CN102284064A - Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene - Google Patents
Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene Download PDFInfo
- Publication number
- CN102284064A CN102284064A CN2011100323216A CN201110032321A CN102284064A CN 102284064 A CN102284064 A CN 102284064A CN 2011100323216 A CN2011100323216 A CN 2011100323216A CN 201110032321 A CN201110032321 A CN 201110032321A CN 102284064 A CN102284064 A CN 102284064A
- Authority
- CN
- China
- Prior art keywords
- adhafp
- admafp
- gene
- sil
- nsil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention provides application of an adenovirus vector-mediated IL-24 with a humanized or murine AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating a liver cancer targeted gene, i.e., the humanized or murine AFP promoter is used for replacing a CMV (Cytomegalovirus) promoter in an adenovirus vector and an IL-24 gene is cloned to the downstream of the AFP promoter, so that the IL-24 gene is controlled by a tissue specific promoter to be specifically expressed and is only expressed in a liver cell without being expressed in normal liver cells and cells from other tissues, further the apoptosis of liver cancer cells is induced and the aim of the target treatment on liver cancer is achieved. The adenovirus vector-mediated IL-24 has the advantages that: firstly, the regulation and the control over a treatment gene, an efficient gene transmission vector and treatment gene expression are comprehensively utilized to achieve the target treatment action on liver cancer; secondly, the side effect is small; thirdly, the adenovirus vector-mediated IL-24 is combined with radiation treatment and chemo-treatment, thus the effect of the adenovirus vector-mediated IL-24 is enhanced; and fourthly, the adenovirus vector-mediated IL-24 has better treatment function on the spread cancer cells.
Description
Technical field
The present invention relates to a kind of gene therapy method is applied in the liver cancer treatment the particularly a kind of application of adenovirus vector-mediated IL-24 in preparation hepatoma targeting character gene therapy medicament with the AFP promoter.
Background technology
Hepatocarcinoma onset concealment, progress is fast, aggressive is strong, easily shift, the M ﹠ M height, occupy the first place of malignant tumor in China, and traditional operation, chemotherapy and radiotherapeutic effect are all undesirable, for this reason, and both at home and abroad all in the new method of seeking and carrying out liver cancer treatment.
Along with development of molecular biology, the particularly foundation of recombinant DNA technology makes various viruses become possibility as carrier.Wherein, adenovirus vector must develop into the transfer vector of genetic immunization and gene therapy than a kind of genophore early in aspect application and developments such as gene therapy, genetic immunizations.Because adenovirus vector safety and transduction efficiency height, so become the most frequently used carrier of therapy of tumor.Gene therapy provides a new solution route and scheme as the part for the treatment of malignant tumor for improving the tumor patient prognosis.In the indication of gene therapy, tumor ranks first place, and accounts for 66.2%.Existing two therapy of tumor are gone on the market by the SFDA approval with adenovirus vector in China.
Be that carrier mediated exogenous gene is used for treatment of cancer and only Ad-P53 that obtain certification with adenovirus at present, its exogenous gene is a P53 albumen, promoter is CMV, CMV is the tissue-specific promoter that do not have of a high strongly expressed, therefore, all infect all has P53 to express in the cell of this defective virus, do not have tissue specificity, and Ad-P53 is also only effective to the cancer that causes because of the P53 sudden change, therefore has the P53 dependency.
Adenovirus vector has the advantage of many uniquenesses: adenovirion is relatively stable; Safety is better, still finds no the integration of adenovirus in the mankind's tumor cell, does not find the direct relation that has of itself and human tumor; The adenoviral gene group is big (36 kb), and the potentiality of inserting big fragment allogenic gene are big; Cell and zoopery show that adenovirus vector is easy to exogenous gene is directly transferred in the target cell, and make its effective expression in cell become activated protein; The adenoviral gene group is more easy to operate.Simultaneously, host cell is comparatively extensive, except can be the breeding of intestinal and respiratory tract, various human somatic cells such as all right infected liver cell, vascular endothelial cell, vascular smooth muscle cell and neurogliocyte, the non-tissue-specific advantage that adenovirus vector infects is can be used as multiple treatment for cancer carrier, but bringing another negative effect is that adenovirus vector-mediated exogenous gene also can be expressed in the cancerous cell normal tissue cell outward, brings some uncertain secondary face effects.
Melanoma differentiation associated gene 7(mda-7/IL-24) be to utilize the subtrahend hybridization technique, the new gene of from people's melanoma cell strain HO-1, cloning.Therefore it belongs to one of bunch member of IL-10 family, and being named as IL-24.IL-24 again is a gene that possesses ideal tumor suppressor gene characteristics: 1. selectivity only promotes to increase in cancerous cell to suppress and apoptosis, and presses down cancer and have broad spectrum activity; 2. can guide intensive bypass Graft Versus Tumor (thereby offsetting low transduction effect); 3. work in coordination with other therapeutic scheme (radiotherapy, chemotherapy); 4. amplify immunologic process (the further strong damage that improves tumor cell); 5. the effect of angiogenesis inhibitor (suppressing the blood supply of tumor).Therefore II phase clinical research also proves its effectiveness and safety, has great clinical antitumor using value aspect the cancer pressing down, and gene therapy for cancer may be opened the brand-new window of a slice at this point.
AFP is alpha-fetoprotein (alpha-fetoprotein, AFP), its promoter is only expressed in Placenta Hominis, overwhelming majority hepatocarcinoma tissue has the characteristic of recovering the AFP expression, protein expression is by the tissue specificity decision of its promoter, therefore, antioncogene IL-24 is only expressed in hepatoma carcinoma cell, in other tissue-derived cell and normal liver cell, do not express.
Therefore, the invention exploitation just becomes the most important task of purpose at the therapeutic adenovirus vector of the cancerous cell in a certain particular organization source.
Summary of the invention
The present invention is to provide a kind of band AFP(people source and Mus source alpha-fetoprotein alpha-fetoprotein, AFP) application of the adenovirus vector-mediated IL-24 of promoter in preparation hepatoma targeting character gene therapy medicament, promptly come mediate foreign gene IL-24 only in hepatoma carcinoma cell, just to express and induce corresponding cancer cell-apoptosis with liver cancer-specific promoter AFP, even be hepatocyte equally, IL-24 does not express yet in normal liver cell, therefore the selectivity that has height, reduce possible side effect, the intensifier target tropism.
1, the application of the adenovirus vector-mediated IL-24 of band AFP promoter in preparation hepatoma targeting character gene therapy medicament, wherein: AFP is alpha-fetoprotein (alpha-fetoprotein), the AFP promoter comprises two kinds in people source or Mus source.
2, the application of the adenovirus vector-mediated IL-24 of band AFP promoter in preparation hepatoma targeting character gene therapy medicament, wherein: IL-24 utilizes the subtrahend hybridization technique, the new gene of from people's melanoma cell strain HO-1, cloning, its gene comprises a signal peptide series, and series is as follows:
1?ATGAATTTTC?AACAGAGGCT?GCAAAGCCTG?TGGACTTTAG?CCAGCAGACC
51?CTTCTGCCCT?CCTTTGCTGG?CGACAGCCTC?TCAAATGCAG?ATGGTTGTGC
101?TCCCTTGCCT?GGGTTTTACC?CTGCTTCTCT?GGAGCCAGGT?ATCAGGGGCC
151?CAGGGCCAAG?AATTCCACTT?TGGGCCCTGC?CAAGTGAAGG?GGGTTGTTCC
201?CCAGAAACTG?TGGGAAGCCT?TCTGGGCTGT?GAAAGACACT?ATGCAAGCTC
251?AGGATAACAT?CACGAGTGCC?CGGCTGCTGC?AGCAGGAGGT?TCTGCAGAAC
301?GTCTCGGATG?CTGAGAGCTG?TTACCTTGTC?CACACCCTGC?TGGAGTTCTA
351?CTTGAAAACT?GTTTTCAAAA?ACTACCACAA?TAGAACAGTT?GAAGTCAGGA
401?CTCTGAAGTC?ATTCTCTACT?CTGGCCAACA?ACTTTGTTCT?CATCGTGTCA
451?CAACTGCAAC?CCAGTCAAGA?AAATGAGATG?TTTTCCATCA?GAGACAGTGC
501?ACACAGGCGG?TTTCTGCTAT?TCCGGAGAGC?ATTCAAACAG?TTGGACGTAG
551?AAGCAGCTCT?GACCAAAGCC?CTTGGGGAAG?TGGACATTCT?TCTGACCTGG
601?ATGCAGAAAT?TCTACAAGCT?CTGA
3, the application of the adenovirus vector-mediated IL-24 of band AFP promoter in preparation hepatoma targeting character gene therapy medicament, wherein: personnel selection source or Mus source AFP promoter replace CMV promoter in the adenovirus vector, and with the IL-24 gene clone to AFP promoter downstream, make the IL-24 expression of gene be subjected to the control of AFP promoter. adenovirus vector carries the IL-24 gene as the exogenous gene expression carrier and enters hepatoma carcinoma cell, IL-24 is specific expressed under the control of the AFP of tissue-specific promoter, promptly only in hepatoma carcinoma cell, express, in normal liver cell and other tissue-derived cell, do not express, thereby lure embodiment 1, the application of adenovirus vector-mediated IL-24 in preparation hepatoma targeting character gene therapy medicament of band Mus source AFP promoter, wherein: the CMV promoter is replaced by Mus source AFP promoter in the adenovirus vector, and IL-24 is positioned at AFP promoter downstream.
1 reagent material Cobra venom endonuclease is a Ferments company product, adenoviral plasmid pDC315, pPGHloxP Δ E3 are available from Shenzhen's hundred grace thing Science and Technology Ltd. that supports one's family, Hep3B, HepG II, SMMC27721, normal liver cell are that L02, Hela preserve for this laboratory, and 293 available from the CCTCC of Wuhan University.
2 primers
HAFP1： AAGCTTTAGAAAATCCTGGTGC
HAFP2： TGTTATTGGCAGTGGTGGA
MAFP1: GGATACTGTGAGCAGT
MAFP2: GGATATTTTACTTGA
IL2401： ATGAATTTTCAACAGAGGCTGCA,
IL2402： CAAAGTGAAACTCTTGGCCCTGGGT
IL2403： GCCCAGGGCCAAGAGTTTCACTTT
IL2404： TCAGAGCTTGTAGAATTTCTGCATCCA
IL2405： ATG?GGGGCCCAGGGCCAAGA
LUC-f： ATGGAAGACGCCAAAAACATA
LUC-R： TTACACGGCGATCTTTCC
eGFP-F: ATGGTGAGCAAGGGCGAGGAG
eGFP-R: TCACTTGTACAGCTCGTCCATGCCGAG
It is synthetic that above primer is Shanghai biological engineering company limited.
3 methods
3.1 the amplification of Mus source and people source AFP promoter: basic skills is got the male Hepar Mus cancerous tissue of AFP and is extracted genomic DNA with reference to the operating instruction of TataRa Blood Goneme DNA Extraction KIT with reference to " molecular cloning ".With MAFP1 and MAFP2 is primer amplification Mus source AFP promoter, with HAFP1 and HAFP2 is the primer source AFP promoter of cloning people from HepG II genome, glue reclaims fragment, double digestion inserts the corresponding site of plasmid pDC315, substitute original CMV promoter among the pDC315, make up the expression vector AdMAFP and the AdHAFP of AFP control.
As a result 1: the AFP promoter size that increases from Mus is 991bp, identifies that through double digestion the back checks order, and the sequence of being measured is as follows:
GGATACTGTGAGCAGTAGCGCTGAAGTTCTTTTATATCCTTTTTAAGTGATGTCTGTTAACTAGTAACCTTCAGTGGGCAAACATGTTACTTTTTTTCCTTATGTTGAAGTTAGGCAATTTGCCAATAATTAACAGCACAGGGGTCACTTCTATCTTATGTTCAAGGACAAAGACCACTTCAGAGTGGAAAAAAAAAAACAAAACCTTGCAAATGCTGCAAATGTTCTCTGCCAACTAAACTCTTCCAATAGAAAGTATCTCCTAAGCTGAAGAAAGATTTATTTATTTCAATGTAAAACATTGATACAGCCATAAAGAAAATATAGCAGGCTTACTATGTAGCTCCAAATGCATTAATTCTTTTTTTAAAAAAAATAGTAAAATGCATGTTGCATGCTAGGCGCTGAACGTATGTCTGAGTCATTCAGACTCTTCATCAGTGGGTGTATTTCTTAATTATCCAGTTGTTATTTAGCTCAAAACCATTGGTCAAGGGGGTGTATTTAATTTTGTGTTTCGTGTCTGGTTTAACATAGAAAACTTACAGCACAAAGCCTGATGAACGAGTTCCCATTCTAATGTCGTGTGCCAAAGGCTATTCTGCATGTATGTCACAGATGCATGGGTTAGCTACAGCACCCTCTCAGGCCCTTGGGATGATGATGCTAACACTAACTAACGAGCACTGATATACTCTGACCCTGGGCAGGCTTCATCTCATACCTTCACCCTCGGTGTCCCGGAGTCTGTGACAGTTTCTTTAGTTCTCTACACATCAGAGAGATGCAAACTTGTAAAGAAAAATTCCCAGTGCGCATCTAAACTATACTCGGACTTTTTCTTTTTATGTGCTCAGAGTTTGATGCATATGTGCATCTGTTCTGCAAGGTCAGAAGAGGCAATGGAATCCGGGATCAGCTTTGTTATCAGACGTATCTGGCCGGGGGGATCTTACTTCAGTGGCTGACATGTGGCTCAAGTAAAATATCC
As a result 2: the AFP promoter size that increases from the HepG II is 981bp, identifies that through double digestion the back checks order, and the sequence of being measured is as follows:
aagctttagaaaatcctggtgcctgggtctcaactccacagattctgatttaactggtctgggttacagactaggcattgggaattcaaaaagttcccccagtgattctaatgtgtagccaagatcgggaacccttgtagacagggatgataggaggtgagccactcttagcatccatcatttagtattaacatcatcatcttgagttgctaagtgaatgatgcacctgacccactttataaagacacatgtgcaaataaaattattataggacttggtttattagggcttgtgctctaagttttctatgttaagccatacatcgcatattaaatactttaaaatgtaccttattgacatacatattaagtgaaaagtgtttctgagctaaacaatgacaacataattatcaagcaatgataatttgaaatgaatttattattctgcaacttagggacaagtcatctctctgaattttttgtactttgagagtatttgttatatttgcaagatgaagagtctgaatcggtcagacaatctcttgtgtgcctggcatatgataggcatttaatagttttaaagaattaatgtatttagatgaattgcataccaaatctgctgtcttttctttatggcttcattaacttaatttgagagaaattaattattctgcaacttagggacaagtcatctctttgaatattctgtagtttgaggagaatatttgttatatttgcaaaataaaataagtttgcaagttttttttttctgccccaaagagctctgtgtccttgaacataaaatacaaataaccgctatgctgttaattattggcaaatgtcccattttcaacctaaggaaataccataaagtaacagatataccaacaaaaggttactagttaacaggcattgcctgaaaagagtataaaagaatttcagcatgattttccatattgtgcttccaccactgccaataaca
3.2 the clone IL-24 gene of IL-24 gene is available from Wuhan three eagle companies, select primer I L2403 and IL2402 earlier the IL-24 gene to be carried out rite-directed mutagenesis respectively, reuse primer I L2401 and IL2404 clone comprise the signal sequence total length IL-24 of 1-49 amino acids, this unnamed gene is SIL-24, the synthetic albumen of institute can be expressed by external secretion, with primer I L2405 and signal sequence that does not comprise the 1-49 amino acids of IL2404 amplification, called after NSIL-24, the synthetic albumen of institute can not secreting, expressing.Simultaneously respectively with primer LUC-F and LUC-R amplification luciferase enzyme gene, with eGFP-R and eGFP-F amplification GFP gene, again these genes are building up to respectively among AdMAFP and the AdHAFP, last plasmid divides other called after AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdMAFP-GFP, AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP, wherein AdMAFP-GFP and AdHAFP-GFP are mainly used in virus packing indication usefulness, and AdMAFP-LUC and AdHAFP-LUC are mainly used in negative control.
3.3 the reorganization of adenovirus is pressed the adenovirus vector workbook with plasmid AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdMAFP-GFP, AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP pass through Lipo2fectamine2000 cotransfection to 293 cell with pBGHloxp △ E3 respectively.Behind the cotransfection about 15 days virus plaque appears, through 3-5 virus plaque purification, the kakaRa test kit extracts recombinant dna, carrying out PCR with the primer in 2 respectively again identifies, to determine successfully to have cloned the AFP promoter in the recombinant dna, the IL-24 gene, LUC gene and GFP gene, correct propagation defective adenoviral name called after AdMAFP-SIL-24V respectively will be identified, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdHAFP-LUCV, AdHAFP-GFPV increases in a large number, purification and titer determination.
Result: adenovirus AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdHAFP-LUCV, AdHAFP-GFPV is amplification repeatedly in 293 cells, and CsCl ultracentrifugation purification obtains highly spissated viral liquid.Measure through TCID50, AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdHAFP-LUCV, AdHAFP-GFPV virus titer reach 6.1 * 1010pfu/ml, 5.0 * 1010pfu/ml, 5.3 * 1010pfu/ml, 5.1 * 1010pfu/ml, 5.6 * 1010pfu/ml, 5.0 * 1010pfu/ml, 4.2 * 1010pfu/ml, 5.1 * 1010pfu/ml.
3.4 the mensuration of IL-24 orientation expression is measured used cell line and is respectively hepatoma cell line HepG II, normal liver cell is L02 and Hela, inoculate above-mentioned cell with six orifice plates by 5 * 104 cell number/hole respectively, after cultivating 24h, press the infection multiplicity inoculation AdMAFP-SIL-24V of MOI=5 respectively, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the AdHAFP-NSIL-24V defective adenoviral, the jog 2h of elder generation absorbs supernatant then, use 2% serum culture fluid again instead, cultivate 48h, collecting cell, not add viral cell synchronized culture in contrast, observing indicator virus with AdMAFP-GFPV and AdMAFP-GFPV experimental group under fluorescence microscope packs, judge the activity of people source and Mus source AFP promoter with measuring the luciferase enzymatic activity, AdMAFP-SIL-24V is extracted in explanation by the Protein and RNA Extraction Kit of TataRa company test kit respectively, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the cell extract of AdHAFP-NSIL-24V group, and carry out the SDS-Page electrophoresis with extracting solution, analyze IL-24 at AdMAFP-SIL-24V with Western Blotting, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, expression among the AdHAFP-NSIL-24V, wherein IL-24 and IL-24 monoclonal antibody are available from SANTA company, and the WB method is a conventional method.Activity with conventional luciferase enzymatic assays luciferase.
The result shows, the AFP promoter is can mediate foreign gene specific expressed in hepatoma carcinoma cell, do not express in the tissue-derived cell of normal hepatocyte and non-liver cancer, and glycosylation is highly arranged when adenovirus mediated IL-24 expresses in hepatocarcinoma simultaneously.LUCIFERASE enzyme activity determination AFP promoter as a result has stronger expression activity in hepatoma carcinoma cell.
3.5 AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the effect of AdHAFP-NSIL-24V liver cancer apoptosis reducing.
Use cells were tested by flow cytometry AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdMAFP-LUCV, AdHAFP-LUCV is to the influence of hepatoma cell apoptosis.
Hepatoma cell line and normal liver cell are that condition of culture is: contain RPMI 1640 culture medium of 10% calf serum, 100 mg/L streptomycins and 100 mU/L penicillins, 37 ℃ and 5% CO2.Cell culture digests to exponential phase, dilution, and counting is cultivated in transferred species to 24 orifice plate, and 105 cell number/hole are cultivated 24h; Remove culture fluid, every hole adds about 1ml serum-free medium, adds above-mentioned virus respectively with MO I=50, and matched group is AdHAFP-LUCV, hatches 90min, adds the culture fluid that contains 5% FBS.AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdMAFP-LUCV, AdHAFP-LUCV, after handling 24 h, centrifugal collecting cell also washes twice with cold PBS, uses 75% ethanol resuspended then,-20 ℃ of refrigerators fixedly spend the night, the cell of the fixing centrifugal recovery of 600g centrifugal force, ice-cold again PBS washed twice is handled 1h with the 100 ug/ml RNase A that are dissolved in PBS at 37 ℃ then, 4 ℃ of refrigerator PI (20 ug/ml) handle 30 min in the dark at last, and the machine of going up is at last measured.
Experimental result shows AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V can obviously induce the hepatocarcinoma apoptosis, and to normal liver cell and the not obviously influence of Hela cell, and control group A dMAFP-LUCV, AdHAFP-LUCV then induces hepatocarcinoma apoptosis efficient lower, show AdMAFP-SIL-24V, AdMAFP-NSIL-24V, effect mainly is IL-24 itself to the hepatocarcinoma apoptosis induced for AdHAFP-SIL-24V, AdHAFP-NSIL-24V, and it is specific expressed in hepatoma carcinoma cell that AFP can start exogenous gene, simultaneously the result also shows AdMAFP-SIL-24V, and the effect of AdHAFP-SIL-24V is than AdMAFP-NSIL-24V, the AdHAFP-NSIL-24V height, this may have amplification to the hepatocarcinoma apoptosis with the external secretion of IL-24, can guide intensive bypass Graft Versus Tumor.Show AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V has the specificity of being developed to anti cancer gene treatment new drug, wherein excellent is the best with AdMAFP-SIL-24V and AdHAFP-SIL-24V, has day potentiality of an anti cancer gene medicine.
Melanoma differentiation associated gene 7(mda-7/IL-24) be to utilize the subtrahend hybridization technique, the new gene of from people's melanoma cell strain HO-1, cloning.Therefore it belongs to one of bunch member of IL-10 family, and being named as IL-24.IL-24 again is a gene that possesses ideal tumor suppressor gene characteristics: 1. selectivity only promotes to increase in cancerous cell to suppress and apoptosis, and presses down cancer and have broad spectrum activity; 2. can guide intensive bypass Graft Versus Tumor (thereby offsetting low transduction effect); 3. work in coordination with other therapeutic scheme (radiotherapy, chemotherapy); 4. amplify immunologic process (the further strong damage that improves tumor cell); 5. the effect of angiogenesis inhibitor (suppressing the blood supply of tumor).Therefore II phase clinical research also proves its effectiveness and safety, has great clinical antitumor using value aspect the cancer pressing down, and gene therapy for cancer may be opened the brand-new window of a slice at this point.
AFP is alpha-fetoprotein (alpha-fetoprotein, AFP), its promoter is only expressed in Placenta Hominis, overwhelming majority hepatocarcinoma tissue has the characteristic of recovering the AFP expression, protein expression is by the tissue specificity decision of its promoter, therefore, antioncogene IL-24 is only expressed in hepatoma carcinoma cell, in other tissue-derived cell and normal liver cell, do not express.
The invention has the advantages that: gene delivery vector efficiently: make full use of the high characteristics of adenovirus vector safety and transduction efficiency; The regulation and control that therapeutic gene is expressed: the AFP promoter of utilizing liver cancer-specific to express can mediate the external source genes of interest can be in hepatoma carcinoma cell the characteristic of specificity orientation expression, realize the purpose of magnetic target therapy hepatocarcinoma; Effectively therapeutic gene: IL-24 has broad spectrum activity, bypass effect and synergitic characteristics, structure can be in hepatoma carcinoma cell the therapeutic adenovirus carrying agent of the efficient cancer cell specific induction of apoptosis of energy of specificity orientation expression, realize its targeted therapy effect to hepatocarcinoma, thereby improve the concentration of gene expression product at tumor by local, and amplify its therapeutic effect by the bypass effect of IL-24, simultaneously and other medicines synergism raising therapeutic efficiencies such as radiotherapy and chemotherapy.Realization effectively fully utilizes the regulation and control of therapeutic gene, gene delivery vector, therapeutic gene expression efficiently.
Another advantage of the present invention is: it is to come mediate foreign gene IL-24 with liver cancer-specific promoter AFP, only corresponding cancer cell-apoptosis is just expressed and induced to exogenous gene in hepatoma carcinoma cell, even be hepatocyte equally, IL-24 does not express yet in normal liver cell, therefore the selectivity that has height, reduce possible side effect, the intensifier target tropism.In addition, IL-24 has the broad-spectrum cancer resistance, does not rely on P53 albumen, does not also rely on Rb albumen etc.The present invention treats the method and the radiotherapy of hepatocarcinoma, chemotherapy is compared three outstanding advantages in addition with modus operandi, the one, side effect is little, radiotherapy and chemotherapy to people's hemocytees such as epithelial cell particularly immunocyte stronger side effect is all arranged, there is not selectivity, and Therapeutic Method of the present invention only has apoptosis-induced effect at hepatoma carcinoma cell, other tissue-derived cell and normal hepatocyte are all had no side effect, the 2nd, IL-24 not only can not damage immune system, function that can also the enhance immunity system, use the effect that strengthens radiotherapy and chemotherapy with radiotherapy and chemotherapy combined, the 3rd, operation is primarily aimed at the not hepatocarcinoma of diffusion, powerless to the hepatoma carcinoma cell that has spread, and this treatment carrier all has therapeutic effect to spreading or not spreading hepatoma carcinoma cell, because the cancerous cell that has spread is had same infection ability equally and induces its apoptosis, therefore can obviously improve later period of hepatocarcinoma patient's survival ability.
Description of drawings
Fig. 1 is that effect of the present invention is implemented illustration; The Lo2 normal liver cell, the Hela ovarian cancer cell, other all is hepatoma carcinoma cell.
The specific embodiment:
The application of adenovirus vector-mediated IL-24 in preparation hepatoma targeting character gene therapy medicament of embodiment 1, band Mus source AFP promoter, wherein: the CMV promoter is replaced by Mus source AFP promoter in the adenovirus vector, and IL-24 is positioned at AFP promoter downstream.
1 reagent material Cobra venom endonuclease is a Ferments company product, adenoviral plasmid pDC315, pPGHloxP Δ E3 are available from Shenzhen's hundred grace thing Science and Technology Ltd. that supports one's family, Hep3B, HepG II, SMMC27721, normal liver cell are that L02, Hela preserve for this laboratory, and 293 available from the CCTCC of Wuhan University.
2 primers
MAFP1: GGATACTGTGAGCAGT
MAFP2: GGATATTTTACTTGA
IL2401： ATGAATTTTCAACAGAGGCTGCA,
IL2402： CAAAGTGAAACTCTTGGCCCTGGGT
IL2403： GCCCAGGGCCAAGAGTTTCACTTT
IL2404： TCAGAGCTTGTAGAATTTCTGCATCCA
IL2405： ATG?GGGGCCCAGGGCCAAGA
LUC-f： ATGGAAGACGCCAAAAACATA
LUC-R： TTACACGGCGATCTTTCC
eGFP-F: ATGGTGAGCAAGGGCGAGGAG
eGFP-R: TCACTTGTACAGCTCGTCCATGCCGAG
It is synthetic that above primer is Shanghai biological engineering company limited.
3 methods
3.1 the amplification of Mus source AFP promoter: basic skills is got the male Hepar Mus cancerous tissue of AFP and is extracted genomic DNA with reference to the operating instruction of TataRa Blood Goneme DNA Extraction KIT with reference to " molecular cloning ".With MAFP1 and MAFP2 is primer amplification Mus source AFP promoter, cuts glue and reclaims fragment, and double digestion inserts the corresponding site of plasmid pDC315, substitutes original CMV promoter among the pDC315, makes up the expression vector AdAFP of AFP control.
The result: the AFP promoter size that increases from Mus is 991bp, order-checking after double digestion is identified, and the sequence of being measured is as follows:
GGATACTGTGAGCAGTAGCGCTGAAGTTCTTTTATATCCTTTTTAAGTGATGTCTGTTAACTAGTAACCTTCAGTGGGCAAACATGTTACTTTTTTTCCTTATGTTGAAGTTAGGCAATTTGCCAATAATTAACAGCACAGGGGTCACTTCTATCTTATGTTCAAGGACAAAGACCACTTCAGAGTGGAAAAAAAAAAACAAAACCTTGCAAATGCTGCAAATGTTCTCTGCCAACTAAACTCTTCCAATAGAAAGTATCTCCTAAGCTGAAGAAAGATTTATTTATTTCAATGTAAAACATTGATACAGCCATAAAGAAAATATAGCAGGCTTACTATGTAGCTCCAAATGCATTAATTCTTTTTTTAAAAAAAATAGTAAAATGCATGTTGCATGCTAGGCGCTGAACGTATGTCTGAGTCATTCAGACTCTTCATCAGTGGGTGTATTTCTTAATTATCCAGTTGTTATTTAGCTCAAAACCATTGGTCAAGGGGGTGTATTTAATTTTGTGTTTCGTGTCTGGTTTAACATAGAAAACTTACAGCACAAAGCCTGATGAACGAGTTCCCATTCTAATGTCGTGTGCCAAAGGCTATTCTGCATGTATGTCACAGATGCATGGGTTAGCTACAGCACCCTCTCAGGCCCTTGGGATGATGATGCTAACACTAACTAACGAGCACTGATATACTCTGACCCTGGGCAGGCTTCATCTCATACCTTCACCCTCGGTGTCCCGGAGTCTGTGACAGTTTCTTTAGTTCTCTACACATCAGAGAGATGCAAACTTGTAAAGAAAAATTCCCAGTGCGCATCTAAACTATACTCGGACTTTTTCTTTTTATGTGCTCAGAGTTTGATGCATATGTGCATCTGTTCTGCAAGGTCAGAAGAGGCAATGGAATCCGGGATCAGCTTTGTTATCAGACGTATCTGGCCGGGGGGATCTTACTTCAGTGGCTGACATGTGGCTCAAGTAAAATATCC
3.2 the clone IL-24 gene of IL-24 gene is available from Wuhan three eagle companies, select primer I L2403 and IL2402 earlier the IL-24 gene to be increased and rite-directed mutagenesis, the last signal sequence that comprises the 1-49 amino acids of IL-24 gene that obtains of reuse primer I L2401 and IL2404, this unnamed gene is SIL-24, the synthetic albumen of institute can be expressed by external secretion, with primer I L2405 and signal sequence that does not comprise the 1-49 amino acids of IL2404 amplification, called after NSIL-24, the synthetic albumen of institute can not secreting, expressing.Use primer LUC-F and LUC-R from plasmid vector amplification luciferase enzyme gene simultaneously respectively, use eGFP-F and eGFP-R from plasmid vector amplification GFP gene.These genes are building up to respectively among the AdMAFP behind double digestion, and last plasmid divides other called after AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdMAFP-GFP.Wherein AdMAFP-GFP is mainly used in virus packing indication usefulness, and AdMAFP-LUC is mainly used in negative control.
As a result, each organize the gene clone picture can be with reference to the Fig. 1 that sees in the Figure of description
3.3 the reorganization of adenovirus is pressed the adenovirus vector workbook with plasmid AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdMAFP-GFP pass through L ipo2fectamine2000 cotransfection to 293 cell with pBGHloxp △ E3 respectively.Behind the cotransfection about 15 days virus plaque appears, through 3-5 virus plaque purification, the kakaRa test kit extracts recombinant dna, carry out PCR with the primer in 2 respectively again and identify, to determine successfully to have cloned AFP promoter, IL-24 gene, luciferase enzyme gene and GFP gene in the recombinant dna.To identify correct propagation defective adenoviral name called after AdMAFP-SIL-24V respectively, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV increase in a large number, purification and titer determination.
The result: adenovirus AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV be amplification repeatedly in 293 cells, and CsCl ultracentrifugation purification obtains highly spissated viral liquid.Measure through TCID50, AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV virus titer reach 6.1 * 1010pfu/ml, 5.0 * 1010pfu/ml, 5.3 * 1010pfu/ml, 5.1 * 1010pfu/ml.
3.4 the mensuration of IL-24 orientation expression is measured used cell line and is respectively hepatoma cell line HepG II, Hep3B and control cells system (normal liver cell is L02 and Hela), inoculate above-mentioned cell with six orifice plates by 5 * 104 cell number/hole respectively, after cultivating 24h, press the infection multiplicity inoculation AdMAFP-SIL-24V of MOI=5 respectively, the AdMAFP-NSIL-24V defective adenoviral, the jog 2h of elder generation absorbs supernatant then, use 2% serum culture fluid again instead, cultivate 48h, collecting cell, not add viral cell synchronized culture in contrast, observing indicator virus with the AdMAFP-GFPV experimental group under fluorescence microscope packs, judge the activity of Mus source AFP promoter with measuring the luciferase enzymatic activity, AdMAFP-SIL-24V is extracted in explanation by the Protein and RNA Extraction Kit of TataRa company test kit respectively, the cell extract of AdMAFP-NSIL-24V group, and carry out the SDS-Page electrophoresis with extracting solution, analyze IL-24 at AdMAFP-SIL-24V with Western Blotting, expression among the AdMAFP-NSIL-24V, wherein IL-24 and IL-24 monoclonal antibody are available from SANTA company, and the WB method is a conventional method.Activity with conventional LUCIFERASE enzymatic assays luciferase.
Expressing fragment can be with reference to the Fig. 2 that sees in the Figure of description
The result shows, the AFP promoter can be expressed by mediate foreign gene specific efficient in hepatoma carcinoma cell, do not express in the tissue-derived cell of normal hepatocyte and non-liver cancer, and glycosylation is highly arranged when adenovirus mediated IL-24 expresses in hepatocarcinoma simultaneously.LUCIFERASE enzyme activity determination result is consistent with the WB testing result of IL-24.
Embodiment 2, people source AFP promoter are replaced the application of adenovirus vector-mediated IL-24 in preparation hepatoma targeting character gene therapy medicament of CMV promoter, wherein: the CMV promoter is replaced by people source AFP promoter in the adenovirus vector, and IL-24 is positioned at AFP promoter downstream.
1 reagent material Cobra venom endonuclease is a Ferments company product, adenoviral plasmid pDC315, pPGHloxP Δ E3 are available from Shenzhen's hundred grace thing Science and Technology Ltd. that supports one's family, Hep3B, HepG II, SMMC27721, normal liver cell are that L02, Hela preserve for this laboratory, and 293 available from the CCTCC of Wuhan University.
2 primers
HAFP1： AAGCTTTAGAAAATCCTGGTGC
HAFP2： TGTTATTGGCAGTGGTGGA
IL2401： ATGAATTTTCAACAGAGGCTGCA,
IL2402： CAAAGTGAAACTCTTGGCCCTGGGT
IL2403： GCCCAGGGCCAAGAGTTTCACTTT
IL2404： TCAGAGCTTGTAGAATTTCTGCATCCA
IL2405： ATG?GGGGCCCAGGGCCAAGA
LUC-f： ATGGAAGACGCCAAAAACATA
LUC-R： TTACACGGCGATCTTTCC
eGFP-F: ATGGTGAGCAAGGGCGAGGAG
eGFP-R: TCACTTGTACAGCTCGTCCATGCCGAG
It is synthetic that above primer is Shanghai biological engineering company limited.
3 methods
3.1 the amplification of people source AFP promoter: basic skills is got HepG II cell with reference to TataRa Blood Goneme DNA Extraction KIT(D9081 with reference to " molecular cloning ") operating instruction extract genomic DNA.With HAFP1 and HAFP2 is the primer source AFP promoter of cloning people from HepG II genome, cuts glue and reclaims fragment, and double digestion inserts the corresponding site of plasmid pDC315, substitutes original CMV promoter among the pDC315, makes up the expression vector AdHAFP of AFP control.
The result: the AFP promoter size that increases from the HepG II is 981bp, order-checking after double digestion is identified, and the sequence of being measured is as follows:
aagctttagaaaatcctggtgcctgggtctcaactccacagattctgatttaactggtctgggttacagactaggcattgggaattcaaaaagttcccccagtgattctaatgtgtagccaagatcgggaacccttgtagacagggatgataggaggtgagccactcttagcatccatcatttagtattaacatcatcatcttgagttgctaagtgaatgatgcacctgacccactttataaagacacatgtgcaaataaaattattataggacttggtttattagggcttgtgctctaagttttctatgttaagccatacatcgcatattaaatactttaaaatgtaccttattgacatacatattaagtgaaaagtgtttctgagctaaacaatgacaacataattatcaagcaatgataatttgaaatgaatttattattctgcaacttagggacaagtcatctctctgaattttttgtactttgagagtatttgttatatttgcaagatgaagagtctgaatcggtcagacaatctcttgtgtgcctggcatatgataggcatttaatagttttaaagaattaatgtatttagatgaattgcataccaaatctgctgtcttttctttatggcttcattaacttaatttgagagaaattaattattctgcaacttagggacaagtcatctctttgaatattctgtagtttgaggagaatatttgttatatttgcaaaataaaataagtttgcaagttttttttttctgccccaaagagctctgtgtccttgaacataaaatacaaataaccgctatgctgttaattattggcaaatgtcccattttcaacctaaggaaataccataaagtaacagatataccaacaaaaggttactagttaacaggcattgcctgaaaagagtataaaagaatttcagcatgattttccatattgtgcttccaccactgccaataaca
3.2 the clone IL-24 gene of IL-24 gene is available from Wuhan three eagle companies, the mode LUC, the SIL-24 that press figure below respectively are identical with embodiment 1 with the NSIL-24 gene clone method, these genes are behind double digestion, be building up among the AdHAFP respectively, last plasmid divides other called after AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP.Wherein AdHAFP-GFP is mainly used in virus packing indication usefulness, and AdHAFP-LUC is mainly used in negative control.
3.3 the reorganization of adenovirus is undertaken by the adenovirus vector workbook, concrete grammar will be identified correct propagation defective adenoviral name called after AdHAFP-SIL-24 respectively, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP with reference to embodiment 1.Increase in a large number, purification and titer determination.
Result: adenovirus AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP.Amplification repeatedly in 293 cells, CsCl ultracentrifugation purification obtains highly spissated viral liquid.Measure AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP through TCID50.Virus titer is respectively to reach 5.6 * 1010pfu/ml, 5.0 * 1010pfu/ml, 4.2 * 1010pfu/ml, 5.1 * 1010pfu/ml.
3.4 the mensuration of IL-24 orientation expression is measured used cell line and is respectively hepatoma cell line Hep3B, HepG II and control cells system (normal liver cell is L02 and Hela), inoculate above-mentioned cell with six orifice plates by 5 * 104 cell number/hole respectively, after cultivating 24h, press the infection multiplicity inoculation AdHAFP-SIL-24 of MOI=5 respectively, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP.Defective adenoviral, the jog 2h of elder generation absorbs supernatant then, use 2% serum culture fluid again instead, cultivate 48h, collecting cell, not add viral cell synchronized culture in contrast, observing indicator virus with the AdHAFP-GFPV experimental group under fluorescence microscope packs, judge the activity of people source and Mus source AFP promoter with measuring the luciferase enzymatic activity, extract the cell extract of AdHAFP-SIL-24V and AdHAFP-NSIL-24V group respectively by the explanation of the Protein and RNA Extraction Kit of TataRa company test kit, and carry out the SDS-Page electrophoresis with extracting solution, analyze the expression of IL-24 in AdHAFP-SIL-24V and AdHAFP-NSIL-24V with Western Blotting, wherein IL-24 and IL-24 monoclonal antibody are available from SANTA company, and the WB method is a conventional method.Activity with conventional LUCIFERASE enzymatic assays luciferase.The result shows, the AFP promoter is can mediate foreign gene specific expressed in hepatoma carcinoma cell, do not express in the tissue-derived cell of normal hepatocyte and non-liver cancer.
Embodiment 3:AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the effect of AdHAFP-NSIL-24V liver cancer apoptosis reducing.
Use cells were tested by flow cytometry AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdMAFP-LUCV, AdHAFP-LUCV is to the influence of hepatoma cell apoptosis.
Hepatoma cell line and normal liver cell are that condition of culture is: contain RPMI 1640 culture medium of 10% calf serum, 100 mg/L streptomycins and 100 mU/L penicillins, 37 ℃ and 5% CO2.Cell culture digests to exponential phase, dilution, and counting is cultivated in transferred species to 24 orifice plate, and 105 cell number/hole are cultivated 24h; Remove culture fluid, every hole adds about 1ml serum-free medium, adds above-mentioned virus respectively with MO I=50, and matched group is AdHAFP-LUCV, hatches 90min, adds the culture fluid that contains 5% FBS.AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdMAFP-LUCV, AdHAFP-LUCV, after handling 24 h, centrifugal collecting cell also washes twice with cold PBS, uses 75% ethanol resuspended then,-20 ℃ of refrigerators fixedly spend the night, the cell of the fixing centrifugal recovery of 600g centrifugal force, ice-cold again PBS washed twice is handled 1h with the 100 ug/ml RNase A that are dissolved in PBS at 37 ℃ then, 4 ℃ of refrigerator PI (20 ug/ml) handle 30 min in the dark at last, and the machine of going up is at last measured.
The experimental result displayed map can be with reference to the Fig. 3 that sees in the Figure of description
Experimental result shows AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V can obviously induce the hepatocarcinoma apoptosis, and to normal liver cell and the not obviously influence of Hela cell, and control group A dMAFP-LUCV, AdHAFP-LUCV then induces hepatocarcinoma apoptosis efficient lower, show AdMAFP-SIL-24V, AdMAFP-NSIL-24V, effect mainly is IL-24 itself to the hepatocarcinoma apoptosis induced for AdHAFP-SIL-24V, AdHAFP-NSIL-24V, and it is specific expressed in hepatoma carcinoma cell that AFP can start exogenous gene, simultaneously the result also shows AdMAFP-SIL-24V, and the effect of AdHAFP-SIL-24V is than AdMAFP-NSIL-24V, the AdHAFP-NSIL-24V height, this may have amplification to the hepatocarcinoma apoptosis with the external secretion of IL-24, can guide intensive bypass Graft Versus Tumor.Show AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V have the specificity of being developed to anti cancer gene treatment new drug, and wherein excellent is the best with AdMAFP-SIL-24V and AdHAFP-SIL-24V.
Claims (3)
1. the application of the adenovirus vector-mediated IL-24 of band AFP promoter in preparation hepatoma targeting character gene therapy medicament, wherein: AFP is alpha-fetoprotein (alpha-fetoprotein), the AFP promoter comprises two kinds in people source or Mus source.
2. the application of the adenovirus vector-mediated IL-24 of band AFP promoter in preparation hepatoma targeting character gene therapy medicament, wherein: IL-24 utilizes the subtrahend hybridization technique, the new gene of from people's melanoma cell strain HO-1, cloning, its gene comprises a signal peptide series, and series is as follows:
1?ATGAATTTTC?AACAGAGGCT?GCAAAGCCTG?TGGACTTTAG?CCAGCAGACC
51?CTTCTGCCCT?CCTTTGCTGG?CGACAGCCTC?TCAAATGCAG?ATGGTTGTGC
101?TCCCTTGCCT?GGGTTTTACC?CTGCTTCTCT?GGAGCCAGGT?ATCAGGGGCC
151?CAGGGCCAAG?AATTCCACTT?TGGGCCCTGC?CAAGTGAAGG?GGGTTGTTCC
201?CCAGAAACTG?TGGGAAGCCT?TCTGGGCTGT?GAAAGACACT?ATGCAAGCTC
251?AGGATAACAT?CACGAGTGCC?CGGCTGCTGC?AGCAGGAGGT?TCTGCAGAAC
301?GTCTCGGATG?CTGAGAGCTG?TTACCTTGTC?CACACCCTGC?TGGAGTTCTA
351?CTTGAAAACT?GTTTTCAAAA?ACTACCACAA?TAGAACAGTT?GAAGTCAGGA
401?CTCTGAAGTC?ATTCTCTACT?CTGGCCAACA?ACTTTGTTCT?CATCGTGTCA
451?CAACTGCAAC?CCAGTCAAGA?AAATGAGATG?TTTTCCATCA?GAGACAGTGC
501?ACACAGGCGG?TTTCTGCTAT?TCCGGAGAGC?ATTCAAACAG?TTGGACGTAG
551?AAGCAGCTCT?GACCAAAGCC?CTTGGGGAAG?TGGACATTCT?TCTGACCTGG
601?ATGCAGAAAT?TCTACAAGCT?CTGA。
3. the application of the adenovirus vector-mediated IL-24 of band AFP promoter as claimed in claim 1 or 2 in preparation hepatoma targeting character gene therapy medicament, wherein: personnel selection source or Mus source AFP promoter replace CMV promoter in the adenovirus vector, and with the IL-24 gene clone to AFP promoter downstream, make the IL-24 expression of gene be subjected to the control of AFP promoter. adenovirus vector carries the IL-24 gene as the exogenous gene expression carrier and enters hepatoma carcinoma cell, IL-24 is specific expressed under the control of the AFP of tissue-specific promoter, promptly only in hepatoma carcinoma cell, express, in normal liver cell and other tissue-derived cell, do not express, thereby liver cancer apoptosis reducing reaches the purpose of magnetic target therapy hepatocarcinoma;
The amplification of Mus source and people source AFP promoter: basic skills is got the male Hepar Mus cancerous tissue of AFP and is extracted genomic DNA with reference to " molecular cloning "; With MAFP1 and MAFP2 is primer amplification Mus source AFP promoter, is that the primer source AFP promoter of cloning people from HepG II genome substitutes original CMV promoter among the pDC315 with HAFP1 and HAFP2, makes up the expression vector AdMAFP and the AdHAFP of AFP control;
The result: the AFP promoter size that increases from Mus is 991bp, order-checking after double digestion is identified, and the sequence of being measured is as follows:
GGATACTGTGAGCAGTAGCGCTGAAGTTCTTTTATATCCTTTTTAAGTGATGTCTGTTAACTAGTAACCTTCAGTGGGCAAACATGTTACTTTTTTTCCTTATGTTGAAGTTAGGCAATTTGCCAATAATTAACAGCACAGGGGTCACTTCTATCTTATGTTCAAGGACAAAGACCACTTCAGAGTGGAAAAAAAAAAACAAAACCTTGCAAATGCTGCAAATGTTCTCTGCCAACTAAACTCTTCCAATAGAAAGTATCTCCTAAGCTGAAGAAAGATTTATTTATTTCAATGTAAAACATTGATACAGCCATAAAGAAAATATAGCAGGCTTACTATGTAGCTCCAAATGCATTAATTCTTTTTTTAAAAAAAATAGTAAAATGCATGTTGCATGCTAGGCGCTGAACGTATGTCTGAGTCATTCAGACTCTTCATCAGTGGGTGTATTTCTTAATTATCCAGTTGTTATTTAGCTCAAAACCATTGGTCAAGGGGGTGTATTTAATTTTGTGTTTCGTGTCTGGTTTAACATAGAAAACTTACAGCACAAAGCCTGATGAACGAGTTCCCATTCTAATGTCGTGTGCCAAAGGCTATTCTGCATGTATGTCACAGATGCATGGGTTAGCTACAGCACCCTCTCAGGCCCTTGGGATGATGATGCTAACACTAACTAACGAGCACTGATATACTCTGACCCTGGGCAGGCTTCATCTCATACCTTCACCCTCGGTGTCCCGGAGTCTGTGACAGTTTCTTTAGTTCTCTACACATCAGAGAGATGCAAACTTGTAAAGAAAAATTCCCAGTGCGCATCTAAACTATACTCGGACTTTTTCTTTTTATGTGCTCAGAGTTTGATGCATATGTGCATCTGTTCTGCAAGGTCAGAAGAGGCAATGGAATCCGGGATCAGCTTTGTTATCAGACGTATCTGGCCGGGGGGATCTTACTTCAGTGGCTGACATGTGGCTCAAGTAAAATATCC
The result: the AFP promoter size that increases from the HepG II is 981bp, order-checking after double digestion is identified, and the sequence of being measured is as follows:
aagctttagaaaatcctggtgcctgggtctcaactccacagattctgatttaactggtctgggttacagactaggcattgggaattcaaaaagttcccccagtgattctaatgtgtagccaagatcgggaacccttgtagacagggatgataggaggtgagccactcttagcatccatcatttagtattaacatcatcatcttgagttgctaagtgaatgatgcacctgacccactttataaagacacatgtgcaaataaaattattataggacttggtttattagggcttgtgctctaagttttctatgttaagccatacatcgcatattaaatactttaaaatgtaccttattgacatacatattaagtgaaaagtgtttctgagctaaacaatgacaacataattatcaagcaatgataatttgaaatgaatttattattctgcaacttagggacaagtcatctctctgaattttttgtactttgagagtatttgttatatttgcaagatgaagagtctgaatcggtcagacaatctcttgtgtgcctggcatatgataggcatttaatagttttaaagaattaatgtatttagatgaattgcataccaaatctgctgtcttttctttatggcttcattaacttaatttgagagaaattaattattctgcaacttagggacaagtcatctctttgaatattctgtagtttgaggagaatatttgttatatttgcaaaataaaataagtttgcaagttttttttttctgccccaaagagctctgtgtccttgaacataaaatacaaataaccgctatgctgttaattattggcaaatgtcccattttcaacctaaggaaataccataaagtaacagatataccaacaaaaggttactagttaacaggcattgcctgaaaagagtataaaagaatttcagcatgattttccatattgtgcttccaccactgccaataaca
The clone of IL-24 gene clones band signal peptide and not the IL-24 gene SIL-24 and the NSIL-24 of band signal peptide respectively, clones luciferase enzyme gene and GFP gene simultaneously respectively;
These genes are building up to respectively among AdMAFP and the AdHAFP behind double digestion, and last plasmid divides other called after AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP, AdMAFP-GFP; Wherein AdMAFP-LUC and AdHAFP-LUC are mainly used in negative control, and AdHAFP-GFP, AdMAFP-GFP are mainly used in the packing of indicator virus;
The reorganization of adenovirus is pressed the adenovirus vector workbook with plasmid AdMAFP-SIL-24, AdMAFP-NSIL-24, AdMAFP-LUC, AdMAFP-GFP, AdHAFP-SIL-24, AdHAFP-NSIL-24, AdHAFP-LUC, AdHAFP-GFP pass through Lipo2fectamine2000 cotransfection to 293 cell with pBGHloxp △ E3 respectively;
Through the virus plaque purification, extract recombinant dna and carry out the PCR evaluation, correct propagation defective adenoviral name called after AdMAFP-SIL-24V respectively will be identified, AdMAFP-NSIL-24V, AdMAFP-LUCV, AdMAFP-GFPV, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdHAFP-LUCV, AdHAFP-GFPV;
The mensuration AdMAFP-SIL-24V of IL-24 orientation expression, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the AdHAFP-NSIL-24V defective adenoviral infects hepatoma cell line HepG II respectively, reaches control cells system (normal liver cell is L02 and Hela), extract the cell extract of each group respectively, analyze IL-24 at AdMAFP-SIL-24V with Western Blotting, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the expression among the AdHAFP-NSIL-24V;
AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, the effect of AdHAFP-NSIL-24V liver cancer apoptosis reducing;
Use cells were tested by flow cytometry AdMAFP-SIL-24V, AdMAFP-NSIL-24V, AdHAFP-SIL-24V, AdHAFP-NSIL-24V, AdMAFP-LUCV, AdHAFP-LUCV infect hepatoma cell line and normal liver cell system respectively, after handling 24 h, respectively organize the apoptosis rate of cell with cells were tested by flow cytometry;
The clone of IL-24 gene wherein: the IL-24 gene is available from Wuhan three eagle companies, select primer I L2403 and IL2402 earlier the IL-24 gene to be carried out rite-directed mutagenesis respectively, reuse primer I L2401 and IL2404 clone comprise the signal sequence total length IL-24 of 1-49 amino acids, this unnamed gene is SIL-24, the synthetic albumen of institute can be expressed by external secretion, with primer I L2405 and signal sequence that does not comprise the 1-49 amino acids of IL2404 amplification, called after NSIL-24, the synthetic albumen of institute can not secreting, expressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100323216A CN102284064A (en) | 2011-01-30 | 2011-01-30 | Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011100323216A CN102284064A (en) | 2011-01-30 | 2011-01-30 | Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102284064A true CN102284064A (en) | 2011-12-21 |
Family
ID=45330999
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011100323216A Pending CN102284064A (en) | 2011-01-30 | 2011-01-30 | Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102284064A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504688A (en) * | 2018-03-07 | 2018-09-07 | 邹卫龙 | Regulate and control suicide gene steerable system specific expressed in liver tumor cells |
-
2011
- 2011-01-30 CN CN2011100323216A patent/CN102284064A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504688A (en) * | 2018-03-07 | 2018-09-07 | 邹卫龙 | Regulate and control suicide gene steerable system specific expressed in liver tumor cells |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Koski et al. | Treatment of cancer patients with a serotype 5/3 chimeric oncolytic adenovirus expressing GMCSF | |
| Lasaro et al. | New insights on adenovirus as vaccine vectors | |
| US10662441B2 (en) | Viral vector targeting cancer stem cells | |
| Krump et al. | From Merkel cell polyomavirus infection to Merkel cell carcinoma oncogenesis | |
| US9345787B2 (en) | Adenoviral vectors and methods and uses related thereto | |
| CA2812096A1 (en) | Adenoviral vectors and methods and uses related thereto | |
| CN103981155B (en) | The structure method of liver cancer targeting oncolytic adenovirus and application | |
| Foka et al. | Novel tumour‐specific promoters for transcriptional targeting of hepatocellular carcinoma by herpes simplex virus vectors | |
| WO2016106178A1 (en) | Multitargeting onocolytic adenovirus, methods of use, and methods of making | |
| CN109439686B (en) | Recombinant attenuated salmonella LH430 and preparation method and application thereof | |
| CN103484462B (en) | The recombinant adenoviral vector of Survivin promoter regulation CD gene builds and application | |
| CN101921769A (en) | A kind of recombinant adenovirus and its production and application | |
| CN1328372C (en) | Tumor target gene-virus ZD55-IL-24, construction method and application thereof | |
| CN102284064A (en) | Application of adenovirus vector-mediated IL-24 with AFP (Alpha-Fetoprotein) promoter to preparation of medicament for treating liver cancer targeted gene | |
| Lu et al. | Molecular characterization of adenoviruses in fecal samples of captively bred rhesus macaques in China | |
| CN102399777B (en) | Recombinant plasmid and recombinant oncolytic virus prepared by using the same | |
| CN103981185B (en) | Liver cancer-specific GP73 core promoter and screening construction process thereof | |
| CN102286435B (en) | Regulatory-cytokine-induced anti-apoptotic molecule (CIAPIN1) recombinant adenovirus and preparation method and use thereof | |
| Xue et al. | Efficacy of recombinant adenovirus expressing a fusion gene from GM-CSF and Epstein-Barr virus LMP2A in a mouse tumor model | |
| Choi et al. | Enhanced tumor targeting and timely viral release of mesenchymal stem cells/oncolytic virus complex due to GRP78 and inducible E1B55K expressions greatly increase the antitumor effect of systemic treatment | |
| CN101864400B (en) | Specific recombinant adenoviruses, preparation thereof and use thereof | |
| CN105002145B (en) | Method and recombined adhenovirus and application using the gene constructed recombined adhenovirus of mTERT and mTyr double-promoter combined regulating HN | |
| CN103451231A (en) | Schistosomiasis japonica vaccine establishment and application using mankind replication-deficient recombinant adenovirus as carrier | |
| CN101805724B (en) | Targeting WWOX (WW domain-containing oxidoreductase) gene recombinant adenovirus and preparation method and application thereof | |
| CN111925997B (en) | Construction and application method of recombinant oncolytic adenovirus for expressing interleukin 33 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111221 |