcr amplification HPV dna fragmentation.The HPV dna fragmentation is cloned into the pMD18-T carrier, plasmid DNA is cut evaluation with Sma I enzyme, positive colony send the order-checking of the precious biotech firm in Dalian, sequence and NCBI GenBank HPV6 gene order (sequence number NC_001355) comparison, the person that has the identical sequence, corresponding pointed condyloma tissue DNA extract is the positive DNA of HPV6.With this acuteness condyloma tissue DNA that contains HPV6 type gene is template, respectively with PCR primer P1/P2 (L2N120), P3/P4 (E7) and P5/P6 (E6), amplify and contain HPV6L2N120 (360bp), HPV6E7 (294bp) and three target gene fragment of HPV6E6 (453bp), amplification condition is as follows: 94 ℃ of pre-sex change in 5 minutes, loop body be 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 30 circulations, then 72 ℃ 10 minutes.

L2N120, E7 and E6 gene PCR amplified fragments are carried out the gel recovery; After mixing with E7 after reclaiming and E6 gene PCR product is template, forward clone's primer (P3) and the E6 reverse cloning primer (P6) of E7 carry out overlapping pcr amplification, amplification condition is as follows: 94 ℃ of pre-sex change in 5 minutes, loop body be 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 30 circulations, then 72 ℃ 10 minutes.

Amplify the fragment that contains the E7E6 goal gene, E7E6 gene overlap pcr amplified fragment is carried out gel reclaim; After mixing with L2N120 gene PCR product after reclaiming and E7E6 gene overlap PCR product is template again, forward clone's primer (P1) and the E6 reverse cloning primer (P6) of L2N120 carry out the overlapping pcr amplification of secondary, amplification condition is as follows: 94 ℃ of pre-sex change in 5 minutes, loop body be 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 1 minute, 30 circulations, then 72 ℃ 10 minutes, amplify the L2N120E7E6 target gene fragment that contains 1107bp.

The primer sequence of the warm L2N120E7E6 goal gene of table 1 pcr amplification

Numbering	Title	Sequence
			P1	L2N12 0F	5’-GAAGATCTGCACATAGTAGGGCCCGACGACGC-3’ (SEQ?ID?NO：3)
P2	L2N12 0R	5’-GTCACGTGACGACCGTGCATTTCAGGCGCCCCTG CGT-3’(SEQ ID NO：4)
			P3	E7F	5’-ATGCACGGTCGTCACGTGACACTGAAGGATATTG

[0074]?

?	?	TAT3’(SEQ?ID?NO：5)
			P4	E7R	5’-GAGGCATTTGCACTTTCCATGGTCTTCGGTGCGCA GATGG-3’(SEQ ID NO：6)
P5	E6F	5’-CCATCTGCGCACCGAAGACCATGGAAAGTGCAA ATGCCTC-3’(SEQ ID NO：7)
			P6	E6R	5’-GAAGATCTTCTTAGGGTAACATGTCTTCCATG-3’ (SEQ?ID?NO：8)

Embodiment 3: the structure of prokaryotic expression recombinant plasmid pQE30-HPV6L2N120E7E6

Present embodiment is for making up prokaryotic expression recombinant plasmid pQE30-HPV6L2N120E7E6, and specifically details are as follows.

The HPV6L2N120E7E6 target gene fragment restriction digest that contains 1107bp that overlapping pcr amplification among the embodiment 2 is gone out, it is as follows that described enzyme is cut the operation of digestion: with Bgl II enzyme (Biolabs company product, available from Beijing North instrument great waves commerce and trade company limited) in 37 ℃ of water-bath effects 3 hours, reclaim test kit (available from sky, Beijing root biochemical technology company limited) with sepharose then and reclaim fragment.

To insert colibacillus expression plasmid carrier pQE30 with the HPV6L2N120E7E6 goal gene of restriction digest then (is Qiagen company product, available from Huamei Bio-Engrg Co.,'s Beijing Company, its concrete structure collection of illustrative plates is seen Fig. 1) BamH I site, through BamH I+Hind III double digestion evaluation and screening the prokaryotic expression recombinant plasmid pQE30-HPV6L2N120E7E6 of correct insertion is arranged, and confirm that through order-checking nucleotide sequence is in full accord with design.The pQE30-HPV6L2N120E7E6 structure diagram as shown in Figure 2.

Embodiment 4: the escherichia coli expression of prokaryotic expression recombinant plasmid

Present embodiment uses that embodiment 3 obtains contains recombinant plasmid pQE30-HPV6L2N120E7E6 transformed into escherichia coli JM109 (available from Invitrogen company).Adopt recombinant plasmid transformed CaCl ₂Legal system is equipped with the JM109 competent escherichia coli cell, the concrete operations document that sees reference: Sa nurse Brooker J, not Ritchie EF and Manny A Disi T, molecular cloning experiment guide .1992. second edition (Beijing): Science Press: the 56th page.

With resulting transformed into escherichia coli JM109, be coated with plate after, 37 ℃ of incubated overnight.Choose single spot at LB substratum (the prescription document that sees reference: Sa nurse Brooker J, Ritchie EF not, with Manny A Disi T, molecular cloning experiment guide .1992. second edition (Beijing): Science Press: the 908th page) 37 ℃ of shaking culture in, when OD600=0.8, adding final concentration is the IPTG (Promega company product is available from vast Tyke, Beijing biological gene technology limited liability company) of 0.8mM, 20 ℃ of abduction deliverings 12 hours are got an amount of thalline and are carried out the SDS-PAGE gel electrophoresis analysis.

Running gel uses the Gel-Pro software analysis after scanning.The result has a newly-increased protein band at the about 41KD of molecular weight place as shown in Figure 3, and the molecular weight of albumen size is consistent with the design theory guess value, and this protein band accounts for 40% of whole bacterial protein total amount.

Embodiment 5: the Western-blot of HPV6L2N120E7E6 gene prokaryotic detects

Present embodiment adopts Western-blot to detect the expression of HPV6L2N120E7E6 gene in prokaryotic expression system, and specifically details are as follows.

Get the abduction delivering bacterium liquid 200 μ l that embodiment 4 obtains, centrifugal results thalline, be resuspended in 100 μ l the SDS-PAGE sample loading buffer (specifically the prescription and compound method see Sa nurse Brooker J, Ritchie EF not, with Manny A Disi T, molecular cloning experiment guide .1992. second edition (Beijing): Science Press: the 935th page) mixing boils heating 5 minutes.Get 5-10 μ l after centrifugal and be splined on 10% SDS-PAGE glue, carry out electrophoresis, electricity changes nitrocellulose filter then.

Use anti-HPV6E6 self-control mouse how anti-as first antibody, albumin A/the G of horseradish peroxidase-labeled is as second antibody (available from the together positive biotech development company of Beijing North), carry out the Western-Blot specificity that target protein expresses and identify (the concrete operations document that sees reference: Sa nurse Brooker J, Ritchie EF not, with Manny A Disi T, molecular cloning experiment guide .1992. second edition (Beijing): Science Press: the 888-898 page or leaf).Wherein the preparation method of employed first antibody is as follows: change in the JM109 bacterial strain with pGEX2T-HPV6E6 prokaryotic expression plasmid (the total length expressed gene of HPV6E6 albumen is inserted between the BamH I and EcoR I site of pGEX-2T prokaryotic expression plasmid vector), the expression bacterial classification that contains the pGEX2T-HPV6E6 plasmid that obtains to be inoculated in 300ml 2 * YT substratum at 1: 100,37 ℃ of shaking culture are to OD600=0.8, add IPTG to final concentration be 0.8mM, 20 ℃ of abduction deliverings 12 hours are collected bacterial sediment; With medium Glutathione Sepharose (Amersham Biosciences (peace agate West Asia) company's product, close poly-economy and trade company limited available from Central Plains, Beijing) carry out the purifying (concrete purification process is with reference to the used medium specification sheets) of expressing protein, the GST-HPV6E6 fusion rotein of purifying adds freund's adjuvant (Sigma company product, glad available from Beijing) through Bioisystech Co., Ltd of section, subcutaneous multiple spot and abdominal injection immune balb/c mice, pluck the eyeball blood sampling after immune three times, centrifuging and taking serum promptly gets HPV6 type E6 protein antiserum.

Western-Blot result shows at the about 41KD of molecular weight place one specific reaction band is arranged, and is the HPV6L2N120E7E6 fusion rotein of destination gene expression, and the result is referring to Fig. 4.

Embodiment 6: expression and the proteic purifying of HPV6L2N120E7E6 fusion gene in intestinal bacteria

Present embodiment is expression and the proteic purifying of HPV6L2N120E7E6 fusion gene in intestinal bacteria, specifically referring to following steps:

A) bacterial classification that embodiment 4 is obtained to be inoculated in 300ml 2 * YT substratum (its prescription document that sees reference: Sa nurse Brooker J at 1: 100, not Ritchie EF and Manny A Disi T, molecular cloning experiment guide .1992. second edition (Beijing): Science Press: the 909th page), 35 ℃ of shaking culture are during to OD600=0.8, adding IPTG (is Promega company product, available from vast Tyke, Beijing biological gene technology limited liability company) to final concentration be 0.8mM, 20 ℃ of abduction deliverings 12 hours, centrifugal (5000rpm, 15 minutes, 4 ℃) the collection bacterial sediment;

B) the expression bacterial sediment that abovementioned steps is obtained in a) be resuspended in the 30ml lysis buffer (50mMTris, PH9.0), supersound process in ice bath (400W, 25 times) 8 seconds, 16 seconds at interval, centrifugal (12,000rpm, 20 minutes, 4 ℃) collecting precipitation;

C) with abovementioned steps b) in the precipitation that obtains be resuspended in the damping fluid that 30ml contains 4M urea (50mMTris, 4M urea, PH9.0), supersound process in ice bath (400 watts, 20 times) 8 seconds, 16 seconds at interval.Centrifugal (12000rmp, 20 minutes, 4 ℃) collecting precipitation;

D) with abovementioned steps c) in the precipitation that obtains be resuspended in the damping fluid that 30ml contains 8M urea (50mMTris, 8M urea, PH9.0), supersound process in ice bath (400 watts, 10 times) 8 seconds, 16 seconds at interval.Centrifugal (12000rmp, 20 minutes, 4 ℃), it is standby to collect supernatant liquor;

E) with abovementioned steps d) in the supernatant liquor that obtains through nickel ion affinity chromatograph post (AmershamBiosciences (peace agate West Asia) company's product, close poly-economy and trade company limited available from Central Plains, Beijing) the purifying target protein, method sees Ao Sibai FM for details, James Kingston RE, Sai Deman JG etc., fine works molecular biology experiment guide .2005. the 4th edition (Beijing): Science Press: 442-447 page or leaf;

F) with abovementioned steps e) in albumen behind the chromatography purification that obtains through dialysis tubing (available from Huamei Bio-Engrg Co.,'s Beijing Company, specification DM-49, the aperture is 12-14KD) carry out urea gradient concentration dialysis, dialyse at last to Tris damping fluid (50mM Tris, PH9.0) in, ultrafiltration is centrifugal to be concentrated, and purity reaches 90%, be stored in-20 ℃ for the immune animal use, the SDS-PAGE gel electrophoresis analysis of gained purifying protein the results are shown in Figure 5.

Embodiment 7: the experiment of HPV6L2N120E7E6 fusion rotein animal immune

Present embodiment carries out the animal immune experiment for using the HPV6L2N120E7E6 fusion rotein, comprises detecting serological specificity antibody and cell immune response behind the immune mouse, and to the restraining effect of tumor growth.

(1) serological specificity antibody and cell immune response detect behind the HPV6L2N120E7E6 fusion protein immunization mouse

The HPV6L2N120E7E6 fusion rotein 50 μ g that use is prepared by previous embodiment 6, (the CpG1826 sequence is: 5TCCATGACGTTCCTGACGTT3 to add the 10ugCpG1826 adjuvant, giving birth to worker biotech company by Shanghai synthesizes, full chain thio-modification, the polyacrylamide gel electrophoresis purifying, be dissolved in physiological saline), intramuscular injection immunity C57BL/6 mouse (C57BL/6 mouse, age in 6-8 week, female, breed the center available from Chinese Academy of Medical Sciences laboratory animal, raise at SPF2 level Animal House), two weeks and all around the back strengthen with same immunizing dose, immunity finishes that the back was carried out the serological specificity antibody test in 10-14 days and cellular immunization detects.

1) specific antibody detects:

The concrete preparation method of HPV6 type L2, E7, E6 envelope antigen who detects usefulness is as follows: HPV6L2 protein expression gene is inserted between the BamH I and Sma I site of pQE30 prokaryotic expression plasmid vector (available from Qiagen company), HPV6E7, E6 protein expression gene are inserted respectively between the BamH I and EcoR I site of pGEX2T prokaryotic expression plasmid vector (available from Pharmacia company), 3 recombinant plasmids change over to respectively in the JM109 bacterial strain, the expression bacterial classification that contains pQE30-HPV6L2, pGEX2T-HPV6E7, pGEX2T-HPV6E6 plasmid of acquisition.To be inoculated in 300ml2 * YT substratum at 1: 100,37 ℃ of shaking culture are to OD600=0.8, add IPTG to final concentration be 0.8mM, the 20 ℃ of abduction deliverings of bacterial strain 12 hours that contain pGEX2T-HPV6E7, pGEX2T-HPV6E6, collect bacterial sediment, carry out proteic purifying (concrete purification process is with reference to the used medium specification sheets) with medium Glutathione Sepharose (Amersham Biosciences (peace agate West Asia) company's product closes poly-economy and trade company limited available from Central Plains, Beijing); The 37 ℃ of abduction deliverings of bacterial strain 3 hours that contain pQE30-HPV6L2, collect bacterial sediment, the method of protein purification in the reference example 6, use nickel ion affinity chromatograph post (Amersham Biosciences (peace agate West Asia) company's product, close poly-economy and trade company limited available from Central Plains, Beijing) purifying protein, concrete method sees reference for details: Ao Sibai FM, James Kingston RE, Sai Deman JG etc., fine works molecular biology experiment guide .2005. the 4th edition (Beijing): Science Press: 442-447 page or leaf.

Get serum, carry out L2 antibody, E7 antibody and E6 detection of antibodies with euzymelinked immunosorbent assay (ELISA) (ELISA).HPV6 type L2, the E7 of preparation, the package amount of E6 envelope antigen are respectively 200ng/ hole, 150ng/ hole, 200ng/ hole, the initial extent of dilution of serum is that (ELISA concrete operations steps was referring to Ao Sibai FM in 1: 800, James Kingston RE, Sai Deman JG etc., fine works molecular biology experiment guide .2005. the 4th edition (Beijing): Science Press: the 476-477 page or leaf), with the negative contrast of reagent set PBS, total antibody titers result of detection as shown in Figure 6.As can be seen from Figure 6, the HPV6L2N120E7E6 fusion rotein can be induced in C57BL/6 mouse body and be produced high titer antibody, and is specific as follows: L2 antibody average titer 1: 688862, E7 antibody average titer 1: 289630 and E6 antibody average titer 1: 121774.

Get serum, with carrying out HPV L2 neutralizing antibody and cross neutralization detection of antibodies with experiment in the pseudovirus.Concrete grammar is: inoculate an amount of 293FT cell in 96 porocyte culture plates, 37 ℃, 5%CO ₂Cultivate in the incubator, second day will be with the cell culture medium (DMEM that contains 10% foetal calf serum, available from Hyclone) (the HPV pseudovirus is made by oneself by the laboratory with the HPV pseudovirus of 200-300 TCID50 after 0.2 μ m filter filtration sterilization for the serum of dilution, concrete grammar is as follows: will contain HPV L1, behind the eukaryon expression plasmid transient transfection 293FT cell of L2 capsid protein gene, express HPV L1, the L2 capsid protein, capsid protein is packed the formation virus-like particle automatically, and the plasmid that will have the green fluorescent protein reporter gene wraps up into inside, results purifying pseudovirus behind the lysing cell.Detailed method reference: Christopher B.Buck, Diana V.Pastrana, Douglas R.Lowy and John T.Schiller.Production of Papillomaviral Vectors (Pseudoviruses) .2009.) mixes, putting 4 ℃ placed after 1 hour, add in the cell 37 ℃, 5%CO ₂Cultivate in the incubator, rearmounted inverted fluorescence microscope was observed down in 2 days, calculated green fluorescence and counted, and statistic data is analyzed NAT, and experimental result as shown in Figure 7.As can be seen from Figure 7, the HPV6L2N120E7E6 fusion rotein induces the NAT at HPV6,11,16,18,58,45 type pseudoviruss of generation to be respectively in C57BL/6 mouse body 1: 3200,1: 1600,1: 800,1: 800,1: 200,1: 800.

2) cell immune response detects:

Extracting spleen cell, (peptide storehouse design is: with reference to protein sequence to carry out E7 peptide storehouse and E6 peptide storehouse with enzyme linked immunological spot (ELISPOT) method, direction with N ' → C ', per 15 amino acid are a peptide section, adjacent peptide section have 11 amino acid whose overlapping, design E7 and E6 peptide storehouse, it is synthetic to deliver BeiJing ZhongKe Asia Optical) stimulate the number of the effector T cell of the specific secretion IFN-γ that produces to detect that (concrete grammar is referring to Miyahira Y, Murata K, Rodriguez D, et al., Quantification of antigen specificCD8 ⁺T cell using an ELISPOT assay.J Immunol Methods, 1995,181 (1): 45-54.Murali-Krishna K, Altman JD, Suresh M, et al.Counting antigen-speific CD8 Tcells:a reevaluation of bystander activation during viral infection.Immunity, 1998,8 (2): 1771-87.), concrete operations are referring to the product E LISPOT of BD company test kit specification sheets).Carry out the E71-15 peptide with dyeing (ICS) method in the born of the same parents simultaneously and the E637-51 peptide stimulates the CD4 of the effector T cell of the specific secretion IFN-γ that produces ⁺/ CD8 ⁺Hypotype determine that (concrete grammar is referring to Arora SK.Analysis of intracellular cytokines using flowcytometry.Methods Cell Sci, 2002,24 (1-3): 37-40.Laurel Nomura, Vernon C.Maino, Holden T.Maecker.Standardization and Optimization of Multiparameter Intracellular CytokineStaining Cytometry 2008,73A:984-991.), concrete operations are referring to the product I CS of BD company test kit specification sheets.

Be respectively with the spot number that produces the effector T cell of secretion of gamma-IFN behind the C57BL/6 mouse boosting cell of HPV6E7 peptide storehouse and HPV6E6 peptide storehouse immune stimulatory HPV6L2N120E7E6 fusion rotein: 446 and 1094, the PBS control group does not then detect corresponding spot number.Both have significant difference on the statistics, illustrate that the HPV6L2N120E7E6 fusion rotein can bring out the C57BL/6 mouse and produce by force at HPV6E7 and the proteic specific T-cells immunne response of E6, and experimental result as shown in Figure 8.With the peptide pond respectively the C57BL/6 mouse boosting cell of immune stimulatory HPV6L2N120E7E6 fusion rotein screen HPV6E71-15 peptide (aminoacid sequence: N '-MHGRHVTLKDIVLDL-3 ') and HPV6E637-51 peptide (aminoacid sequence: N '-ALTTAEIYSYAYKHL-3 ') and stimulate afterreaction the strongest, cell spot number is respectively: 302 and 826.

Mice immunized two all backs extracting spleen cells stimulate after intracellular cytokine dyes (ICS) with HPV6E71-15 peptide and HPV6E637-51 peptide respectively, and use Flow cytometry analytical results shows that HPV6E71-15 peptide (aminoacid sequence: N '-MHGRHVTLKDIVLDL-3 ') and HPV6E637-51 peptide (aminoacid sequence: N '-ALTTAEIYSYAYKHL-3 ') are CD8 ⁺T cell epitope.The result as shown in Figure 9.

(2) HPV6L2N120E7E6 is to the restraining effect of C57 mouse tumor growth:

Use 1.2x10 earlier ³Individual B16/HPV6E7 tumour cell (B16/HPV6E7 tumor cell line pcDNA3.1-HPV6E7 plasmid transfection C57BL/6 mouse melanin tumor cell B16, but stably express and submission E7 albumen after G418 goes down to posterity screening, present by professor Cheng Hao of Shaoyifu Hospital Attached to Zhejiang Univ. Medical College, document sees reference: the foundation of the mouse tumor cell strain of expressing human papilloma virus 6b and 11 type E6/E7 genes, Chinese journal of dermatology 2004.Vol37.No2:91～93) inguinal region subcutaneous injection (injected dose is 100 μ l) C57BL/6 mouse (C57BL/6 mouse, age in 6-8 week, female, breed the center available from Chinese Academy of Medical Sciences laboratory animal, raise at SPF2 level Animal House), the HPV6L2N120E7E6 fusion rotein of intramuscular injection in second day 50 μ g (the HPV6L2N120E7E6 fusion rotein for preparing by previous embodiment 6)+10ugCpG (1826) adjuvant, strengthen with same immunizing dose after 10 days, observe tumor growth situation (2 times weekly).

Experimental result shows that behind protein immunization growth of tumor is had certain restraining effect as shown in figure 10, and mouse becomes the knurl time obviously to postpone, and has 20% mouse can suppress growth of tumor fully.

By above result as can be known, the HPV6L2N120E7E6 fusion rotein has strong immunogenicity, can bring out stronger immune response in C57BL/6 mouse body.This albumen of ELISA experiment demonstration can be induced the antibody at HPV6 type L2, E7, E6 of high titre, and show with experiment in the HPV pseudovirus, it up to 1: 3200, simultaneously, also has to a certain degree cross-neutralization to the HPV pseudovirus of other types at the NAT of HPV6 type; The ELISPOT experiment confirm, HPV6 type E6 albumen can bring out stronger cell immune response than E7 albumen, in conjunction with ICS experiment and mouse tumor growth-inhibiting experimental result, illustrate that this albumen can bring out strong specific C D8+T cell response, specific killing or removing related neoplasms cell, owing to added the E6 albumen that immunogenicity is strong, make vaccine have better antitumous effect in addition.

Described before combining, this fusion rotein can bring out strong body fluid and cell immune response, can produce the neutralizing antibody and the special-shaped cross neutralization antibody of high titre, can bring out the C57BL/6 mouse and produce at HPV6E7 and the proteic specific T-cells immunne response of E6, so can be as the vaccine of prevention and treatment HPV6 type infection and relative disease (as Genital warts).

Sequence table

＜110〉China Sickness Prevention Control Center Virus Disease Prevention Control Institute

＜120〉HPV6 type L2N120E7E6 antigen-4 fusion protein gene, expression vector, method, bacterial strain and purposes

<130>DIC10110037

<160>8

<170>PatentIn?version?3.3

<210>1

<211>368

<212>PRT

＜213〉HPV6L2N120E7E6 fusion rotein

<400>1

Met?Ala?His?Ser?Arg?Ala?Arg?Arg?Arg?Lys?Arg?Ala?Ser?Ala?Thr?Gln

1 5 10 15

Leu?Tyr?Gln?Thr?Cys?Lys?Leu?Thr?Gly?Thr?Cys?Pro?Pro?Asp?Val?Ile

20 25 30

Pro?Lys?Val?Glu?His?Asn?Thr?Ile?Ala?Asp?Gln?Ile?Leu?Lys?Trp?Gly

35 40 45

Ser?Leu?Gly?Val?Phe?Phe?Gly?Gly?Leu?Gly?Ile?Gly?Thr?Gly?Ser?Gly

50 55 60

Thr?Gly?Gly?Arg?Thr?Gly?Tyr?Val?Pro?Leu?Gln?Thr?Ser?Ala?Lys?Pro

65 70 75 80

Ser?Ile?Thr?Ser?Gly?Pro?Met?Ala?Arg?Pro?Pro?Val?Val?Val?Glu?Pro

85 90 95

Val?Ala?Pro?Ser?Asp?Pro?Ser?Ile?Val?Ser?Leu?Ile?Glu?Glu?Ser?Ala

100 105 110

Ile?Ile?Asn?Ala?Gly?Ala?Pro?Glu?Met?His?Gly?Arg?His?Val?Thr?Leu

115 120 125

Lys?Asp?Ile?Val?Leu?Asp?Leu?Gln?Pro?Pro?Asp?Pro?Val?Gly?Leu?His

130 135 140

Cys?Tyr?Glu?Gln?Leu?Val?Asp?Ser?Ser?Glu?Asp?Glu?Val?Asp?Glu?Val

145 150 155 160

Asp?Gly?Gln?Asp?Ser?Gln?Pro?Leu?Lys?Gln?His?Phe?Gln?Ile?Val?Thr

165 170 175

Cys?Cys?Cys?Gly?Cys?Asp?Ser?Asn?Val?Arg?Leu?Val?Val?Gln?Cys?Thr

180 185 190

Glu?Thr?Asp?Ile?Arg?Glu?Val?Gln?Gln?Leu?Leu?Leu?Gly?Thr?Leu?Asn

195 200 205

Ile?Val?Cys?Pro?Ile?Cys?Ala?Pro?Lys?Thr?Met?Glu?Ser?Ala?Asn?Ala

210 215 220

Ser?Thr?Ser?Ala?Thr?Thr?Ile?Asp?Gln?Leu?Cys?Lys?Thr?Phe?Asn?Leu

225 230 235 240

Ser?Met?His?Thr?Leu?Gln?Ile?Asn?Cys?Val?Phe?Cys?Lys?Asn?Ala?Leu

245 250 255

Thr?Thr?Ala?Glu?Ile?Tyr?Ser?Tyr?Ala?Tyr?Lys?His?Leu?Lys?Val?Leu

260 265 270

Phe?Arg?Gly?Gly?Tyr?Pro?Tyr?Ala?Ala?Cys?Ala?Cys?Cys?Leu?Glu?Phe

275 280 285

His?Gly?Lys?Ile?Asn?Gln?Tyr?Arg?His?Phe?Asp?Tyr?Ala?Gly?Tyr?Ala

290 295 300

Thr?Thr?Val?Glu?Glu?Glu?Thr?Lys?Gln?Asp?Ile?Leu?Asp?Val?Leu?Ile

305 310 315 320

Arg?Cys?Tyr?Leu?Cys?His?Lys?Pro?Leu?Cys?Glu?Val?Glu?Lys?Val?Lys

325 330 335

His?Ile?Leu?Thr?Lys?Ala?Arg?Phe?Ile?Lys?Leu?Asn?Cys?Thr?Trp?Lys

340 345 350

Gly?Arg?Cys?Leu?His?Cys?Trp?Thr?Thr?Cys?Met?Glu?Asp?Met?Leu?Pro

355 360 365

<210>2

<211>1107

<212>DNA

＜213〉artificial sequence

<400>2

atggcacata?gtagggcccg?acgacgcaag?cgtgcgtcag?ctacacagct?atatcaaaca 60

tgtaaactca?ctggaacatg?ccccccagat?gtaattccta?aggtggagca?caacaccatt 120

gcagatcaaa?tattaaaatg?gggaagtttg?ggggtgtttt?ttggagggtt?gggtataggc 180

acgggttccg?gcactggggg?tcgtactggc?tatgttccct?tacaaacttc?tgcaaaacct 240

tctattacta?gtgggcctat?ggctcgtcct?cctgtggtgg?tggagcctgt?ggccccttcg 300

gatccatcta?ttgtgtcttt?aattgaagaa?tcggcaatca?ttaacgcagg?ggcgcctgaa 360

atgcacggtc?gtcacgtgac?actgaaggat?attgtattag?acctgcaacc?tccagaccct 420

gtagggttac?attgctatga?gcaattagta?gacagctcag?aagatgaggt?ggacgaagtg 480

gacggacaag?attcacaacc?tttaaaacaa?catttccaaa?tagtgacctg?ttgctgtgga 540

tgtgacagca?acgttcgact?ggttgtgcag?tgtacagaaa?cagacatcag?agaagtgcaa 600

cagcttctgt?tgggaacact?aaacatagtg?tgtcccatct?gcgcaccgaa?gaccatggaa 660

agtgcaaatg?cctccacgtc?tgcaacgacc?atagaccagt?tgtgcaagac?gtttaatcta 720

tctatgcata?cgttgcaaat?taattgtgtg?ttttgcaaga?atgcactgac?cacagcagag 780

atttattcat?atgcatataa?acacctaaag?gtcctgtttc?gaggcggcta?tccatatgca 840

gcctgcgcgt?gctgcctaga?atttcatgga?aaaataaacc?aatatagaca?ctttgattat 900

gctggatatg?caacaacagt?tgaagaagaa?actaaacaag?acatcttaga?cgtgctaatt 960

cggtgctacc?tgtgtcacaa?accgctgtgt?gaagtagaaa?aggtaaaaca?tatactaacc 1020

aaggcgcggt?tcataaagct?aaattgtacg?tggaagggtc?gctgcctaca?ctgctggaca 1080

acatgcatgg?aagacatgtt?accctaa 1107

<210>3

<211>32

<212>DNA

＜213〉artificial sequence

<400>3

gaagatctgc?acatagtagg?gcccgacgac?gc 32

<210>4

<211>37

<212>DNA

＜213〉artificial sequence

<400>4

gtcacgtgac?gaccgtgcat?ttcaggcgcc?cctgcgt 37

<210>5

<211>37

<212>DNA

＜213〉artificial sequence

<400>5

atgcacggtc?gtcacgtgac?actgaaggat?attgtat 37

<210>6

<211>40

<212>DNA

＜213〉artificial sequence

<400>6

gaggcatttg?cactttccat?ggtcttcggt?gcgcagatgg 40

<210>7

<211>40

<212>DNA

＜213〉artificial sequence

<400>7

ccatctgcgc?accgaagacc?atggaaagtg?caaatgcctc 40

<210>8

<211>32

<212>DNA

＜213〉artificial sequence

<400>8

gaagatcttc?ttagggtaac?atgtcttcca?tg 32

Claims

1. a human papillomavirus (HPV) 6 type L2N120E7E6 fusion roteins is characterized in that the aminoacid sequence of described fusion rotein is the sequence shown in the SQE.ID.NO.1.

2. the dna sequence dna of the described fusion rotein of claim 1 that is used to encode is characterized in that the nucleotides sequence of described dna sequence dna is classified the sequence shown in the SQE.ID.NO.2 as.

3. one kind is used to express the described Expression of Fusion Protein carrier of claim 1, it is characterized in that described expression vector contains the described dna sequence dna of claim 2;

Preferably, described expression vector is protokaryon or carrier for expression of eukaryon;

More preferably, described expression vector is an e. coli plasmid vector.

4. expression vector according to claim 3 is characterized in that, described e. coli plasmid vector is to be inserted between the BamH I site of plasmid pQE30 by the described dna sequence dna of claim 2 to make up;

Preferably, described intestinal bacteria are selected from JM109 and M15.

5. a bacterial strain that is used for the described fusion rotein of production claim 1 is characterized in that, described bacterial strain contains claim 3 or 4 described expression vectors;

Preferably, described bacterial strain is intestinal bacteria;

More preferably, described intestinal bacteria are selected from JM109 and M15.

6. a method for preparing the described fusion rotein of claim 1 is characterized in that, described method comprises that structure contains the expression vector of the described dna sequence dna of claim 2, and makes this expression vector obtain expressing;

Preferably, described expression vector is an e. coli plasmid vector;

More preferably, described intestinal bacteria are selected from JM109 and M15.

7. method according to claim 6 is characterized in that, this method may further comprise the steps:

1) the described dna sequence dna of claim 2 is inserted into the BamH I site of plasmid pQE30, constructs recombinant expression plasmid pQE30-HPV6L2N120E7E6;

2), obtain to contain the bacterial strain of this recombinant expression plasmid, inoculation culture, IPTG abduction delivering with the constructed recombinant expression plasmid transformed into escherichia coli of step 1);

8. one kind prepares the method that is used for prevention and 6 types infection of treatment human papillomavirus (HPV) and relative disease (as Genital warts) medicine, it is characterized in that this method comprises the described dna sequence dna of claim 2, claim 3 or 4 described expression vectors, the described bacterial strain of claim 5 are used to express the described human papillomavirus of claim 1 (HPV) 6 type L2N120E7E6 fusion roteins.

9. the described fusion rotein of claim 1, the described dna sequence dna of claim 2, claim 3 or 4 described expression vectors, the described bacterial strain of claim 5 are used for the application of prevention and 6 types infection of treatment human papillomavirus (HPV) and relative disease (as Genital warts) medicine in preparation;

Preferably, described medicine is a vaccine.

10. a vaccine that is used to prevent and treat Genital warts is characterized in that, described vaccine comprises the described fusion rotein of claim 1, the described dna sequence dna of claim 2, claim 3 or 4 described expression vectors or the described bacterial strain of claim 5.