CN102277351A

CN102277351A - Method for acquiring gene information and function genes from species without genome referenced sequences

Info

Publication number: CN102277351A
Application number: CN 201010197328
Authority: CN
Inventors: 苗雪霞; 李海超; 王玉冰; 张�浩; 黄勇平
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2010-06-10
Filing date: 2010-06-10
Publication date: 2011-12-14

Abstract

The invention relates to a method for acquiring gene information and function genes from species without genome referenced sequences, a method for acquiring gene-expression profiles from Ostrinia furnacalis Guenee, and a method for acquiring transcriptome information and function genes of the Ostrinia furnacalis Guenee. In the invention, a DGE-tag (digital gene expression tag) technology is combined with an RNA-seq (ribonucleic acid-sequencing) technology firstly, which is used for acquiring the expression period, expression quantity, corresponding metabolic pathways and function information of genes from the species without the genome referenced sequences, thus being convenient, quick and exact and having low cost.

Description

Obtain the method for gene information and functional gene from no genome reference sequences species

Technical field

The invention belongs to biological technical field; More specifically, the present invention relates to obtain the method for gene information and functional gene from no genome reference sequences species.

Background technology

The subject matter that new gene is puzzlement biologist research is always excavated on quick in the species that lack the genome reference sequences, high-throughput ground, the method general using that traditional gene is excavated makes up the library, the SAGE technology, the MPSS technology, perhaps the method for gene order-checking obtains, yet generally all there is the cost height in these methods, workload is big, obtain a large amount of numerous and jumbled sequences, and under not having with reference to the situation of genome sequence, be difficult to reject redundant sequence, these problems have had a strong impact on the research to animal-plant gene group level.

Digital gene expression label (DGE-tag) and high-throughput are transcribed group analysis (RNA-seq) and are based on new-generation sequencing technology acquisition expressed sequence tag and gene transcripts sequence.DGE-tag obtains sequence label (the Digital Gene Expression Tag Profile of expressing gene based on the digitizing express spectra, DGE-tag), utilize the new-generation sequencing technology can be fast, comprehensively, the expression conditions under high throughput testing particular organization or the different states, with the special gene of DGE-tag mark of 3 ' special terminal 21bp, and indicate the technology of this expression of gene amount with the DGE-tag multiplicity; RNA-seq can detect nearly all transcript fast at the summation of following all RNA that can transcribe out of the certain state of specific cells.At present, these two technology are widely used in medical science respectively, biological, industries such as agricultural, DGE-tag often is applied to analyzing the gene of Tag sequence representative, gene expression dose, the research of sample room gene expression difference, RNA-seq then is used in transcript structures (UTR zone evaluation, intron/exon identifies, variable shearing, promoter zone evaluation etc.), non-coding region function (non-coding RNA, microRNA etc.), gene transcription level and newly transcribe the zone research, two kinds of methods in theory all can obtain all transcript information of single species, but present with different expression modes, DGE-tag is with the corresponding unique gene order of the tag sequence of 3 ' end 21bp, and presents the expression amount of this gene at specific period and tissue by different reads quantity.RNA-seq checks order by mRNA and obtains the sequence of 75bp, obtains the full length sequence of gene by the assembling splicing.Utilize these two kinds of methods to excavate new gene respectively, the research gene function has high-throughput, repeatable advantages of higher, but its unfavorable place is arranged also, though can find out the differential expression of different genes or sample room fast as DGE-tag, but for further the research gene function also must be after obtaining the tag sequence, in conjunction with the GIGI technology, the RACE technology further increases to obtain gene order, and by qPCR or Northern blot checking, these work need lot of manpower and material resources just can finish undoubtedly, simultaneously, because the tag sequence only is the sequence of 21bp, when being carried out gene annotation, it causes disappearance or mispairing inevitably.Therefore, need exploitation more rationally, method more accurate and with low cost excavates new gene information from genome.

Ostrinia furnacalis (Ostrinia furnacalis Guen é e) is important worldwide Agricultural pests, important food cash crop such as main harm corn, Chinese sorghum, Sunflower Receptacle, present control to Ostrinia furnacalis, remain based on chemical prevention, ecotope and grain security production have been caused huge infringement, though and the method for utilizing breeding for pest resistance can reduce ecological pressure well, but its breeding cycle is long and plant resistance to environment stress is single, be easy to generate pest resistance, utilizing the pest-resistant method of molecular breeding is solution preferably at present.And less to the Pyrausta nubilalis (Hubern). Molecular Study at present, gene information is very deficient, makes that the progress of Pyrausta nubilalis (Hubern). gene aspect is slow.Because the whole genome sequence of these species not, also be in the stage of traditional biological for the research of these species, and the research of molecular biology aspect is less relatively all the time, the similar gene that mainly is based on nearly source species is studied.For the species that lack genome sequence, the discovery of new gene and functional study are the subject matter of puzzlement biologist research always, the method general using that traditional gene is excavated makes up the library, the SAGE technology, the MPSS technology, perhaps the method for gene order-checking obtains, yet generally all there is the cost height in these methods, workload is big, obtain a large amount of impurity sequences, and do not having with reference to being difficult to the rejecting redundant sequence under the genomic situation, these problems have had a strong impact on the research to animal-plant gene group level.Therefore, need find the method for suitable excavation Ostrinia furnacalis genomic gene, in the hope of understanding Ostrinia furnacalis gene as much as possible, for the technology from molecular biology aspect exploitation control Ostrinia furnacalis provides effective way.

Summary of the invention

The object of the present invention is to provide the method that obtains gene information and functional gene from no genome reference sequences species.

Another object of the present invention is to provide the method for the gene expression profile that obtains Ostrinia furnacalis.

Another object of the present invention is to obtain the gene information of Ostrinia furnacalis and the method for functional gene.

In a first aspect of the present invention, a kind of method from no genome reference sequences species excavation gene information is provided, comprising:

(1) digital gene express spectra (the Digital Gene Expression-tag Profile of acquisition species to be measured; DGE-tag), comprising the sequence and the abundance of gene expression label (Tag);

(2) set (RNA-seq) of the full genome transcript of acquisition species to be measured forms sequence library;

(3) gene expression label in the digital gene express spectra that (1) is obtained compares with the sequence library that (2) obtain respectively, find transcript sequence with this gene expression label coupling, obtain sequence with the corresponding full length gene cDNA of this gene expression label, the geneseq database of this full length gene cDNA sequence and known information is compared and analyzes, obtain the potential function of the gene of this sequence correspondence; Simultaneously, this gene expression label abundance that obtains according to (1) obtains its corresponding expression of gene amount or expression pattern.

In a preference, described species to be measured (animal or plant) are in a certain period of growth.

In another preference, described species are animal or plants.

In another preference, step (1) comprising:

(a) total RNA of extraction species to be measured, isolate mRNA, reverse transcription and synthetic double chain cDNA utilize restriction endonuclease NlaIII to cut off double-stranded cDNA, connect the joint have the Mmel enzyme recognition site, cutting the length that acquisition has a CATG site with the Mmel enzyme then is the fragment of 21bp;

(b) utilize Illumina platform synthetic gene expression tag library and checking order, selecting length is that 21bp and copy number are higher than 1 label;

(c) abundance (expression amount) of each gene expression label of statistics (b) acquisition.

In another preference, step (2) comprising:

(a) total RNA of extraction species to be measured isolates the mRNA that 3 ' end has polyA, interrupts mRNA at random and reclaims 200-700bp fragment, reverse transcription and synthetic double chain cDNA;

(b) sequence that (a) obtained checks order;

(c) sequencing result is spliced and assembling, obtain Unigene, and determine its direction.

In another preference, in the step (3), described comparison and analysis also comprise: CDS prediction, expression analysis, transcript analysis.

In another preference, described expression analysis comprises: gene annotation, and the differential expression analysis, the expression amount analysis, the expression pattern analysis, the KEGG functional annotation, the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.

In another preference, described species are Ostrinia furnacalis (Ostrinia furnacalis Guen é e).

In another aspect of this invention, provide a kind of method that obtains the gene expression profile of Ostrinia furnacalis, comprising:

(S1) digital gene express spectra (the Digital GeneExpression-tag Profile of a certain developmental stage of acquisition Ostrinia furnacalis; DGE-tag), comprising the sequence and the abundance of gene expression label (Tag);

(S2) gene expression label that (S1) obtained is carried out bioinformatic analysis, thereby learns gene, its potential function, its expression amount or the expression pattern of this label correspondence.

In a preference, described developmental stage includes, but is not limited to: ovum phase, larval stage, pupa time, adult stage.

In another preference, step (S1) comprising:

(a1) total RNA of extraction Ostrinia furnacalis, isolate mRNA, reverse transcription and synthetic double chain cDNA utilize restriction endonuclease NlaIII to cut off double-stranded cDNA, connect the joint have the Mmel enzyme recognition site, cutting the length that acquisition has a CATG site with the Mmel enzyme then is the fragment of 21bp;

(b1) utilize Illumina platform synthetic gene expression tag library and checking order, selecting length is that 21bp and copy number are higher than 1 label;

(c1) abundance (expression amount) of each gene expression label of statistics (b1) acquisition.

In another preference, in the step (S2), described bioinformatic analysis includes, but is not limited to:

Gene annotation, stdn (also comprise that the Tag expression amount is distributional analysis, order-checking saturation analysis, experimental repeatability analysis therebetween or before, total, peculiar, difference Tag analyzes), differential gene screening (also comprising the gene expression amount statistics therebetween or before, the transcription analysis of antisense strand).

In another preference, described difference expression gene screening comprises: the expression pattern cluster analysis, and the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.

In another aspect of this invention, provide a kind of gene information of Ostrinia furnacalis and method of functional gene of obtaining, comprising:

(B1) the range gene transcript in the full genome of acquisition Ostrinia furnacalis;

(B2) gene transcripts that (B1) obtained carries out bioinformatic analysis respectively, thereby obtains gene information (comprising gene expression amount information, gene annotation information and gene function information) and the functional gene of Ostrinia furnacalis.

In a preference, step (B1) comprising:

(a1) total RNA of extraction Ostrinia furnacalis isolates the mRNA that 3 ' end has polyA, interrupts mRNA at random and reclaims 200-700bp fragment, reverse transcription and synthetic double chain cDNA;

(b1) sequence that (a1) obtained checks order;

(c1) sequencing result is spliced and assembling, obtain Unigene, and determine its direction.

In another preference, in the step (B2), described bioinformatic analysis includes, but is not limited to: gene annotation, CDS prediction, difference expression gene screening.

In another preference, described gene annotation comprises: expression amount note, functional annotation.

In another preference, described difference expression gene screening comprises: the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

The schematic flow sheet of Fig. 1, DGE-tag test method.

The data analysis schematic flow sheet of Fig. 2, DGE-tag.

The sample preparation of Fig. 3, RNA-seq and order-checking schematic flow sheet.

Fig. 4, RNA-seq data analysis schematic flow sheet.

The schematic flow sheet of the test method that two kinds of methods of Fig. 5, DGE-tag and RNA-seq are integrated.

The schematic flow sheet of the analytical procedure that two kinds of methods of Fig. 6, DGE-tag and RNA-seq are integrated.

Fig. 7, employing GO note carry out the statistical graph of functional annotation to some genes.

Embodiment

At the technical barrier that is difficult to from the species of no genome reference sequences, obtain gene information at present, the inventor is through extensive and deep research, first the DGE-tag technology is combined with the RNA-seq technology, be used for obtaining gene information from the species of no genome reference sequences, described method is convenient, fast, accurate and with low cost.In view of the problem that does not have further investigation in the present prior art for the genome sequence of Ostrinia furnacalis, gene information, gene function and expression that the inventor also utilizes DGE-tag technology and combining of RNA-seq technology and two kinds of methods to excavate a lot of Ostrinia furnacalis different development stages respectively.

The DGE-tag technology

(Digital Gene Expression Tag Profile DGE-tag) is based on the full genomic expression spectral technology of s-generation sequencing technologies to the digital gene express spectra, with the gene of the Tag-seq mark specifically expressing of 3 ' terminal 21bp.Utilize high-flux sequence to obtain the special label of millions of genes, and indicate this expression of gene amount, and the sequence signal of numeral can reflect the truly expressed situation of corresponding gene accurately, specifically with the Tag-seq multiplicity.This technology can be fast, comprehensively, information such as the gene expression dose under high throughput testing particular organization or the different states situation and sample room gene expression difference.Because sequence need not prior design, the DGE data have splendid real-time, can cover the gene of many not notes, hold complete genomic expression conditions more comprehensively, exactly, for the discovery of gene newly provides good clue.Yet because the sequence label that the DGE-tag technology obtains has only 21bp, obtaining full-length gene based on this weak point sequence also needs complicated analytical procedure, may cause disappearance or mispairing when it is carried out gene annotation.

Described DGE-tag mainly comprises following steps: the extraction of the total RNA of sample (comprising: need total RNA extraction carrying out purifying, the DNA enzyme is handled, and obtains all satisfactory samples of energy (must reach Agilent 2100 and detect requirement) of purity, quality); The separation of mRNA and cDNA's is synthetic; Tag preparation and order-checking (utilizing s-generation sequencing technologies to obtain Tag-seq); And bioinformatic analysis, for example comprise the order-checking assessment, the genetic expression note, the screening of difference expression gene, the transcription analysis of antisense strand, the differential gene expression pattern clustering is analyzed, the enrichment of Gene Ontology function significance is analyzed, and the enrichment of Pathway significance is analyzed.

By above method, obtain maximized tag information quickly and efficiently, the screening target gene is identified to be present in the different transcripts of species different development stage to be measured and to predict its function.

As preferred implementation of the present invention, described DGE-tag method is applied in the middle of the research of Ostrinia furnacalis first.Utilize the DGE-tag technology, start with from the Ostrinia furnacalis development by metamorphosis, obtain the full genomic expression spectrum of four developmental stages (ovum phase, larval stage, pupa time, adult stage), and all information that obtains carried out bioinformatic analysis, the screening difference expression gene, the analytic function gene, and predict possible functional gene regulatory pathway.

Adopt the method for described DGE-tag, obtained 320985 Tag-seq sequences of Ostrinia furnacalis ovum, larva, pupa, four developmental stages of adult first; The number of tags that four developmental stages obtain note is respectively 31504,33081,33340 and 37352.Adopt method of the present invention, after all DGE-tag of Ostrinia furnacalis are carried out functional annotation, obtain the note of totally 35779 functional genes, comprise 8415 of ovum phases, 7988 of larval stages, 9123 of pupa time, adult stage 10253 functional genes.The information that obtains comprises: Tag sequence, copy number and standardized value that gene title, annotation information, GO function prediction, Blast nr, gene pairs are answered.

Adopt the method for described DGE-tag, advantage is as follows:

(1) high-throughput has obtained the full genomic expression spectrum of each developmental stage of species to be measured (as Ostrinia furnacalis), determines genetic expression period and abundance by the statistical study to sequence label;

(2) fast, low cost, high-throughput, obtain the target gene information of species to be measured (as Ostrinia furnacalis) to high timeliness;

(3) difference expression gene and the antisense strand regulatory gene of a large amount of species to be measured (as Ostrinia furnacalis) different development stage have been obtained;

(4) obtain a large amount of species to be measured (as Ostrinia furnacalis) gene function information and participate in the information of metabolic pathway, for further research provides reference information.

The RNA-seq technology

The RNA-seq technology is meant and all transcripts (comprising: mRNA, smallRNA and non-coding RNA) in the next cell of certain period certain condition are checked order and carries out relative quantification.The RNA-seq technology can obtain specific cells, organize the total RNA under certain state, can detect nearly all transcript apace, and this technology provides technical support for the genomic expression of studying a certain species.

RNA-seq is used at transcript structures (UTR zone evaluation, intron/exon evaluation, variable shearing, the evaluation of promoter zone etc.), non-coding region function (non-coding RNA, microRNA etc.), gene transcription level and newly transcribes regional research, RNA-seq checks order by mRNA and obtains the sequence of about 75bp, obtains the full length sequence of gene by the assembling splicing.Utilize this method can be fast, high-throughput obtains species all transcript sequence information of genome and express abundance in vegetative period, by information biology software its sequence and existing nearly source species database (as European corn borer, silkworm and fruit bat) are compared then, obtain the annotation information of gene, and classify and the pathway analysis.For comparison less than sequence, can carry out CDS scanning, then its function is predicted.

Described RNA-seq mainly comprises following steps: the extraction of the total RNA of sample (comprising: total RNA is extracted carry out purifying, the DNA enzyme is handled, and obtains all satisfactory samples of energy of purity, quality, must reach the Agilent2100 detection and require); Tag preparation and order-checking; The separation of mRNA and the order-checking of RNA-seq (preferably utilizing s-generation sequencing technologies); The impurity data are rejected in data analysis, and the result after the RNA-seq assembling is integrated; Bioinformatic analysis (Blast analysis, GO note, KEGG note, predicted gene function).

As preferred implementation of the present invention, adopt the sequence information of described RNA-seq technical measurement Ostrinia furnacalis all transcripts of genome in vegetative period and express abundance information, and Ostrinia furnacalis genome transcript functional annotation and pathway analysis have been carried out based on these information, and high-throughput ground is to gene expression amount, and differential expression etc. are analyzed.Method by RNA-seq is compared with traditional gene functional research, is all optimized significantly from the cycle, the quantity of data, the quality that obtain data, has saved a large amount of workloads and experimentation cost simultaneously.

The method of described RNA-seq is applied at first obtain the information of the complete budding cDNA sequence of Ostrinia furnacalis by the RNA-seq technology in the Ostrinia furnacalis research, obtained 97407 sequence informations altogether; Article 46986, Unigene; Comprise RNA-seq title, sequence length and express totally 46884 information of number, COG prediction, COG functional annotation, KEGG note, KEGG-pathway, GO note; And comprise protein function note totally 16443 information that the sequence information that obtains is carried out the prediction of CDS nucleotide sequence.

Adopt the method for described RNA-seq, advantage is as follows:

(1) high-throughput obtains all transcript sequence informations of species to be measured (as Ostrinia furnacalis) genome;

(2) obtain species to be measured (as Ostrinia furnacalis) gene expression abundance information and differential expression fast;

(3) a large amount of fast annotation information that obtain species to be measured (as Ostrinia furnacalis) genome transcript;

(4) can carry out structure prediction and functional analysis to species to be measured (as Ostrinia furnacalis) unknown function gene.

The combination of DGE-tag and RNA-seq technology is used

Utilize the combination of DGE-tag and RNA-seq technology, can excavate the gene information of no genome reference sequences species easily.Specific design is to utilize the sequencing technologies of a new generation, excavates the gene information of no genome reference sequences species and the method that functional gene is found fast based on DGE-tag and RNA-seq technology.

The inventor finds, the RNA-seq technology can remedy the deficiency of DGE-tag technology, directly check order and to result's analysis by mRNA, can obtain the gene order information of all transcripts, with interested tag sequence and RNA-seq result's comparison, can directly analyze the information of goal gene, and, owing to obtained the information of a large amount of gene orders, when it is analyzed, guaranteed result's accuracy.

The combination of DGE-tag and RNA-seq technology mainly comprises following steps:

1. the extraction of the total RNA of sample (must reach Agilent 2100 and detect requirement).This step needs total RNA extraction carrying out purifying, and the DNA enzyme is handled, and obtaining purity, quality all can satisfactory sample.

2.Tag preparation and order-checking.

3.mRNA separation and the order-checking of RNA-seq.

4. the impurity data are rejected in data analysis, and the result after Tag sequence and the RNA-seq assembling integrates.Data are integrated the maximized gene information of acquisition rapidly and efficiently by bioinformatic analysis.

5. from comparison result, screen interested gene or genome.

6. bioinformatic analysis (Blast analysis, GO note, KEGG note, predicted gene function).

7. excavate new gene (UTR zone, interior apparent son/exon, variable shearing, promoter region etc.) and carry out functional study.

Wherein, step 5,6,7 utilizes bioinformatic analysis to excavate target gene, and evaluation may be present in the intravital position of animal or plant, developmental stage and predict its function.

The present invention can be used for not having the genomics and the functional genomics research of genome reference sequences species.Can directly obtain still not have all transcript information of genome sequence species by described method, be used for further functional study.Method of the present invention is compared with the research of traditional gene function aspect, from the quantity of cycle of obtaining data, data, all optimized significantly qualitatively, has saved a large amount of workloads and experimentation cost simultaneously.

With respect to prior art, with having the following advantages of DGE-tag and RNA-seq technology in conjunction with using:

1) high-throughout method obtains the transcript information of no genome reference sequences species;

2) obtain the gene expression difference of gene or sample room fast;

3) low cost, high-throughput, high timeliness ground obtain the information of target gene;

4) two kinds of methods combine, and the result can replenish mutually, checking mutually, and the data that obtain are more accurate reliable.

As preferred implementation of the present invention, based on the DGE-tag technology of new-generation sequencing technology and RNA-seq technology combine the tag sequence of 3 ' the end 21bp that obtains unknown gene group species transcript information and the mRNA sequence information of transcript, obtain a series of gene informations such as CDS sequence, gene expression amount, gene function note of target gene by bioinformatic analysis.

Utilize method of the present invention, apply to first in the middle of the research of Pyrausta nubilalis (Hubern)., at first obtained the RNA-seq sequence of the full developmental stage of Pyrausta nubilalis (Hubern). and Pyrausta nubilalis (Hubern). ovum, larva, pupa, the adult DGE-tag sequence in four periods by order-checking, in conjunction with obtain to have the cDNA sequence with the gene information of expressing note, totally 35780 sequence informations.And having obtained the expression amount difference of these genes at different development stage, and information such as gene function note for the research of Pyrausta nubilalis (Hubern). functional gene provides lot of data, illustrates that the present invention has very high operability and repeatability.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

Embodiment 1, acquisition DGE-tag

DGE-tag analysis with Ostrinia furnacalis is an example, and method steps is as follows, and simple and clear experiment flow is seen Fig. 1 and Fig. 2.

1. the extraction of the total RNA of Ostrinia furnacalis

Adopt conventional Trizol method to extract, the ordinary method purifying, the DNA enzyme is handled, and acquisition concentration 〉=300ng/ul, total amount 〉=6ug, OD260/280 are 1.8～2.2 Total RNA sample (must reach Agilent 2100 and detect requirement).

2.mRNA separation and cDNA synthetic

Isolate the mRNA that has polyA with the magnetic bead that has oligo-dT, then with synthetic cDNA first chain of the Superscript II reverse transcriptase test kit of 6 polymers at random and Invitrogen.CDNA second chain is to finish with RNase H (Invitrogen) and dna polymerase i (New England BioLabs).

3.Tag preparation and order-checking

Utilize synthetic good double-stranded cDNA, the inventor uses NlaIII, CATG site on its identification and the cut-out cDNA utilizes the magnetic bead deposition and purification to have the fragment of cDNA 3 ' end, and its 5 ' end is connected Illumina joint 1 (5 ' P-TCGGACTGTAGAACTCTGAAC (SEQ ID NO:6); 5 ' ACAGGTTCAGAGTTCTACAGTCCGACATG (SEQ ID NO:7)).Illumina joint 1 is the recognition site of MmeI with the junction in CATG site, and MmeI is a kind of recognition site and the isolating restriction endonuclease of restriction enzyme site, and enzyme is cut 17bp place, downstream, CATG site, has so just produced the Tag that has joint 1.After magnetic bead precipitation removal 3 ' fragment, at Tag 3 ' the terminal Illumina joint 2 (5 ' CAAGCAGAAGACGGCATACGANN (SEQ ID NO:8) that connect; 5 ' P-TCGTATGCCGTCTTCTGCTTG (SEQ ID NO:9)), thus obtain the 21bp label library that two ends are connected with different joint sequences.Behind 15 round-robin PCR linear amplifications, by 6%TBE PAGE gel electrophoresis purifying 85 base bands, after unwinding, single chain molecule is added to Solexa sequence testing chip (flowcell) to be gone up and fixes, amplification becomes a unit molecule bunch (cluster) sequencing template to every molecule through original position, add 4 looks fluorescently-labeled, 4 kinds of Nucleotide, adopt while synthesizing sequencing (sequencing by synthesis, SBS) order-checking.Each passage will produce millions of original Read, and the long 35bp that is is read in the order-checking of Read.

4. data analysis

Analysis process is as shown in Figure 2, and is specific as follows:

(a) raw data is carried out base conditioning, obtain high-quality Tag sequence: original series has one section 3 ' adaptor sequence, the Tag that contains unknown base N, long or the too short Tag and the copy number that do not meet 21nt are Tag of 1 etc., utilize corresponding identification software to handle, removing what obtain after these impurity sequences is Clean Tag.

(b) by the quantity of each Clean Tag sequence of statistics, obtain the corresponding expression of gene amount of this Tag label: the Clean Tag that obtains after impurity composition is removed, wherein the copy number of Tag has reflected the expression amount of corresponding gene.

Embodiment 2, DGE-tag analyze

DGE-tag analyzes the embodiment 1 that continues, and proceeds following steps:

(c) Tag is carried out note, set up the corresponding relation of Tag and gene: because Ostrinia furnacalis is not with reference to gene data, the inventor is with reference to the Ostrinia furnacalis RNA-seq data of finishing simultaneously, utilize all CATG sites in the software retrieval Ostrinia furnacalis RNA-seq data, generate the reference label database of CATG+17nt base.Then with whole Clean Tag and the comparison of reference label database, allow maximum base mispairings, unique label (Unambiguous Tags) of comparing a gene is wherein carried out gene annotation, add up the original Clean Tag number that each gene pairs is answered, then original Clean Tag number is done standardization, obtain standardized gene expression amount, thus more accurate, scientifically weigh the expression of gene level.Standardized method is: total clean Tags number * 1 in original Clean Tags number/this sample that each gene comprises, 000,000 (referring to ' t Hoen, P.A., Y.Ariyurek, et al. (2008). " Deep sequencing-basedexpression analysis shows major advances in robustness, resolution and inter-labportability over five microarray platforms. " Nucleic Acids Res 36 (21): e141; Morrissy, A.S., R.D.Morin, et al. (2009). " Next-generation tag sequencing forcancer gene expression profiling. " Genome Res.).

(d) gene is analyzed at the sample room differential expression: the digitizing Difference of Gene Expression Profile gene tester (Audic that delivers with reference to people such as Audic S., S.and J.M.Claverie (1997). " The significance ofdigital gene expression profiles. " Genome Res 7 (10): 986-95), screen the difference expression gene between two samples.

(e) gene is a kind of important way of gene expression regulation at the relation between expression amount: Sense-antisense on positive-sense strand and the antisense strand.If the order-checking label can be compared the antisense strand of gene, the antisense strand that then hints this gene also comprises transcript, this gene may exist the sense-antisense control methods (referring to ' t Hoen, P.A., Y.Ariyurek, et al. (2008). " Deep sequencing-based expression analysis showsmaj or advances in robustness, resolution and inter-lab portability over fivemicroarray platforms. " Nucleic Acids Res 36 (21): e141).

(f) cluster analysis of difference expression gene: the similar gene of expression pattern has similar function usually.The inventor utilizes cluster software (Eisen, M.B., P.T.Spellman, et al. (1998). " Clusteranalysis and display of genome-wide expression patterns. " Proc Natl Acad Sci U SA 95 (25): 14863-8), with Euclidean distance is apart from the matrix calculation formula, difference expression gene and experiment condition are carried out the grade cluster analysis simultaneously, cluster result with javaTreeview show (referring to Saldanha, A.J. (2004). " Java Treeview--extensible visualization of microarray data. " Bioinformatics 20 (17): 3246-8).Represent an experiment condition with every row, every row is represented a gene, and the different variation multiples of expressing are represented with different colours, red expression up-regulated, green expression down-regulated expression.

(g) enrichment of Gene Ontology (GO) function significance is analyzed: GO always has three ontology (body), describes the molecular function (molecular function), residing cell position (cellularcomponent) of gene, the bioprocess (biological process) that participates in respectively.The fundamental unit of GO is term (entry, a node), all corresponding attribute of each term.The enrichment of GO function significance is analyzed at first each the term mapping to Gene Ontology database (http://www.geneontology.org/) of all differences expressing gene, calculate the number gene of each term, use the hypergeometry check then, find out with the whole genome background and compare, the GO clauses and subclauses of significant enrichment in difference expression gene.

The enrichment of Pathway significance is analyzed: in vivo, different genes coordinates to exercise its biology mutually, helps further to understand the biological function of gene based on the analysis of Pathway.KEGG is the main public database (Kanehisa of relevant Pathway, M., M.Araki, et al. (2008). " KEGG forlinking genomes to life and the environment. " Nucleic Acids Res 36 (Databaseissue): D480-4), it is unit that the enrichment of Pathway significance is analyzed with KEGG Pathway, the check of application hypergeometry is found out with the whole genome background and is compared, the Pathway of significance enrichment in difference expression gene.Determine main biochemical metabolism approach and the signal transduction pathway that difference expression gene participates in by the enrichment of Pathway significance.

Embodiment 3, RNA-seq analyze

Sample preparation and order-checking flow process are seen Fig. 3.Concrete grammar is as follows:

1. the extraction of Ostrinia furnacalis Total RNA

Adopt the Trizol method of routine to extract, purifying, the DNA enzyme is handled, and acquisition concentration 〉=300ng/ul, total amount 〉=6ug, OD260/280 are 1.8～2.2 Total RNA sample (must reach Agilent 2100 and detect requirement).

2.mRNA separation and interrupt at random

Isolate the mRNA that has polyA with the magnetic bead that has oligo-dT, utilize ultrasonic wave to interrupt at random then, reclaim the fragment of 200-700bp.

3.cDNA first chain and second chain is synthetic

CDNA first chain synthetic is to carry out with the Superscript II reversetranscriptase test kit of 6 polymers and Invitrogen at random.CDNA second chain is to finish with RNase H (Invitrogen) and dna polymerase i (New England BioLabs).

On the cDNA fragment in the grappling by the joint sequence that provides in the Illumina/Solexa sequencing kit:

5′RNA?Adapter(SEQ?ID?NO：10)：

5′P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG；

3′RNA?Adapter(SEQ?ID?NO：11)：

5′ACACTCTTTCCCTACACGACGCTCTTCCGATCT；

5.PCR amplification

Carry out 15 round-robin pcr amplifications with the primer in the above-mentioned joint sequence.

6. library construction and detection

Utilize the sequence that obtains in the above-mentioned steps, carry out library construction and detection according to the sample prep kit of Illumina company.

7.RNA-seq order-checking

The library of the building up concentration with 5-7pM is added on the respective channel of Illumina sequenator (Genome Analyzer II) 36 circulations of method operation that provide according to manufacturers.

8. data analysis

Quick-reading flow sheets is seen Fig. 4.Reject the impurity data, the result after the RNA-seq assembling is integrated.What step before obtained is raw data, wherein contains in steps the joint sequence that adds in 4, and it will be called Clean reads after removing, and just can splice and assembles.Concrete grammar is to utilize the Cleanreads that obtains, and utilizes composite software SOAPdenovo, is published in the method that Genome Res. the last the 20th rolls up on the 265-272 page or leaf in 2010 according to Li etc. and carries out.The reads that SOAPdenovo at first will have certain-length overlap is linked to be longer fragment, and these are referred to as Contig by the assembling fragment inventor who does not contain N that reads overlap relation obtains.Then, reads is compared back Contig, can determine that by paired-end reads SOAPdenovo connects together these Contig from the different Contig of same transcript and the distance between these Contig, middle unknown nucleotide sequence is represented with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and handle, it is minimum to obtain containing N at last, and the sequence that two ends can not prolong again is referred to as Unigene.

9. bioinformatic analysis

The above-mentioned Unigene sequence that obtains and albumen database nr, Swiss-Prot, KEGG and COG are done blastx comparison (evalue＜0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between the different sink is contradictory, then determine the sequence direction of Unigene by the priority of nr, Swiss-Prot, KEGG and COG, with above four storehouses all less than Unigene, with software ESTScan (Iseli, Jongeneel etc. 1999, Menlo Park ed. (AAAI Press) pp.138-148.) predicts its coding region and determine the direction of sequence.For the Unigene that can determine the sequence direction, provide the sequence of its from 5 ' to 3 ' direction; For the Unigene that can't determine the sequence direction, provide the sequence that composite software obtains.

The application example analysis that embodiment 4, DGE-Tag and RNA-seq combine for example

Utilize method of the present invention, apply in the middle of the research of Pyrausta nubilalis (Hubern)., thereby obtained the RNA-seq sequence of the full developmental stage of Pyrausta nubilalis (Hubern). and Pyrausta nubilalis (Hubern). ovum, larva, pupa, the adult DGE-tag sequence in four periods.

Wherein, utilize the DGE-tag technology, finish at four developmental stages of Ostrinia furnacalis note of totally 35779 functional genes (8415 of ovum phases, 7988 of larval stages, 9123 of pupa time, 10253 of adult stages).Obtain the step of the method for DGE-tag referring to embodiment 1.

Wherein, utilize the RNA-seq technology to obtain the information of the complete budding cDNA sequence of Ostrinia furnacalis, obtained 46986 Unigene altogether.The method that obtains is referring to the step of embodiment 3.

How utilizing these data is key problems of the present invention.As shown in the table, the inventor has found several Tag (as shown in table 1) that surpass 10000 times at the copy number average of ovum phase gene, they have nothing in common with each other at the copy number of other 3 developmental stages, and the expression amount in some Tag other 3 periods is also very high, and some Tag does not express at other 1-3 a period.

Each copy number in period Tag above 10,000 times of table 1. for example

The ovum phase	Larval stage	Pupa time	Adult stage	Tag
					21200	15301	8776	4798	CATGGACTCCGCCGAGGGAGA (SEQ?ID?NO：1)
18714	0	0	3136	CATGTGACTCTTAACACTATA (SEQ?ID?NO：2)
					16884	14640	10544	11967	CATGGATTACATGTAATAATT (SEQ?ID?NO：3)
13213	0	0	0	CATGTACATCGCAATTTGGCT (SEQ?ID?NO：4)
					11888	15326	7573	5850	CATGGGCACGCTCAAGAAGGA (SEQ?ID?NO：5)

For the function of identifying that these genes are possible, the inventor just utilizes these Tag as sequence label,

From the RNA-seq database, compare, therefrom find the note gene of these Tag correspondences and corresponding 5 gene function, thereby can carry out detailed research this gene.Two kinds of streams that method is integrated and analyzed

Journey is referring to Fig. 5.Utilize the example of the gene function that DGE-tag and RNA-seq infer to see Table 2.

Gene expression amount and function thereof that table 2. utilizes DGE-tag and RNA-seq to infer

The analytical results that embodiment 5, DGE-Tag and RNA-seq combine

Utilize described method of the present invention, apply in the middle of the research of Pyrausta nubilalis (Hubern)., obtained the RNA-seq sequence of the full developmental stage of Pyrausta nubilalis (Hubern). and Pyrausta nubilalis (Hubern). ovum, larva, pupa, the adult DGE-tag sequence in four periods, combination obtain to have the cDNA sequence with the gene information of expressing note, totally 35779 sequence informations comprise DGE-tag sequence title, the tag sequence, the RNA-seq title, sequence is expressed period, expression amount and functional annotation and CDS sequence.

Method is summarized as follows:

1. 46986 Unigene of Ostrinia furnacalis have been obtained by RNA-seq.

2. obtained Ostrinia furnacalis four different development stages by DGE-tag tag and expression more than 3,600,000 have respectively been arranged.

3. obtained the note of 35779 Unigene by confluence analysis, expression period and expression amount analysis, data such as functional annotation.

4. these genes are carried out functional annotation, comprised COG classification and GO note.The partial analysis situation as shown in Figure 7.

5. by analyzing the annotation information that directly obtains specific expression gene in each in period, the expression pattern of different development stage, gene order information is as table 3.

The function and the expression amount analysis of the corresponding gene of table 3. different development stage

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉obtain the method for gene information and functional gene from no genome reference sequences species

<130>102572

<160>11

<170>PatentIn?version?3.3

<210>1

<211>21

<212>DNA

＜213〉Ostrinia furnacalis (Ostrinia furnacalis Guen é e)

<400>1

catggactcc?gccgagggag?a 21

<210>2

<211>21

<212>DNA

＜213〉Ostrinia furnacalis (Ostrinia furnacalis Guen é e)

<400>2

catgtgactc?ttaacactat?a 21

<210>3

<211>21

<212>DNA

＜213〉Ostrinia furnacalis (Ostrinia furnacalis Guen é e)

<400>3

catggattac?atgtaataat?t 21

<210>4

<211>21

<212>DNA

＜213〉Ostrinia furnacalis (Ostrinia furnacalis Guen é e)

<400>4

catgtacatc?gcaatttggc?t 21

<210>5

<211>21

<212>DNA

＜213〉Ostrinia furnacalis (Ostrinia furnacalis Guen é e)

<400>5

catgggcacg?ctcaagaagg?a 21

<210>6

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>6

tcggactgta?gaactctgaa?c 21

<210>7

<211>29

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>7

acaggttcag?agttctacag?tccgacatg 29

<210>8

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<220>

<221>misc_feature

<222>(22)..(23)

<223>n?is?a，c，g，or?t

<400>8

caagcagaag?acggcatacg?ann 23

<210>9

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>9

tcgtatgccg?tcttctgctt?g 21

<210>10

<211>33

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>10

gatcggaaga?gctcgtatgc?cgtcttctgc?ttg 33

<210>11

<211>33

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉oligonucleotide

<400>11

acactctttc?cctacacgac?gctcttccga?tct 33

Claims

1. excavate the method for gene information from no genome reference sequences species for one kind, comprising:

(1) the digital gene express spectra of acquisition species to be measured is comprising the sequence and the abundance of gene expression label;

(2) set of the full genome transcript of acquisition species to be measured forms sequence library;

2. the method for claim 1 is characterized in that, described species to be measured are in a certain period of growth.

3. the method for claim 1 is characterized in that, step (1) comprising:

(c) abundance of each gene expression label of statistics (b) acquisition.

4. the method for claim 1 is characterized in that, step (2) comprising:

(b) sequence that (a) obtained checks order;

5. the method for claim 1 is characterized in that, in the step (3), described comparison and analysis also comprise: CDS prediction, expression analysis, transcript analysis.

6. method as claimed in claim 5 is characterized in that, described expression analysis comprises: gene annotation, and the differential expression analysis, the expression amount analysis, the expression pattern analysis, the KEGG functional annotation, the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.

7. the method for claim 1 is characterized in that, described species are Ostrinia furnacalis (Ostrinia furnacalis Guen é e).

8. method that obtains the gene expression profile of Ostrinia furnacalis comprises:

(S1) the digital gene express spectra of a certain developmental stage of acquisition Ostrinia furnacalis is comprising the sequence and the abundance of gene expression label;

9. method as claimed in claim 8 is characterized in that, described developmental stage comprises: ovum phase, larval stage, pupa time, adult stage.

10. method as claimed in claim 8 is characterized in that, step (S1) comprising:

11. method as claimed in claim 8 is characterized in that, in the step (S2), described bioinformatic analysis comprises:

Gene annotation, stdn, the differential gene screening.

12. method as claimed in claim 11 is characterized in that, described difference expression gene screening comprises: the expression pattern cluster analysis, and the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.

13. one kind obtains the gene information of Ostrinia furnacalis and the method for functional gene, comprising:

(B2) gene transcripts that (B1) obtained carries out bioinformatic analysis respectively, thereby obtains gene information and the functional gene of Ostrinia furnacalis.

14. method as claimed in claim 13 is characterized in that, step (B1) comprising:

(b1) sequence that (a1) obtained checks order;

15. method as claimed in claim 13 is characterized in that, in the step (B2), described bioinformatic analysis comprises: gene annotation, CDS prediction, difference expression gene screening.

16. method as claimed in claim 15 is characterized in that, described gene annotation comprises: expression amount note, functional annotation.

17. method as claimed in claim 15 is characterized in that, described difference expression gene screening comprises: the enrichment of GO function significance is analyzed, and the enrichment of Pathway significance is analyzed.